Sex-related molecular markers, identification primer sets, kits and applications of Zhejiang mackerel

Abstract

The Zhejiang snakehead sex-related molecular marker, identification primer group, kit and application belong to the molecular biology identification technical field.The nucleotide sequence of the Zhejiang snakehead sex-related molecular marker is shown in SEQ ID No.1;the nucleotide sequences of the Zhejiang snakehead sex-related molecular marker identification primer group are shown in SEQ ID No.2 and SEQ ID No.3.The molecular marker, the primer group and the kit designed by the molecular marker and the identification method can realize the Zhejiang snakehead sex identification quickly, and have wide application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological identification, and particularly relates to a molecular marker related to the sex of Zhejiang black carp, an identification primer set, a kit and applications. Background Art

[0002] The blackmouth fish (Opsariichthys bidens), belonging to the order Cypriniformes, is a small fish endemic to East Asia and found in major water systems across northern and southern China. The taxonomic status of the blackmouth fish, including family and subfamily, has undergone numerous adjustments over the past half century. In the 1964 "Chinese Cyprinids (Volume 1)," the blackmouth fish was classified in the family Cyprinidae, subfamily Leucinae, and genus Opsariichthys, with two subspecies: the Amur blackmouth fish (Opsariichthys uncirostrisamurensis) and the southern blackmouth fish (Opsariichthys uncirostris bidens). In the 1998 "Fauna Sinica, Teleosteiformes (Volume 2)," the blackmouth fish was classified in the family Cyprinidae, subfamily Ichthyinae, and genus Opsariichthys, with only one species, the blackmouth fish (Opsariichthys bidens). With the rapid development of molecular biology techniques, molecular systematics has been widely applied to fish phylogenetic studies. With increasing evidence from molecular systematics and morphological studies, the 2017 classification of bony fishes reclassified the croaker to the family Cyprinidae, subfamily Cyprininae, and genus Cyprinidae. Due to rising market prices, declining wild stocks, and increasing demand for stocking and restocking, research on the breeding and aquaculture biology of croaker has increased in China. First, research is being conducted on the reproductive performance of croaker in different water and geographic populations. Second, research is being conducted on the improvement of artificial breeding and aquaculture techniques. Finally, research is being conducted on sperm physiology and embryonic development.

[0003] Sexual dimorphism in the blackmouth mullet has attracted considerable attention. Studies of sexual dimorphism in blackmouth mullet morphology have shown that, with the exception of body thickness, males are significantly larger than females in all other morphological characteristics. Therefore, all-male blackmouth mullet breeding has significant production and application value. The key to sex-controlled blackmouth mullet breeding lies in the development of molecular markers for sex. Initial efforts to screen for molecular markers of sex differences in blackmouth mullet used RAPD technology, but no suitable markers were developed. Gynogenetic and gonadal histological characterization indicate that blackmouth mullet in Zhejiang Province has an XX / XY sex determination pattern. Studies have shown that blackmouth mullet from Leshan and Ya'an, Sichuan (Qingyi River, a tributary of the Yangtze River) have a chromosome number of 2N = 74, with a karyotype formula of 6m + 6sm + 4st + 58t, while blackmouth mullet from Shaoguan, Guangdong (Beijiang River, a tributary of the Pearl River) have a chromosome number of 2N = 76, with a karyotype formula of 4m + 6sm + 4st + 62t. The applicant discovered through experiments that the number of chromosomes in Zhejiang mackerel is 2N=78, and the karyotype formula is 4m+4sm+4st+66t, indicating that Zhejiang mackerel should be an independent species different from the Pearl River and Yangtze River systems.

[0004] Zhejiang Province is the main production area and consumption market for the breeding and farming of black carp, and the industry development has an urgent need for all-male seedlings. Summary of the Invention

[0005] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide technical solutions for molecular markers related to the sex of Zhejiang black carp, identification primer sets, kits and applications.

[0006] The present invention specifically adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a molecular marker related to the sex of Zhejiang black carp. The nucleotide sequence of the molecular marker is shown as SEQ ID No.1.

[0008] The second aspect of the present invention provides a primer set for identifying molecular markers related to the sex of the Zhejiang black carp. The nucleotide sequences of the primer set are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0009] The third aspect of the present invention provides a kit containing the above primer set.

[0010] A fourth aspect of the present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer set or the above-mentioned kit in identifying the sex of Zhejiang mackerel.

[0011] A fifth aspect of the present invention provides a method for sex identification of Zhejiang croaker using the above primer set or the above kit, characterized by comprising the following steps:

[0012] 1) Extracting DNA from a sample of Zhejiang croaker to be tested as a template;

[0013] 2) PCR amplification was performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3, and the resulting PCR products were subjected to agarose gel electrophoresis;

[0014] 3) If the amplified product is a single band of 422 bp, the fish is determined to be male; if no amplified band is found, the fish is determined to be female.

[0015] Furthermore, the PCR reaction system is: 0.5 μL of 100 ng / μL DNA, 6.25 μL of 2×Premix Taq, 0.5 μL of each 10 mM primer, and 4.75 μL of ddH2O.

[0016] Furthermore, the PCR conditions are: 94°C for 3 min; 94°C for 30 s, 56°C for 30 s, 72°C for 20 s, 30 cycles; and extension at 72°C for 5 min.

[0017] The present invention has the following beneficial effects:

[0018] 1. The InDel molecular markers of the present invention are closely associated with the sex traits of Zhejiang mackerel. Through molecular markers, Zhejiang mackerel individuals can be identified and screened at the molecular level. The method is simple, accurate, and reliable, and is not restricted by the external environment or the individual growth and development stage. It can also be selected at an early stage, thereby effectively accelerating the breeding process of all-male Zhejiang mackerel.

[0019] 2. The identification method of the present invention is highly practical and has no specific requirements for the extraction method of Zhejiang mackerel genomic DNA and the agarose gel electrophoresis method. The method is simple and efficient, and the detection cost is low and the applicability is wide. It can be used for large-scale screening of Zhejiang mackerel males, effectively reducing breeding costs.

[0020] Therefore, the molecular markers of the present invention and the primer sets, kits and identification methods designed using the molecular markers have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the HiC heat map of Zhejiang mackerel;

[0022] Figure 2 This is the SNP distribution density map of 39 chromosomes of Zhejiang mackerel;

[0023] Figure 3 is the McHatton map of sex-linked SNP loci;

[0024] Figure 4 The figure shows the PCR electrophoresis detection results in the embodiment. If the amplified product is a single band of 422 bp, it is determined to be a male fish; if there is no amplified band, it is determined to be a female fish. DETAILED DESCRIPTION

[0025] The present invention will be further described below through the following specific embodiments, but the content of the present invention is not limited thereto at all.

[0026] Example 1: Whole genome sequencing of male and female Zhejiang mackerel

[0027] Whole-genome sequencing was performed on wild male and female Zhejiang croaker using the Pacbio platform in CLR mode. Hic sequencing was also used to assist with chromosome-level mapping. The resulting female reference genome was 818.78 Mb with an N50 of 25.29 Mb, mapped to 39 chromosomes; the male reference genome was 840.95 Mb with an N50 of 24.76 Mb, mapped to 39 chromosomes. Figure 1 This is the HiC heat map of Zhejiang mackerel.

[0028] Example 2: Large-scale male-female resequencing of Zhejiang croaker

[0029] 100 male and female 8-month-old pond-raised Zhejiang mackerel were selected. Gonads were dissected to determine sex, and fin rays were clipped and preserved in alcohol for DNA extraction. After quality control of the genomic DNA, paired-end libraries of 300-350 bp were constructed and resequenced on the DNBSEQ-T7RS platform at a sequencing depth of 15X. Call SNPs were identified using GATK (v3.3.0) and VCFtools. Figure 2 This is the SNP distribution density map of 39 chromosomes of Zhejiang mackerel.

[0030] Example 3: Gender GWAS Analysis

[0031] The GWAS analysis of sex traits used a logistic regression model in PLINK v 2.0. The significance threshold was set at P < 1 × 10 -6 The analysis results were compiled into a list of sex-related SNPs arranged in chromosomal order. Figure 3 This is the Manhattan map of sex-linked SNP loci.

[0032] Example 4: Development and Validation of Gender Indel Marker Screening and Identification Technology

[0033] Sex-specific indel markers were screened chromosome by chromosome. First, through coarse mapping of sex-associated SNPs and combined with collinearity analysis of the male and female genomes, indel markers were searched for in flanking regions. Ultimately, a 2648-bp indel marker was found on chromosome 24, located between 15488973-15508952 in females and 17210584-17233231 in males. The nucleotide sequence of this indel marker is shown in SEQ ID NO. 1.

[0034] The primers designed based on the flanking sequences were F: GCAATAAAGTTCATCTCTGCACAGC (shown in SEQ ID NO. 2); R: GCCTCGTGTAGCGAACAAGGAC (shown in SEQ ID NO. 3).

[0035] Forty-eight males and females were randomly selected from a Zhejiang croaker population for validation. PCR conditions were: 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 20 s, followed by extension at 72°C for 5 min. The PCR system consisted of 12.5 μL of the following: 0.5 μL of DNA (100 ng / μL), 6.25 μL of 2× Premix Taq, 0.5 μL of F / R primers (10 mM), and 4.75 μL of ddH2O.

[0036] like Figure 4 As shown, the results showed that a single band of 422 bp was amplified from 24 male fish, while no amplified band was found from 24 female fish, and the identification accuracy was 100%.

[0037] The amplified nucleotide sequence of 422 bp is shown as SEQ ID NO.4.

[0038] The present invention is not limited to the specific embodiments described above. The embodiments described above are merely intended to illustrate the use of the present invention in detail. Functionally equivalent production methods and technical details are also part of the present invention. In fact, based on the above description, those skilled in the art will be able to find different adjustments according to their respective needs, and such adjustments are intended to be within the scope of the appended claims.

Claims

1. Application of a primer set for identifying sex-related molecular markers of Zhejiang mackerel in identifying sex of Zhejiang mackerel, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1, and the nucleotide sequences of the primer set are shown in SEQ ID No. 2 and SEQ ID No.

3.

2. The use of a kit for identifying molecular markers related to the sex of Zhejiang black carp in identifying the sex of Zhejiang black carp, the kit containing a primer set for identifying molecular markers related to the sex of Zhejiang black carp, the nucleotide sequence of the molecular marker being shown as SEQ ID No. 1, and the nucleotide sequences of the primer set being shown as SEQ ID No. 2 and SEQ ID No.

3.

3. A method for sex identification of Zhejiang croaker, characterized in that The following steps are involved: 1) Extract DNA from the sample of Zhejiang mackerel as a template; 2) performing PCR amplification using the primers shown in SEQ ID No. 2 and SEQ ID No. 3, and performing agarose gel electrophoresis on the resulting PCR products; 3) If the amplified product is a single band of 422 bp, the fish is determined to be male; if no amplified band is found, the fish is determined to be female.

4. The method according to claim 3, wherein The PCR reaction system is: 0.5 μL of 100 ng / μL DNA, 6.25 μL of 2×Premix Taq, 0.5 μL of each 10 mM primer, and 4.75 μL of ddH 2 O.

5. The method according to claim 3, wherein The PCR conditions were as follows: 94°C for 3 min; 94°C for 30 s, 56°C for 30 s, and 72°C for 20 s, for 30 cycles; and extension at 72°C for 5 min.

Images