A mesenchymal stem cell-targeted dual-microRNA functionalized tetrahedral framework nucleic acid and its preparation method and use

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to a mesenchymal stem cell-targeted dual-microRNA functionalized tetrahedral framework nucleic acid, and a preparation method and use thereof. The present invention provides a nucleic acid aptamer with a mesenchymal stem cell targeting effect. And based on the nucleic acid aptamer, a dual-miRNA delivery system with a mesenchymal stem cell targeting effect is designed, which integrates the cell targeting of the nucleic acid aptamer, the biological advantages of the tetrahedral framework nucleic acid, and the function of miRNA in promoting cartilage differentiation of mesenchymal stem cells in the joint and inhibiting hypertrophy and degeneration processes, thereby achieving the purpose of high-quality endogenous repair of articular cartilage. The delivery system of the present invention is of great significance for promoting the effectiveness and accuracy of cartilage injury treatment, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a mesenchymal stem cell-targeted dual-microRNA functionalized tetrahedral framework nucleic acid, and a preparation method and use thereof. Background Art

[0002] Treatment of articular cartilage (AC) damage caused by trauma, inflammation, or chronic strain is a major challenge in regenerative medicine and clinical needs. Natural regeneration of AC is difficult to achieve due to its avascular state and insufficient nutrient supply. Current surgical treatment strategies for AC repair include microfracture techniques, autologous or allogeneic cartilage transplantation, and cartilage scaffold implantation. However, according to long-term follow-up results, these surgical strategies usually lead to fibrocartilage formation instead of durable, well-functioning hyaline cartilage. To address this problem, in recent years, mesenchymal stem cell (MSCs)-based therapy has developed rapidly as a frontier field and has achieved encouraging results. However, this therapy still has some potential problems, such as the high cost of in vitro culture and the loss of cell function after induction, which has an adverse effect on the effectiveness of this therapy.

[0003] Despite the relatively poor quality of the regenerated tissue, the effectiveness of the microfracture technique suggests that repair of AC injuries can be achieved by directly stimulating endogenous MSCs within the joint cavity. Previous studies have demonstrated the presence of MSCs in multiple locations within the joint, such as the bone marrow, infrapatellar fat pad, and synovium. When the AC is damaged, these resident intra-articular MSCs migrate to the site of injury and undergo chondrogenic differentiation, which is known as endogenous repair. Notably, osteotomy and knee distraction, two common methods for treating osteoarthritis, also rely on this endogenous repair capacity. Unfortunately, due to the destruction of the intra-articular microenvironment, the chondrogenic differentiation process of endogenous MSCs without intervention will gradually degenerate over time, ultimately leading to the formation of a hypertrophic chondrocyte-like phenotype. Therefore, developing therapeutic strategies that can regulate the differentiation fate of endogenous MSCs and enhance their endogenous repair capacity is a promising clinical translational approach to help address the problem of AC regeneration.

[0004] MicroRNA (miRNA) regulates gene expression by interfering with mRNA translation and plays an important role in cell fate determination. In particular, miRNA plays a key role in cartilage development and homeostasis and chondrogenic differentiation of MSCs and is an important regulatory factor. Among them, miR-140 is a key up-regulatory factor induced by SOX9 with cartilage specificity and plays a central role in chondrogenic differentiation of MSCs. Karlsen et al. demonstrated that miR-140 enhances chondrogenic differentiation of human MSCs by targeting RALA (Stem Cells Dev. 2014, 23, 290.). Zhao et al. reported that combined gene therapy by intra-articular injection of IGF-1 and miR-140 can improve cartilage damage repair (Biomed Res Int 2019, 2019, 2761241.). In addition, Rajagopal et al. found that continuous delivery of miR-140 to MSCs in a three-dimensional (3D) matrix can form hyaline cartilage-like tissue, reduce hypertrophy, and successfully simulate the endogenous stem cell-mediated cartilage repair process (Cartilage 2021, 13, 571.). In addition, recent studies have revealed that another key positive regulator, miR-455, is involved in the chondrogenic differentiation of MSCs (Osteoarthr. Cartil. 2012, 20, 1638.; Nat Commun 2021, 12, 4148.). Studies have shown that the high expression of Sox9 during the chondrogenic differentiation of MSCs will lead to the upregulation of miR-455-5p and miR-455-3p. Zhang et al. have shown in several published studies that miR-455-3p can directly target Runx2 to activate early chondrogenesis and inhibit the degeneration process of MSC chondrogenic differentiation through DNA methylation. At the same time, Sun et al. confirmed that exosomes secreted by bone marrow MSCs pretreated with TGF-β3 promoted articular cartilage regeneration by delivering miR-455.

[0005] In summary, miR-140 and miR-455 are two promising candidate molecules for regulating the differentiation of endogenous MSCs and enhancing the endogenous repair capacity of articular cartilage. However, due to their inherent limitations, such as poor stability, compatibility with commonly used delivery vectors, cytotoxicity, and high off-target effects, miRNAs are greatly restricted in clinical application. Therefore, it is urgent to develop a targeted co-delivery system that can stably and efficiently deliver miR-140 and miR-455, so as to achieve the purpose of enhancing the endogenous repair capacity of articular cartilage through miRNA. Summary of the invention

[0006] In view of the problems of the prior art, the present invention provides a mesenchymal stem cell-targeted dual-microRNA functionalized tetrahedral framework nucleic acid and a preparation method and use thereof.

[0007] A nucleic acid aptamer, whose nucleotide sequence is shown as SEQ ID NO.1.

[0008] The present invention also provides use of the nucleic acid aptamer in preparing a drug targeting mesenchymal stem cells.

[0009] The present invention also provides a functionalized tetrahedral framework nucleic acid, wherein the functionalized tetrahedral framework nucleic acid is modified with miR-140-5p, miR-455-3p and the nucleic acid aptamer according to claim 1.

[0010] Preferably, it is formed by base complementary pairing of three single-stranded DNAs respectively connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer and a fourth single-stranded DNA.

[0011] Preferably, the single-stranded DNA nucleotide sequence connected with miR-140-5p is shown in SEQ ID NO.2;

[0012] and / or, the single-stranded DNA nucleotide sequence connected to miR-455-3p is shown in SEQ ID NO.3;

[0013] And / or, the single-stranded DNA nucleotide sequence connected to the nucleic acid aptamer is shown in SEQ ID NO.4;

[0014] And / or, the nucleotide sequence of the fourth single-stranded DNA is as shown in SEQ ID NO.5.

[0015] The present invention also provides a method for preparing the functionalized tetrahedral framework nucleic acid, comprising the following steps: incubating three single-stranded DNAs respectively connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer with a fourth single-stranded DNA to obtain the functionalized tetrahedral framework nucleic acid.

[0016] The present invention also provides the use of the functionalized tetrahedral framework nucleic acid in preparing a medicine for treating articular cartilage damage.

[0017] Preferably, the drug is used to promote endogenous cartilage regeneration.

[0018] Preferably, the drug is used to promote cartilage differentiation of mesenchymal stem cells in joints;

[0019] And / or, the drug is used to inhibit hypertrophy and degeneration of mesenchymal stem cells in joints;

[0020] And / or, the drug is used to enhance the migration ability of mesenchymal stem cells.

[0021] And / or, the drug is used to activate HIF-1α and FOXO signaling pathways to enhance mesenchymal stem cells.

[0022] The present invention also provides a medicine for treating articular cartilage damage, which is prepared by using the above-mentioned functionalized tetrahedral framework nucleic acid as an active ingredient and adding pharmaceutically acceptable auxiliary materials.

[0023] In order to achieve the drug targeting MSCs, the present invention provides a new nucleic acid aptamer (hereinafter referred to as Apt19S), which has a good targeting effect on MSCs. Further, in order to improve the current strategy for treating articular cartilage damage, the present invention designs a functionalized tetrahedral framework nucleic acid (hereinafter referred to as ATM) modified with miR-140-5p, miR-455-3p and Apt19S, which is a dual miRNA delivery system with MSCs targeting effect, which integrates the cell targeting of Apt19S, the biological advantages of tFNAs, and the functions of miR-140-5p and miR-455-3p in promoting cartilage differentiation of intra-articular MSCs and inhibiting hypertrophy and degeneration, thereby achieving the purpose of high-quality endogenous repair of AC.

[0024] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0025] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 To verify the experimental results of successful synthesis of tFNAs, TM and ATM by 8% PAGE;

[0027] Figure 2 Experimental results confirming the successful self-assembly of tFNAs, TM, and ATM for HPCE;

[0028] Figure 3 The experimental results of the particle size and zeta potential of tFNAs (A) and ATM (B) detected by nanoparticle potentiometer and dynamic light scattering (DLS);

[0029] Figure 4(A) The molecular structure of ATM observed under atomic force microscopy (AFM), scale bars: 100 nm and 50 nm; (B) The molecular structure of ATM observed under transmission electron microscopy (TEM), scale bars: 100 nm and 50 nm;

[0030] Figure 5 The structural stability of ATM in serum proteins and MSC lysate;

[0031] Figure 6 The uptake of ssDNA, miRNA, TM and ATM by SMSCs after 12 hours was detected by confocal laser scanning microscopy. Scale bar: 25 μm.

[0032] Figure 7 To evaluate the experimental results of ssDNA, miRNA, TM and ATM uptake by SMSCs using flow cytometry;

[0033] Figure 8 The experimental results of analyzing cytotoxicity using CCK-8 kit;

[0034] Fig. 9 The results of the experiment using the scratch healing assay to test whether ATM would affect the effect of tFNAs on enhancing the migration ability of MSCs;

[0035] Fig.10 To determine the expression levels of miR-140-5p and miR-455-3p in each group by RT-PCR;

[0036] Fig.11 AL staining images of SMSC chondrogenic differentiation after 7 days of culture on a 2D tissue culture plate;

[0037] Fig.12 The RT-PCR results of Sox9, Col2a1 and Acan gene expression in each group at 14 days and 21 days; data are expressed as mean ± standard deviation (n = 3). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0038] Fig.13 RT-PCR results of Sox9, Col2a1 and Acan gene expression levels in each group at 14 and 21 days;

[0039] Fig.14(A) H&E, SO, AL staining, Col2 immunohistochemical staining, and Acan immunofluorescence staining images of individual spheroids in different groups at 21 days. (B) Quantitative analysis of H&E, SO, AL staining, Col2 immunohistochemical staining, and Acan immunofluorescence staining. Scale bars: 50 μm and 250 μm.

[0040] Fig.15 Immunofluorescence staining images and quantitative analysis of MMP-13, Runx2 and Col10 of single spheroids in each group at 28 days. Scale bar: 250 μm.

[0041] Fig.16 The RT-PCR results of the gene expression levels of Col10, Runx2 and MMP-13 in each group at 28 days. The data are expressed as mean ± standard deviation (n = 3). Statistical analysis: *p < 0.05, **p < 0.01, **p < 0.001 (the control group is marked with an asterisk (*), and the tFNAs group is marked with a pound sign (#)).

[0042] Fig.17 (A) The principal component analysis (PCA) results of the two groups of samples (n=4). (B) The Venn diagram of gene expression between the two groups.

[0043] Fig.18 (A) Scatter plot of differentially expressed genes (DEGs) and (B) cluster analysis results.

[0044] Fig.19 GO enrichment bar chart of DEGs.

[0045] Fig. 20 (A) KEGG enrichment histogram of DEGs. (B) KEGG repression histogram.

[0046] Fig.21 GSEA enrichment analysis of fatty acid biosynthesis, HIF-1 signaling pathway, FOXO signaling pathway and TGF-BETA signaling pathway between ATM and control groups.

[0047] Fig. 22 (A) Heat map of genes related to cell chondrogenic differentiation. (B) qRT-PCR analysis of genes related to cell hypoxia regulation and chondrogenic differentiation. Data are expressed as mean ± standard deviation (n = 3). Statistical analysis: *p < 0.05, **p < 0.01.

[0048] Fig.23(A) Western blotting to detect the protein expression levels of HIF-1α, FOXO1, FOXO3, and SOX9 in SMSCs under different treatment conditions. (B) Quantitative analysis of WB results. (C)-(F) Immunofluorescence detection of HIF-1α, FOXO1, FOXO3, and SOX9. Scale bar: 25 μm.

[0049] Fig.24 Images at different time points (0, 15, 30, 45, 60, 90 and 120 minutes) after injection of Cy3-labeled miR-140-5p, TM and ATM were acquired using an in vivo fluorescence imaging system.

[0050] Fig.25 (A) Schematic diagram of articular cartilage defect model and ATM treatment in rats after surgery. (B) Immunofluorescence image of Cy3+ / CD90+ cells in the defect site under confocal microscope at 1 week after surgery. (C) Quantitative analysis of Cy3+ / CD90+ cells in the defect site. (D) Overall appearance of each group at 6 and 12 weeks after surgery. (E) ICRS macroscopic repair score. (F) ICRS score heat map (a: defect repair degree, b: boundary integration, c: macroscopic appearance). (G) Micro-CT reconstruction image. (H) Quantitative analysis of BV / TV in the ROI area. (I) Quantitative analysis of BMD in the ROI area. Data are expressed as mean ± SD (n = 3). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0051] Fig.26 H&E staining (A), SO / Fast Green staining (B), colloidal toluidine blue staining (C), and type II collagen immunohistochemical staining (D) of repaired tissues of SD rats 6 and 12 weeks after repair (N represents normal cartilage, and R represents repaired cartilage). Scale bars: 100 μm and 500 μm.

[0052] Fig. 27 This is a heat map of histological parameters after repair in SD rats.

[0053] Fig.28 (A) Principal component analysis of histological scores among groups after repair in SD rats. (B) Mankin histological total score. (C) Wakitani histological total score. (D) Histological structure score. (E) Cell density score. (F) SO staining score. (G) Calcification line integrity score. (H) Cell morphology score. (I) Matrix staining score. (J) Surface regularity score. (K) Cartilage thickness score. (L) Integration score. Data are expressed as mean ± standard deviation (n = 3). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0054] Fig.29 Polarized light microscope images of the regeneration area of ​​SD rats 12 weeks after surgery stained with Sirius Red. Scale bars: 1 mm and 100 μm.

[0055] Fig.30 This is the directionality and dispersion of collagen fibers in the superficial and deep layers of the defect site in SD rats after surgery.

[0056] Fig.31 Polar coordinate analysis of collagen fiber arrangement in the surface and deep regions of SD rats after surgery.

[0057] Fig.32 (A) Immunohistochemistry (for MMP13 and Col10) and immunofluorescence (for Runx2) staining of repair tissues in SD rats 12 weeks after surgery. Scale bar: 500 μm. (B) Quantitative analysis of immunohistochemistry and immunofluorescence staining in SD rats 12 weeks after surgery. Data are expressed as mean ± standard deviation (n = 3). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001. DETAILED DESCRIPTION

[0058] In the following examples and experimental examples, reagents and materials not specifically described are all commercially available.

[0059] Example 1 Functionalized tetrahedral framework nucleic acid and preparation method thereof

[0060] This embodiment provides a functionalized tetrahedral framework nucleic acid ATM targeting MSCs, which is composed of

[0061] It is formed by three single-stranded DNAs respectively connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer and a fourth single-stranded DNA through base complementary pairing.

[0062] Wherein, the nucleotide sequence of the nucleic acid aptamer (Apt19S) is shown in SEQ ID NO.1:

[0063] AGGTCAGATGAGGAGGGGGACTTAGGACTGGGTTTATGACCTATGCGTG;

[0064] The nucleotide sequence of the single-stranded DNA (S1-miR-140-5p) connected with miR-140-5p is shown in SEQ ID NO.2:

[0065] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAcagugguuuuacccuaugguag;

[0066] The nucleotide sequence of the single-stranded DNA (S2-miR-455-3p) connected with miR-455-3p is shown in SEQ ID NO.3:

[0067] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCGgcaguccacgggcauauaacacu;

[0068] The nucleotide sequence of the single-stranded DNA (S3-Apt19S) connected to the nucleic acid aptamer is shown in SEQ ID NO.4:

[0069] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATC CAGGTCAGATGAGGAGGGGGACTTAGGACTGGGTTTATGACCTATGCGTG;

[0070] The nucleotide sequence of the fourth single-stranded DNA (S4) is shown in SEQ ID NO.5:

[0071] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG.

[0072] The preparation method is as follows: incubate three single-stranded DNAs connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer respectively with a fourth single-stranded DNA at 95° C. for 10 minutes, and then cool at 4° C. for 20 minutes to obtain the product.

[0073] Comparative Example 1

[0074] This comparative example provides the control samples used in the experiment:

[0075] 1. tFNAs

[0076] The sample is prepared by base-pairing of single-stranded DNA (S1 and S2) not linked to miR-140-5p or miR-455-3p, single-stranded DNA (S3) not linked to Apt19S, and S4. The preparation method is the same as that of Example 1.

[0077] in,

[0078] The nucleotide sequence of S1 is shown in SEQ ID NO.6:

[0079] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA; the nucleotide sequence of S2 is shown in SEQ ID NO.7:

[0080] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTC G;

[0081] The nucleotide sequence of S3 is shown in SEQ ID NO.8:

[0082] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATC C.

[0083] 2. TM

[0084] The sample is composed of single-stranded DNA (S1 and S2) not connected to miR-140-5p or miR-455-3p, S3-Apt19S and S4 through base complementary pairing. The preparation method is the same as that of Example 1.

[0085] 3. T-140

[0086] The sample is composed of S1-miR-140-5p, S2, S3 and S4 through base complementary pairing. The preparation method is the same as that of Example 1.

[0087] 4. T-455

[0088] The sample is composed of S1, S2-miR-455-3p, S3 and S4 through base complementary pairing. The preparation method is the same as that of Example 1.

[0089] The technical solution of the present invention is further illustrated by experiments below.

[0090] Experimental Example 1 Characterization of Functionalized Tetrahedral Framework Nucleic ATM

[0091] This experimental example characterizes the ATM prepared in Example 1.

[0092] 1. Experimental Methods

[0093] The successful synthesis and structure of ATM were verified and observed by 8% polyacrylamide gel electrophoresis (PAGE), high performance capillary electrophoresis (HPCE), dynamic light scattering (DLS), atomic force microscopy (AFM) and transmission electron microscopy (TEM).

[0094] 2. Experimental Results

[0095] Based on the differences in electrophoretic mobility of different nanostructures, 8% polyacrylamide gel electrophoresis (PAGE) was used to verify the successful synthesis of tFNAs and ATM. PAGE results ( Figure 1 ) showed that the migration rate of ATM with a larger molecular weight was significantly slower than that of tFNAs, which was consistent with expectations. To further confirm, the results of high-performance capillary electrophoresis (HPCE) once again confirmed the successful synthesis of ATM ( Figure 2 In addition, dynamic light scattering (DLS) was used to determine the expression of tFNAs ( Figure 3 A) and ATM( Figure 3 B) Particle size and zeta potential. DLS results showed that the particle sizes of tFNAs and ATM were approximately 6.492 nm and 14.04 nm, respectively. In terms of charge properties, both carried negative charges (-2.68 mV and -6.75 mV, respectively), indicating that ATM has a similar and stable structure to tFNAs. In addition, atomic force microscopy (AFM, Figure 4 A) and transmission electron microscopy (TEM, Figure 4 B) The shape of ATM in aqueous solution was observed. The results showed that ATM was triangular in shape and evenly distributed in aqueous buffer. Given that the structural stability of ATM is crucial as an ideal nanobiocarrier, its stability in 10% fetal bovine serum (FBS) and MSC cell lysis conditions was evaluated ( Figure 5 ). The experimental results show that ATM can maintain a stable state for at least 24 hours in 10% FBS and MSC lysate, which is crucial for the effective delivery of miRNA to MSCs.

[0096] The above experimental results confirmed that the present invention successfully constructed a miRNA co-delivery system based on tFNAs.

[0097] Experimental Example 2 Cellular endocytosis and biocompatibility of ATM

[0098] The TM and ATM samples used in this experimental example were prepared according to the method of Example 1 or Comparative Example 1.

[0099] 1. Experimental Methods

[0100] 1. Cell culture

[0101] The SMSCs (rat synovial mesenchymal stem cells) used in this study were purchased from Wuhan Procell Biotechnology Co., Ltd., China, and cultured in fresh Dulbecco's modified Eagle's medium (DMEM / F12, Corning, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA). The cells were cultured and passaged in a constant temperature incubator (5% CO2 and 37°C). The experiments used SMSCs cells from the 1st to 3rd generations.

[0102] 2. Cellular absorption of ATM

[0103] Cy3-S1 (i.e., S1 labeled with Cy3), Cy3-miR-140-5p (i.e., miR-140-5p labeled with Cy3), Cy3-TM (i.e., TM labeled with Cy3), and Cy3-ATM (i.e., ATM labeled with Cy3, 250 nm) were co-cultured with SMSCs for 12 hours. Confocal laser microscopy and flow cytometry were then performed to determine the cellular uptake rate.

[0104] 2. Experimental Results

[0105] In order to verify the ability of ATM to deliver miRNA to MSCs, this experimental example synthesized Cy3-labeled miR-140-5p (Cy3-miR-140-5p) by linking miR-140-5p with cyanine 3 (Cy3), and further used Cy3-miR-140-5p instead of miR-140-5p according to the method of Example 1 or Comparative Example 1.

[0106] Cy3-TM and Cy3-ATM were constructed. Then, SMSCs (a type of mesenchymal stem cell) were incubated with Cy3-S1, Cy3-miR-140-5p, Cy3-TM or Cy3-ATM for 12 hours, and the cellular uptake rate was determined by confocal laser microscopy and flow cytometry.

[0107] Confocal fluorescence images ( Figure 6 ) showed that pure ssDNA and pure miR-140-5p could hardly enter SMSCs, while TM could enter the cells in large quantities without using any transfection reagents. More importantly, within the same incubation time, ATM loaded with Apt19S had a higher cell uptake efficiency than TM. Similarly, the flow cytometry quantitative results ( Figure 7) also showed that after 12 hours of incubation, 97.5% of SMSCs took up ATM, while the proportion of SMSCs taking up TM was 59.3%, compared to only 9.81% and 18.9% of cells taking up ssDNAs and miR-140-5p. These results confirm that tFNAs can successfully deliver miRNAs into MSCs, especially after Apt19S modification; while individual miRNAs are difficult to be internalized by MSCs. This shows that among all tested molecules, ATM has the highest affinity and most efficient delivery capacity for MSCs.

[0108] Next, the biocompatibility of ATM was tested. Specifically, SMSCs were treated with miRNAs (250 nM miR-140-5p and 250 nM miR-455-3p), tFNAs, TM, and ATM, respectively, and the cytotoxicity was analyzed by CCK-8 kit ( Figure 8 ). The results showed that the preparations used in these experiments were non-cytotoxic, and tFNAs, TM, and ATM were able to promote cell proliferation. In addition, previous studies have shown that tFNAs can promote the migration of MSCs to a certain extent. Therefore, the scratch healing assay was used to test whether ATM would affect the effect of tFNAs on the migration ability of MSCs ( Fig. 9 ). The scratch images at 0, 12, and 24 hours showed that TM and ATM did not affect the promoting effect of tFNAs on MSC migration; on the contrary, ATM enhanced the effect of tFNAs on MSC migration due to the modification of Apt19S.

[0109] The above experimental results show that ATM is an efficient and safe miRNA co-delivery system that can be quickly internalized by MSCs and enhance the effect of tFNAs. This is a prerequisite for using tFNAs as nanocarriers and is also the key to ATM playing an important biological role in MSCs.

[0110] Experimental Example 3 Functionalized tetrahedral framework nucleic acid ATM enhances the endogenous repair ability of articular cartilage

[0111] The tFNAs, T-140, T-455, TM, and ATM samples used in this experimental example were all prepared according to the method of Example 1 or Comparative Example 1.

[0112] 1. Experimental Methods

[0113] 1. Cell culture

[0114] The SMSCs (rat synovial mesenchymal stem cells) used in this study were purchased from Wuhan Procell Biotechnology Co., Ltd., China, and cultured in fresh Dulbecco's modified Eagle's medium (DMEM / F12, Corning, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA). The cells were cultured and passaged in a constant temperature incubator (5% CO2 and 37°C). The experiments used SMSCs cells from the 1st to 3rd generations.

[0115] 2. Cellular uptake of ATM

[0116] Three-dimensional cell spheroids were constructed using SMSC suspension. The SMSCs in the experimental groups were treated with chondrogenic differentiation induction medium (MSCgoTM; provided by Israel Bioindustries) containing T (250nM), M (250nM), TM (250nM), or ATM (250nM), while the control group was treated with pure induction medium. The culture medium was changed every 3 days. At 7 and 14 days, the expression levels of Sox9, Col2a1, and ACAN genes in different groups were analyzed by RT-qPCR. After 14 days of induction culture, H&E staining, SO staining, AL staining, and type II collagen immunohistochemical staining were performed to evaluate the degree of chondrogenic differentiation. Finally, at 28 days, hypertrophy and degeneration were evaluated by RT-qPCR and immunofluorescence staining (for MMP13, Runx2, and Col10). Detailed operation steps are shown in the Supporting Information section.

[0117] 3. RT-qPCR

[0118] Total RNA was extracted using a total RNA extraction kit (Nanjing Vazyme Co., Ltd.). Then, RNA was reverse transcribed into cDNA using a reverse transcription kit (Nanjing Vazyme Co., Ltd.). Real-time quantitative RT-qPCR detection was performed using SYBR Green IPCR Master Mix. GAPDH was used as a control.

[0119] 4. Immunofluorescence staining experiment

[0120] After routine fixation and blocking, the samples were incubated overnight with the following primary antibody dilutions: aggrecan (1:200; Invitrogen), MMP13 (1:200; Proteintech), Runx2 (1:100; CST), Col 10 (1:200; Abcam), SOX9 (1:200; Abcam), HIF-1α (1:200; CTS), FOXO1 (1:200; CST), FOXO3 (1:200; Proteintech), and CD90 (1:100; Proteintech). Then, fluorescently labeled secondary antibodies were used for incubation for 40 minutes, followed by DAPI staining of cell nuclei and phalloidin staining of cytoskeleton, and observation was performed under a fluorescence microscope.

[0121] 5. Western Blotting

[0122] After routine lysis, denaturation, electrophoresis, and membrane transfer, the membrane was blocked with blocking buffer for 15 minutes. The membrane was then incubated with the following primary antibody dilutions at 4°C overnight: anti-β-actin (1:500, Abcam), anti-SOX9 (1:500, Abcam), anti-HIF-1α (1:500, CTS), anti-FOXO1 (1:500, CST), and anti-FOXO3 (1:500, Proteintech). After incubation with secondary antibodies at room temperature, protein bands were finally visualized.

[0123] 6. Rat articular cartilage injury model

[0124] This study was approved by the Animal Ethics Committee of the General Hospital of the Chinese People's Liberation Army. Male rats aged 6 to 8 weeks were randomly divided into five groups (control group, T group, M group, TM group, and ATM group). After anesthesia, the rats were routinely prepared and disinfected, the left knee joint cavity was opened, the femoral trochlear part was exposed, and a hole (diameter: 2 mm, depth: 1 mm) was drilled in the center of the trochlear groove near the medial collateral ligament, and the incision was sutured layer by layer. Intra-articular injections were performed every 3 days after surgery. Specimens were collected 1 week, 6 weeks, and 12 weeks after surgery.

[0125] 7. Macroscopic evaluation and Micro-CT analysis

[0126] The specimens were scored according to the ICRS macroscopic evaluation guidelines at 6 and 12 weeks after surgery. The specimens were then scanned using the GE Explorer Locus SP system. Finally, three-dimensional CT reconstruction of the femoral specimens was performed, and BMD and BV / TV values ​​were calculated.

[0127] 8. Statistical analysis data

[0128] The data are presented as mean ± standard deviation (n ≥ 3). One-way analysis of variance (ANOVA) was used to evaluate the differences among the groups, and Tukey's multiple comparison test was used for subsequent correction. GraphPad Prism 8.0 and ImageJ were used for data analysis. A p value less than 0.05 indicated statistical significance.

[0129] 2. Experimental Results

[0130] 1. Synergistic effect of miR-140-5p and miR-455-3p in regulating SMSC chondrogenic differentiation

[0131] First, the real-time quantitative polymerase chain reaction (RT-PCR) technique was used to explore the changes in the expression of miR-140-5p and miR-455-3p in SMSCs after they were cultured with T-140 (250nM), T-455 (250nM), TM (250nM) or ATM (250nM). The results showed that compared with the control group, miRNA was successfully delivered to SMSCs in each group, and the expression of miR-140-5p and miR-455-3p increased most significantly in the ATM group, indicating that more miRNA was delivered to SMSCs ( Fig.10 Next, the Alcian blue (AL) staining method was used ( Fig.11 ) studied the effects of T-140, T-455, TM and ATM on the enhancement of chondrogenic differentiation potential of SMSCs in 2D tissue culture plates, and determined the expression levels of related genes Sox9, ACAN and Col2a1 ( Fig.12 ). The experimental data showed that the co-delivery system containing TM and ATM was more effective in promoting the chondrogenic differentiation of SMSCs than using T-140 to deliver miR-140-5p and T-455 to deliver miR-455-3p alone. The above preliminary experimental results confirmed that miR-140-5p and miR-455-3p have a synergistic effect in the chondrogenic differentiation of MSCs, which is an unprecedented discovery. Therefore, in the subsequent research of this experimental example, we will no longer focus on the delivery of a single miRNA, but will focus on the miRNA co-delivery system based on TM and ATM for in-depth exploration.

[0132] 2. ATM system promotes SMSCs differentiation into hyaline cartilage phenotype

[0133] Previous studies have pointed out that native joint-resident mesenchymal stem cells play a key role in cartilage regeneration. In particular, SMSCs (a type of MSCs) may be the main driving force for adult articular cartilage repair. When articular cartilage is injured, many MSCs are recruited to the damaged site. Under the influence of the local regenerative microenvironment, these recruited MSCs differentiate into chondrocytes, thereby promoting the endogenous repair of cartilage tissue. Therefore, it is crucial to precisely regulate the differentiation fate of MSCs when developing cartilage regeneration strategies. The chondrogenic differentiation process of MSCs in the joint cavity usually depends on the action of specific growth factors in the local microenvironment after injury, including bone morphogenetic protein (BMP), insulin-like growth factor (IGF), and transforming growth factor-β (TGF-β). It is worth noting that TGF-β superfamily members such as TGF-β1 and TGF-β3 play a crucial role in this process. However, when the microenvironment is destroyed due to inflammatory response in the joint cavity, the differentiation of MSCs tends to hypertrophic cartilage rather than hyaline cartilage. This process leads to a decline in the overall function of the regenerated tissue, which is one of the main reasons why microfracture surgery has unsatisfactory long-term results.

[0134] Based on this, this experimental example applied ATM to the three-dimensional spheroid culture model of SMSCs induced by TGF-β3 to explore whether ATM can promote chondrogenic differentiation of MSCs while inhibiting their development towards hypertrophy and degeneration. The effects of tFNAs, pure miRNAs, TM and ATM on chondrogenic differentiation of SMSCs were evaluated at different time points (14 days, 21 days and 28 days) in the three-dimensional spheroid culture model induced by TGF-β3. By RT-PCR, the expression levels of cartilage-specific genes (Sox9, Col2a1 and Acan) in each group were determined on days 14 and 21 ( Fig.13 ). Compared with the control group induced with pure TGF-β3 alone (conventional chondrogenic differentiation medium), spheroids treated with 250 nM ATM showed the highest Sox9, Col2a1, and Acan gene expressions at 14 and 21 days. Subsequently, histopathological staining experiments including hematoxylin and eosin (H&E), safranin O (SO), and Alcian blue (AL) staining were performed to evaluate the morphology of chondrogenic spheroids 21 days after induction ( Fig.14A, B). H&E images showed that the spheroids in the ATM group had the darkest staining, indicating that this group produced more extracellular matrix (ECM). In addition, SO and AL staining results, which reflect the polysaccharide content, showed that polysaccharide accumulation in the ECM of SMSCs was reduced after ATM treatment. The expression levels of Col2 and Acan proteins were determined by immunohistochemistry and immunofluorescence staining, respectively. Compared with the control group, spheroids treated with ATM showed the strongest expression of Col2 and Acan proteins on day 21. Therefore, ATM can significantly promote the chondrogenic differentiation of SMSCs.

[0135] As cell aging and inflammation occur, specific markers such as Col10, Runx2, and MMP-13 gradually accumulate, leading to the gradual appearance of the phenotype of hypertrophic chondrocyte differentiation. Compared with hyaline chondrocytes, hypertrophic chondrocytes can further aggravate the deterioration of joint structure and function. Therefore, after 28 days of culture, we used RT-PCR ( Fig.15 ) and immunofluorescence staining ( Fig.16 ) were used to evaluate the mRNA and protein expression levels of hypertrophy-specific markers Col10, Runx2, and MMP-13 in cartilage spheroids of each treatment group. The results showed that ATM significantly reduced the expression of Col10, Runx2, and MMP-13 in cartilage spheroids, indicating that ATM successfully inhibited the degenerative process during cartilage formation. Based on these results, ATM may promote the differentiation of MSCs into chondrocytes after cartilage injury. In the late stage of differentiation, MSCs from the injury site may secrete Col10, Runx2, and MMP-13, which are involved in the cartilage degeneration process. However, intervention with ATM can inhibit this degenerative process and reconstruct the microenvironment during articular cartilage regeneration by guiding hyaline cartilage production.

[0136] From the above experimental results, it can be seen that ATM not only promotes the formation of beneficial cartilage tissue, but also effectively prevents the adverse hypertrophy process, which is conducive to the efficient repair and regeneration of articular cartilage.

[0137] 3. ATM promotes chondrogenic differentiation of SMSCs by enhancing HIF1α and FOXO signaling pathways

[0138] To further explore the mechanism of action of ATM on SMSCs, mRNA sequencing analysis was performed on SMSCs in the experimental group treated with ATM for 24 hours and the control group without ATM. Fig.17As shown in AB, principal component analysis (PCA) and Venn diagram of gene expression levels clearly showed significant differences between the two groups of samples and confirmed the consistency of samples within each group. Compared with the control group, 180 differentially expressed genes (DEGs) were identified in the ATM-treated group [false positive discovery rate (FDR) < 0.05, |log2(fold change A)|>1], of which 77 genes were up-regulated and 103 genes were down-regulated ( Fig.18 AB). Gene ontology (GO) analysis of the two groups showed that these DEGs were closely related to cholesterol biosynthesis, cytokine secretion, hypoxia response, and extracellular matrix accumulation ( Fig.19 ). In addition, the results of KEGG pathway analysis showed that the ATM-treated group and the control group were significantly enriched in lipid metabolism, hypoxia response, MAPK, Ras, PI3K / Akt and other functional pathways related to chondrogenic differentiation ( Fig. 20 AB). Gene set enrichment analysis (GSEA) further confirmed that after the addition of ATM, lipid metabolism-related functions of SMSCs, such as fatty acid biosynthesis and FOXO signaling pathway activity, were reduced, while signaling pathways related to hypoxia response (such as hypoxia-inducible factor-1α, HIF-1α) and the classical TGF-β pathway closely related to chondrogenic differentiation were enhanced ( Fig.21 ). Subsequently, the functions related to hypoxia regulation, lipid metabolism and cartilage differentiation were analyzed. The results showed that compared with the control group, the expression of key hypoxia regulatory molecules HIF-1α, FOXO1, FOXO3 and genes related to cartilage differentiation (Tgfb1, Tgfb2, Tgfb3) in the ATM treatment group were upregulated ( Fig. 22 AB).

[0139] Hypoxia response and lipid metabolism are two key pathways that regulate the differentiation fate of MSCs. Among them, HIF-1α, as a key mediator of cellular response to hypoxia, has been shown to promote the differentiation of MSCs into chondrocytes by upregulating the expression of SOX9, a key transcription factor involved in chondrogenesis. In addition, Nick van Gastel et al. revealed that the FOXO transcription factor can bind to the SOX9 promoter and increase its expression level, further initiating chondrogenesis, and regulating intracellular lipid metabolism by inhibiting fatty acid oxidation. Therefore, protein blotting (western blot, WB) and immunofluorescence staining techniques were used to evaluate the protein expression levels of HIF-1α, FOXO1, FOXO3 and SOX9 in SMSCs treated with ATM to further verify the results obtained by transcriptome sequencing. The WB results showed ( Fig.23 AB), ATM significantly upregulated the expression of HIF-1α, FOXO1, FOXO3 and SOX9 in SMSCs. Similarly, immunofluorescence images ( Fig.23 CF) showed that after ATM treatment, the fluorescence intensity of these four proteins in SMSCs was enhanced compared with other treatments. In summary, all these research results together indicate that ATM promotes the expression of SOX9 by regulating the HIF-1α signaling pathway and the FOXO signaling pathway, thereby effectively enhancing the chondrogenic differentiation ability of SMSCs.

[0140] The above results indicate that, as a multifunctional targeted delivery system, ATM not only enhances the migration ability of SMSCs, but also regulates their differentiation into hyaline chondrocytes, opening up a new way to enhance the endogenous regeneration of articular cartilage.

[0141] 4. ATM improves the endogenous repair capacity of rat articular cartilage

[0142] To evaluate the distribution and retention of TM and ATM in vivo, Cy3-labeled miR-140-5p, TM, and ATM were injected into the knee joint cavity of rats. Images at different time points (0, 15, 30, 45, 60, 90, and 120 min) after injection were acquired using an in vivo fluorescence imaging system ( Fig.24 ), and the results showed that over time, the fluorescence intensity of the Cy3-TM and Cy3-ATM groups was higher than that of the free Cy3-miR-140-5p group. In particular, Cy3-ATM showed the strongest retention 120 minutes after intra-articular injection, indicating that tFNAs modified with Apt19S significantly enhanced the stability and effective time of miRNAs in the joint. Next, a cartilage defect model with a diameter of 2 mm and a depth of 1 mm was established in rats to further study the effects of various treatments on the endogenous repair effect of articular cartilage. After the model was established, the same volume of saline (negative control), tFNAs, miRNAs (250nM of miR-140-5p or 250nM of miR-455-3p), TM, and ATM were injected into the knee joint cavity every three days for 12 weeks. Fig.25 A shows a rat cartilage defect model and a schematic diagram of ATM treatment for 12 weeks. After intra-articular injection of Cy3-labeled miRNA, TM, and ATM, the affinity of ATM for MSCs was evaluated by immunofluorescence in the first week after surgery. The regenerated tissue of the defect site was collected and immunofluorescence labeling of MSCs was performed specifically using the CD90 marker. The fluorescence signal was detected by confocal microscopy ( Fig.25 B), Quantitative analysis of CD90 and Cy3 double positive cells ( Fig.25C) shows that more red Cy3 fluorescence was observed in the ATM group compared with the control group and the TM group, and these fluorescences clearly overlapped with the green fluorescence signal of MSCs. These findings indicate that ATM injection significantly increased the number of MSCs at the site of injury, and the introduction of aptamers into tFNAs can greatly increase their affinity for MSCs. In addition, tFNAs improved the in vivo migration of MSCs to the site of injury and the efficiency of miRNA delivery to cells, a result consistent with previous studies. In the case of AC injury, mobilizing endogenous MSCs to the site of injury is crucial for early repair. The above results demonstrate that ATM achieves targeted miRNA delivery to MSCs in vivo and successfully mobilizes a sufficient number of endogenous MSCs to the site of injury, providing a solid foundation for subsequent cartilage regeneration.

[0143] Six and 12 weeks after surgery, the rats were subjected to macroscopic evaluation, micro-computed tomography (micro-CT), pathological staining, and immunohistochemical analysis ( Fig.25 A). Fig.25 As shown in D, at 6 and 12 weeks after surgery, the surfaces of the rat femoral trochlea samples removed from the control group, tFNA (T) group, and miRNA (M) group showed obvious depressions, the surface of the new tissue was uneven, and there was a significant color difference from the surrounding normal cartilage tissue. In contrast, the regenerated tissue in the TM group was closer to normal cartilage, but still had a clear boundary with the surrounding tissue; while the regenerated tissue in the ATM group was significantly better than the other four groups, showing better integration and consistency with the surrounding normal tissue. According to the macroscopic evaluation criteria provided by the International Cartilage Repair Society (ICRS), the samples in each group were scored 6 and 12 weeks after surgery. ICRS scoring results ( Fig.25 E) and heat map analysis ( Fig.25 F) shows that the ATM group achieved the highest overall score for regenerated cartilage tissue at 6 and 12 weeks after surgery. In addition, the regeneration of subchondral bone at the defect site was evaluated by micro-CT analysis and 3D reconstruction. Fig.25 As shown in G, at 6 weeks after surgery, only a small amount of new bone was formed in the control group, T group, and M group, showing limited repair ability; while the subchondral bone repair in the TM group and ATM group was more consistent. At 12 weeks after surgery, subchondral bone formation in the control group, T group, M group, and TM group improved compared with that at 6 weeks, but there were still obvious defects; at this time, the ATM group showed the most continuous and complete subchondral bone regeneration. Subsequently, we selected the region of interest (ROI) to measure the bone volume / tissue volume ratio (BV / TV; Fig.25 H) and bone mineral density (BMD; Fig.25I). The results showed that at 6 and 12 weeks, the control group had the lowest BV / TV and BMD values, while the ATM group achieved the best results at both time points.

[0144] To further confirm the therapeutic effect of ATM, the histopathological characteristics of the repair tissues were evaluated by various histological examinations (H&E staining, SO / FastGreen staining, toluidine blue staining, and Col2 immunohistochemical staining) at 6 and 12 weeks after surgery. Fig.26 A) The results showed that in the control group, the defect was not filled with new tissue, accompanied by subchondral bone collapse and fibrous tissue filling the collapsed cavity; in the T and M groups, partial new tissue filling was observed, with an uneven surface and obvious boundaries, and the filled tissue contained disordered spindle-shaped fibroblasts and a small number of round chondrocytes; the TM group showed completely filled cartilage-like tissue, which was thinner than the surrounding cartilage and had a slightly rough surface; and the ATM group showed completely filled cartilage-like tissue with a smooth surface. SO / Fast Green staining ( Fig.26 B) and toluidine blue staining ( Fig.26 C) The proteoglycan distribution was investigated. Compared with the other four groups, the ATM group showed the strongest positive staining at both time points, indicating that it had the most abundant proteoglycan deposition in the ECM. In addition, by performing Col2 immunohistochemical staining ( Fig.26 D) Evaluation of the deposition and distribution of Col2. The ATM group had more Col2 deposition in the regenerated tissue compared with the control group, T group, M group, and TM group. Therefore, based on the histopathological staining results 12 weeks after surgery, the Mankin score and Wakitani score were performed. Heat map analysis of histological scores ( Fig. 27 ) and total score ( Fig.28 B, C) show that the quality of regenerated cartilage in the ATM group was better than that in all other groups (the better the regeneration effect, the lower the score). It is worth noting that the PCA analysis results showed significant differences between the ATM dataset and other datasets, suggesting that there were significant histological differences between the ATM group and other groups receiving cartilage repair treatment ( Fig.28 A). Specifically, the histological scores of various parameters further confirmed that the application of ATM significantly enhanced the "structure", "cell density", "SO staining", "calcification line integrity", "cell morphology", "matrix staining", "surface regularity", "cartilage thickness" and "integration" ( Fig.28 DL).

[0145] In the follow-up work, Sirius Red staining and polarized light microscopy were used to observe the distribution and arrangement of regenerated collagen fibers in the new cartilage tissue after 6 and 12 weeks of repair ( Fig.29 ). Collagen fiber organization is a key factor in determining the biological function and mechanical properties of articular cartilage. Previous studies have shown that collagen fibers in the surface area of ​​normal AC are oriented parallel, while in the deep base area they are arranged vertically. Therefore, we used ImageJ software to analyze the arrangement direction of regenerated collagen fibers in two different areas (including the surface area and the deep area) at 12 weeks, such as Fig.30 , 31 As shown. The control group and the M group showed irregular distribution of collagen fibers in the surface area and deep area; the T group and the TM group showed a certain degree of arrangement directionality. In the ATM group, the surface area showed the most parallel arrangement of collagen fibers, and the deep area close to normal cartilage showed the most vertical arrangement of collagen fibers, which was consistent with the structural characteristics of normal cartilage tissue, showing that ATM has a significant promoting effect on the reconstruction of regenerated cartilage tissue.

[0146] To verify whether ATM can still inhibit the degeneration of MSC chondrogenic differentiation in vivo, we used immunohistochemistry and immunofluorescence techniques to detect the expression of characteristic senescent and hypertrophic chondrocyte markers MMP13, Col10, and Runx2 ( Fig.32 A, B). Compared with the other groups, almost no expression of MMP13, Col10, or Runx2 was detected in the regenerated area of ​​the ATM group, indicating that the application of ATM successfully inhibited the generation of hypertrophic chondrocytes.

[0147] Based on the above results, ATM significantly enhanced the endogenous repair capacity of cartilage after knee injury in rats and successfully blocked the development of MSCs towards the hypertrophy pathway during chondrogenesis, thereby further improving the quality of regenerated cartilage.

[0148] Through the above experimental examples, it can be seen that the stability of miRNAs in ATM is significantly improved, and it has a good targeting effect on MSCs. By using ATM, the migration ability of MSCs can be enhanced, so that their number in the damaged area increases, creating conditions for endogenous cartilage regeneration. In addition, ATM can activate the HIF-1α and FOXO signaling pathways, prompting MSCs to differentiate into a stable chondrocyte phenotype, and at the same time inhibit excessive hypertrophy and degeneration processes, thereby promoting the precise recovery of cartilage function. The experiment of the present invention also confirmed for the first time that miR-140-5p and miR-455-3p have a synergistic effect in the MSC cartilage differentiation process.

[0149] Therefore, the ATM of the present invention represents a novel cartilage regeneration strategy with important clinical translational value, providing new insights and experimental evidence in the field of regenerative medicine. This new delivery system is of great significance for promoting the effectiveness and accuracy of cartilage injury treatment and has good application prospects.

Claims

1. A functionalized tetrahedral framework nucleic acid, characterized in that: The functionalized tetrahedral framework nucleic acid is modified with miR-140-5p, miR-455-3p and a nucleic acid aptamer whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The functionalized tetrahedral framework nucleic acid according to claim 1, characterized in that: It is formed by three single-stranded DNAs respectively connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer and a fourth single-stranded DNA through base complementary pairing.

3. The functionalized tetrahedral framework nucleic acid according to claim 2, characterized in that: The nucleotide sequence of the single-stranded DNA connected with miR-140-5p is shown in SEQ ID NO.2; and / or, the single-stranded DNA nucleotide sequence connected to miR-455-3p is shown in SEQ ID NO.3; And / or, the single-stranded DNA nucleotide sequence connected to the nucleic acid aptamer is shown in SEQ ID NO.4; And / or, the nucleotide sequence of the fourth single-stranded DNA is as shown in SEQ ID NO.

5.

4. The method for preparing the functionalized tetrahedral framework nucleic acid according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: incubating three single-stranded DNAs respectively connected with miR-140-5p, miR-455-3p and the nucleic acid aptamer with a fourth single-stranded DNA to obtain the product.

5. Use of the functionalized tetrahedral framework nucleic acid according to any one of claims 1 to 3 in the preparation of a drug for treating articular cartilage damage.

6. The use according to claim 5, characterized in that: The drug is used for promoting endogenous cartilage regeneration.

7. The use according to claim 5, characterized in that: The drug is used to promote cartilage differentiation of mesenchymal stem cells in joints; And / or, the drug is used to inhibit hypertrophy and degeneration of mesenchymal stem cells in joints; And / or, the drug is used to enhance the migration ability of mesenchymal stem cells; And / or, the drug is used to activate HIF-1α and FOXO signaling pathways to enhance mesenchymal stem cells.

8. A drug for treating articular cartilage damage, characterized in that: The invention is prepared by taking the functionalized tetrahedral framework nucleic acid as any one of claims 1 to 3 as an active ingredient and adding pharmaceutically acceptable auxiliary materials.

Images