Use of sodium diethyldithiocarbamate in the preparation of vaccine adjuvants

Abstract

The application discloses application of sodium diethyl dithiocarbamate in preparation of a vaccine adjuvant, the adjuvant can effectively enhance immunogenicity of an antigen and stimulate the body to generate higher humoral and cellular immune responses, and can be combined with a traditional aluminum adjuvant to enhance the protection effect of the antigen, and is non-toxic and has no side effects.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to the application of DTC as an adjuvant in the preparation of vaccines against Pseudomonas aeruginosa infection. Background Technology

[0002] As an immune enhancer, adjuvants can not only increase the immunogenicity of antigens and improve the body's innate and adaptive immune responses to antigens, but also save on antigen dosage or reduce the number of vaccinations, thereby lowering vaccine costs [Mekonnen D, et al. Expert Rev Vaccine. 2022]. Currently approved adjuvants for clinical use include aluminum adjuvants, MF59, AS03, and AS04. Among them, aluminum adjuvants have a history of over 100 years and are a major adjuvant used in commercial vaccines [Mbhele Z, et al. Vaccines. 2023]. However, aluminum adjuvants have limitations: they can only induce relatively weak humoral immune responses and cannot support strong cellular immune responses, nor can they provide effective protection against certain intracellular pathogens [Laera D, et al. Pharmaceuticals. 2023]. Therefore, there is an urgent need to develop an adjuvant that can provide stronger protection, enhance the performance of aluminum adjuvants, and is non-toxic and has no side effects.

[0003] Studies have found that certain small molecules have immunomodulatory effects. For example, sodium diethyldithiocarbamate (DTC), also known as dithiocarbamate, is traditionally used in the chemical industry as a colorimetric reagent for copper or for the extraction of small amounts of heavy metals such as copper, cadmium, vanadium, nickel, and cobalt.

[0004] DTC is a thiolated derivative with thymic-like activity, but it does not contain an imidazole group that could potentially cause cholinergic effects. Although previous studies have found that DTC can inhibit the proliferation of human liver cancer cells and induce cell differentiation and apoptosis [Kang Jiuhong, Chinese Journal of Pharmacology, 2001], its use as an adjuvant is currently undocumented. Summary of the Invention

[0005] The purpose of this invention is to address the problem in the prior art of lacking adjuvants with stronger protection, enhanced performance of aluminum adjuvants, and no toxicity or side effects. This invention provides an application of DTC as an adjuvant in vaccine preparation. The adjuvant can effectively enhance the immunogenicity of antigens and stimulate the body to produce a higher humoral and cellular immune response. It can also be used in combination with traditional aluminum adjuvants to enhance the protective effect of antigens, and is non-toxic and has no side effects.

[0006] The technical solution of this invention is:

[0007] Use of sodium diethyldithiocarbamate in the preparation of an adjuvant for a vaccine.

[0008] The adjuvant is used in combination with an aluminum adjuvant.

[0009] The vaccine is used for preventing lung infection.

[0010] The sodium diethyldithiocarbamate promotes Th17 cell differentiation and induces a Th17 response.

[0011] The adjuvant is administered by injection at a dose of 50 μg / ml.

[0012] The DTC described in the present application has a chemical formula of C5H 10 S2Na, a molecular weight of 171, and a structural formula of:

[0013]

[0014] The experimental results of the applicant show that, by lung transcriptome sequencing, it is found that, when sodium diethyldithiocarbamate is used as an adjuvant, it plays a role by inducing a Th17 response, can improve the survival rate of mice after lung infection, and can reduce lung damage. Animal experiment results show that, compared with the control group, the survival protection rate of mice in the PA0833+DTC group is 90%, and the survival protection rate of mice in the PA0833+Alum+DTC group is 100%.

[0015] The DTC described in the present application has an immunoregulatory effect, can enhance the immunogenicity and protection effect of the Pseudomonas aeruginosa vaccine candidate antigen PA0833, and the mechanism of immune regulation is that small molecules promote the differentiation of Th17 cells and induce a Th17 response.

[0016] The small molecule adjuvant of the present application has the following advantages:

[0017] 1) Compared with traditional aluminum hydroxide as an adjuvant, the survival protection effect on mice after infection is higher;

[0018] 2) After immunization, the body can induce a Th17 cell immune response, and can enhance the humoral immune response to a certain extent, and can be used as a new means for enhancing the immunogenicity of antigens;

[0019] 3) After inoculation of mice by the muscle injection route, no adverse reactions are generated, so it is considered that the small molecule has no side effects.

[0020] The present application first uses DTC as an adjuvant in combination with an aluminum adjuvant, and the results show that the combination can enhance the immunogenicity of antigens. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1To confirm that DTC has good safety by CCK-8 test;

[0022] Figure 2 To confirm that DTC can activate IL-17 signaling pathway and promote Th17 cell differentiation by transcriptome sequencing and flow detection;

[0023] Figure 3 To confirm that DTC activates IL-17 signaling pathway through IL-23 pathway by qPCR detection of transcription factors;

[0024] Figure 4 To enhance the protective effect of Pseudomonas aeruginosa vaccine antigen by combining DTC with aluminum hydroxide adjuvant. DETAILED DESCRIPTION

[0025] The strains used in the application and various reagents are as follows:

[0026] The experimental animals are 6-8 week old female SPF level Balb / c mice, weighing 16-20g, purchased from Beijing Vito Lihua Biological Technology Co., Ltd.

[0027] Pseudomonas aeruginosa strain PAO1 was purchased from ATCC and stored at -80℃;

[0028] The construction of the engineering strain expressing PA0833 is described in PA0833 Is an OmpA C-Like Protein That Confers Protection Against Pseudomonas aeruginosa Infection (Yang F, Front Microbiol., 2018), which was constructed and stored by the research group;

[0029] Sodium diethyldithiocarbamate (DTC) was purchased from Macklin;

[0030] Al(OH)3 adjuvant was purchased from InvivoGen;

[0031] RPMI1640 medium was purchased from GIBCO.

[0032] Cell Counting Kit-8 (CCK-8 kit) was purchased from Biyun Tian, and was detected at 450nm wavelength by American BioTek full-wavelength enzyme marker.

[0033] Goat anti-mouse IgG Fc HRP, PMA / TPA, ionomycin, protein transport inhibitor were purchased from Biyun Tian;

[0034] GM-CSF, IL-4 reagents were purchased from SinoBiological.

[0035] Anti-mouse live / dead-AF700, anti-mouse CD3-FITC, anti-mouse CD4-Pacific Blue, and anti-mouse IL17A-PE were purchased from Biolegend.

[0036] Cell culture was performed using a CO2 cell culture incubator manufactured by Thermo Fisher Scientific, USA.

[0037] All other reagents used in this embodiment are commercially available reagents.

[0038] Example 1: CCK-8 Detection

[0039] BMDC cell culture method: Bone marrow cells were extracted from the femur and tibia of mice, washed and suspended in RPMI 1640 medium. The bone marrow cells were cultured at 1×10⁻⁶ cells / mL. 6 Inoculate sterile culture dishes at a density of 10 ng / mL, and add GM-CSF and IL-4 to achieve final concentrations of 20 ng / mL and 10 ng / mL, respectively. Place the culture flasks in an incubator at 37°C and 5% CO2, and change the culture medium every two days.

[0040] 1. Centrifuge and count the BMDC cells cultured to day 7.

[0041] 2. Seed 100 μL of 6kJ / well cells into a 96-well plate and culture at 37°C and 5% CO2 for 24 hours.

[0042] 3. Observe the growth status and density of the cells under a microscope, and select wells with good growth status and uniform cell distribution and density for experiments.

[0043] 4. Prepare a 1 μM sodium diethyldithiocarbamate solution, a 1 μM aluminum hydroxide solution as the positive control, and an equal volume of PBS as the negative control. Take 3 replicates from each group and add them to a 96-well plate. Incubate at 37°C and 5% CO2 for 12 hours.

[0044] 5. Add 10 μL of CCK-8 solution to each well.

[0045] 6. Incubate at 37℃, 5% CO2, and 90% humidity for 2 hours.

[0046] 7. Measure the absorbance at 450 nm using an ELISA reader.

[0047] The results showed that the cell survival rate after stimulation with DTC small molecules was above 92% (see [link]). Figure 1 This study demonstrates that sodium diethyldithiocarbamate is non-toxic to cells and can be used for subsequent animal and cell experiments.

[0048] Example 2 Transcriptome sequencing and detection of mouse spleen Th17 response

[0049] Balb / c mice were divided into PBS control group and DTC test group, 3 mice in each group. After continuous intramuscular injection of DTC (10 μg) or PBS for 7 days, the lung tissues of the mice were taken out and then stored in liquid nitrogen. The mRNA-Seq technology was used to perform transcriptome sequencing and analysis on the mouse lung by Chongqing Wenda Biological Technology Co., Ltd.

[0050] Taking the genome of the control group as a reference, the differentially expressed genes were screened and GO function enrichment analysis and KEGG signal pathway analysis were performed to explore the mechanism of DTC effect.

[0051] The spleen cells of the mice were taken 48 hours after intramuscular injection of DTC (10 μg), treated with red blood cell lysate, and then stimulated with 100 μg / ml PMA / TPA and 1 μg / ml ionomycin in complete RPMI1640 medium for 4 hours. After blocking the cells with a protein transport inhibitor for about 1 hour, the cells were washed with staining buffer (PBS containing 2% fetal bovine serum).

[0052] The washed cells were labeled and stained with surface molecules (anti-mouse CD3-FITC, anti-mouse CD4-Pacific Blue) for 30 minutes, fixed and broken membrane permeable for 30 minutes in the dark, and then stained with intracellular factors (anti-mouse IL17A-PE). After washing the cells, resuspend them in PBS, use a BD flow cytometer to detect the samples, and finally use FlowJo to analyze the detection results.

[0053] The experimental results show that the KEGG signal pathway enrichment analysis in the transcriptome sequencing shows that many up-regulated DEGs are significantly enriched in several inflammatory response signal pathways, especially in the IL-17 (P=0.00374162) signal pathway. The flow cytometry results show that the proportion of CD3+CD4+IL-17A+T cells in the DTC group is significantly higher than that in the PBS control group (P<0.05), indicating that DTC can promote the differentiation of Th17 cells, which is consistent with the results of transcriptome sequencing, see Figure 2 .

[0054] Example 3

[0055] IL-23 primer design: product length = 147

[0056] Forward primer 1 ACCAGCGGGACATATGAATCT 21 (SEQ ID NO: 1)

[0057] Reverse primer 1 AGACCTTGGCGGATCCTTTG 20 (SEQ ID NO: 2)

[0058] IL-23 is considered to play a crucial role in the maintenance and proliferation of Th17 cells, and its receptor (IL-23R) is upregulated in activated Th17 cells. To verify whether Th17 maturation, survival, and effector function originate from IL-23 in antigen-presenting cells, qPCR was performed to validate the transcription factor. Total RNA was extracted from BMDC cells stimulated with DTC for 10 hours, and its concentration and purity were measured. The RNA was then reverse transcribed into cDNA using a reverse transcription kit and subjected to qPCR. Each group was configured with three replicates, and three independent experiments were performed. GAPDH was used as an internal control to detect IL-23 gene expression. Primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0059] Experimental results indicate that DTC primarily mediates the Th17 response by promoting the secretion of the IL-23 transcription factor. (See [link to relevant documentation]) Figure 3 .

[0060] Example 4: Animal Immune and Infection Protection and Bacterial Load Experiment

[0061] 1. Animal immunization and antibody detection

[0062] Vaccine sample preparation: Dissolve 150 μg PA0833, 150 μg Al(OH)3, and 50 μg DTC in one milliliter of water, mix well, and prepare an immunization solution. Inject 200 μl of the immunization solution into each mouse via intramuscular injection. Immunization method: Hold the mouse and insert the needle 0.5 cm near the quadriceps femoris muscle, injecting the vaccine sample into both limbs at a uniform rate. Mice in each group were immunized three times on days 0, 14, and 21. Tail vein blood was collected from BALB / c mice on days 13, 20, and 27, and serum was separated. The level of antigen-specific IgG response after immunization was detected by ELISA.

[0063] The blank control group was immunized with 200 μl of PBS, using the same immunization method as described above.

[0064] A. Preparation of reagents

[0065] 1) Preparation of coating solution: Weigh 1.6g of Na2CO3 and 2.9g of NaHCO3, dissolve them in 1L of ddH2O, and adjust the pH to 9.6 using a pH meter;

[0066] 2) Preparation of blocking solution: 1g bovine serum albumin, dissolved in 100mL antibody dilution solution (1:100);

[0067] 3) Preparation of antibody dilution solution: Dissolve phosphate in 1L ddH2O, then add 500μl Tween 20, and adjust the pH to 7.4 using a pH meter;

[0068] 4) Preparation of washing solution: same as antibody diluent

[0069] 5) Color developing solution (TMB), termination solution are all products of Biyun Tian Company;

[0070] B. Detection

[0071] 1) Dilute the purified PA0833 protein to 0.5 μg / mL with coating solution;

[0072] 2) Coating: add the recombinant protein diluent to the enzyme-labeled plate, 100 μL / well, and wash 3 times after overnight incubation at 4°C, then dry and cover with preservative film, and place in a 4°C refrigerator for standby;

[0073] 3) Blocking: add 200 μL / well of blocking solution to the enzyme-labeled plate, and place in a 37°C incubator for 2 hours, and wash 3 times;

[0074] 4) Dilute the serum by 1:1000, 1:2000, 1:4000, 1:8000, etc. in proportion;

[0075] 5) Take the blocked enzyme-labeled plate, and sequentially add the diluted serum, 100 μL / well, and place in a 37°C incubator for 1 hour, wash 3 times, and dry;

[0076] 6) Dilute the HRP-labeled goat anti-mouse IgG antibody storage solution by 1:1000 to prepare an antibody working solution;

[0077] 7) Add the diluted antibody working solution, 100 μL / well, and place in a 37°C incubator for 40 min, wash 3 times, and dry;

[0078] 8) Add substrate color developing solution (TMB), 100 μL / well, and react at room temperature for 10 min in the dark;

[0079] 9) Add termination solution, and immediately place on an enzyme-labeled instrument to measure OD value at 450 nm wavelength;

[0080] 10) Result judgment: OD value of PA0833+DTC group / PBS group >=2.1 is positive (negative control is 1:1000 dilution of serum of the PBS group mice).

[0081] Experimental results: the antibody titers of the group added with DTC as an adjuvant are significantly higher than those of the PA0833+Alum group and the PA0833 group, which indicates that the application as an adjuvant can effectively enhance humoral immunity, see Figure 4 A.

[0082] 2. Animal immunization and infection

[0083] Vaccine sample preparation: 150 μg PA0833, 150 μg Al(OH)3, 50 μg DTC were dissolved in 1 ml water, mixed, and prepared into immunization solution, 200 μl of the immunization solution was injected into each mouse, and the injection was performed by intramuscular injection.

[0084] Immunization method: the mouse was held by hand, the needle was inserted into the mouse near the quadriceps femoris muscle by 0.5 cm, and the injection was performed at a uniform speed, and the vaccine sample was injected into the left and right limbs respectively. The mice in each group were immunized for 3 times at 0, 14, 21 days respectively. On the 7th day after the last immunization, 1×10 7 CFU dose of P. aeruginosa PAO1 was used to infect the mice by tracheal instillation, and the survival state of the mice was observed, and the observation period was 7 days, and the number of dead mice was recorded every day. On the 7th day after the last immunization, 3×10 6 CFU dose of P. aeruginosa PAO1 was used to infect the mice by tracheal instillation. After the mouse was disinfected by immersion in 75% ethanol, the lung tissue of the mouse was taken out. The lung tissue was added to a grinding tube containing 1 ml of sterile PBS and ground on ice. The homogenate was serially diluted, and 5 μl of the homogenate was uniformly coated on solid LB medium and incubated at 37°C overnight. After 16-17 hours, the number of bacterial monoclonal colonies on the medium was counted.

[0085] The blank control group was injected with 200 μl of PBS, and the immunization method was the same as described above.

[0086] The animal experiment results show that, compared with the control group, the survival protection rate of the mice in the PA0833+DTC group is 90%, and the survival protection rate of the mice in the PA0833+Alum+DTC group is 100%. It is shown that the small molecule can effectively improve the immunogenicity of the candidate antigen, and DTC can significantly reduce the bacterial load when P. aeruginosa infects the lung, see Figure 4 B.

[0087] The above results show that the combination of DTC and aluminum adjuvant can not only enhance the cellular immune response, but also enhance the humoral immune response.

[0088] The above description is only a preferred embodiment of the present application, and is not intended to limit the scope of the present application; if the modification or equivalent replacement of the present application does not deviate from the spirit and scope of the present application, it should be covered in the protection scope of the claims of the present application.

[0089] SEQUENCE LISTING

[0090] SEQ ID NO: 1

[0091] ACCAGCGGGACATATGAATCT

[0092] SEQ ID NO: 2

[0093] AGACCTTGGCGGATCCTTTG

Claims

1. Use of sodium diethyldithiocarbamate in the manufacture of an adjuvant for a vaccine against Pseudomonas aeruginosa infection, said adjuvant being used in combination with an aluminium adjuvant, said vaccine comprising the Pseudomonas aeruginosa vaccine candidate antigen PA0833; said sodium diethyldithiocarbamate promoting Th17 cell differentiation inducing a Th17 response.

2. Use according to claim 1, characterized in that: said vaccine being used for the prevention of a pulmonary infection.

3. Use according to claim 1, characterized in that: said adjuvant being administered by injection at a dose of 50 μg / ml.

Images