Glutamate dehydrogenase gene RkGDH2 and its application

Abstract

The present invention discloses a glutamate dehydrogenase gene RkGDH2 , isolated from Rhodosporidium Rhodosporidium short-lived ) YM25235, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO: 2; the gene was connected to a vector and transformed into red winter spore yeast cells. The experimental results showed RkGDH2 Overexpression of the gene can promote the synthesis of carotenoids by red winter spore yeast; the present invention provides a reference for large-scale commercial production of carotenoids.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and relates to a glutamate dehydrogenase gene RkGDH2 , specifically from Rhodosporidium Rhodosporidium kratochvilovae ) Glutamate dehydrogenase gene cloned from YM25235 RkGDH2 The gene is connected to a vector and transferred into yeast cells to increase the expression level of the gene and ultimately promote the synthesis of carotenoids. Background Art

[0002] Carotenoids are naturally occurring, fat-soluble pigments commonly found in the photosynthetic systems of higher plants, algae, and phototrophic bacteria. Carotenoids are terpenoid compounds composed of an isoprene backbone, most consisting of two 20-carbon units linked end-to-end to form a 40-carbon molecular skeleton, from which a variety of different compounds can be derived. Natural carotenoids are widely used in various fields, including food, pharmaceuticals, feed, and cosmetics, due to their strong antioxidant properties, including their ability to scavenge free radicals, prevent aging, and protect against cancer.

[0003] Currently, commercial carotenoids are primarily obtained through chemical synthesis, with smaller amounts derived from natural carotenoids extracted from plants and produced through microbial fermentation. While chemically synthesized carotenoids share a similar molecular structure to natural carotenoids, natural carotenoids offer greater health benefits. The advantage of microbial carotenoid production lies in the use of low-cost substrates, which can reduce production costs. Therefore, metabolic engineering research is increasingly becoming a promising alternative for efficient and cost-effective microbial production of carotenoids.

[0004] Carotenoids use acetyl CoA as a substrate and are synthesized into isopentenyl pyrophosphate (IPP) and dimethylallyl diphosphate (DMAPP) through the mevalonate (MVA) pathway. The two are concentrated and further converted into different carotenoids such as lycopene and β-carotene through different reaction processes.

[0005] The GDH2 gene encodes an NAD-linked glutamate dehydrogenase. When overexpressed or when NH 4＋ When abundant, it uses NADH as a cofactor to participate in the production of glutamate, catalyzing the oxidative deamination of glutamate to produce α-ketoglutarate and ammonium. The GDH2 gene encodes a 1092 amino acid protein located on chromosome XII, which is closely related to Neurospora ( Neurosporu) have a high sequence similarity to the cross-glutamate dehydrogenase of GDH2. α-Ketoglutarate is an important compound in the TCA cycle. After the TCA cycle, it can effectively promote the synthesis of acetyl CoA, the substrate for carotenoid synthesis, thereby increasing the content of carotenoid synthesis. GDH2 plays an important role in glutamate metabolism and is mainly involved in the biosynthesis and decomposition of glutamate. Under glucose growth conditions, the concentration of NAD cofactor in the cytoplasm is higher. Therefore, it forces the reaction to glutamate degradation to obtain NAD-NADH balance, and by regulating the NAD-NADH balance, it affects the response of cells to environmental changes. GDH2 also interacts with the GDH1 and GDH3 genes to jointly regulate glutamate homeostasis and ammonia absorption. Therefore, we studied the glutamate dehydrogenase gene GDH2 and analyzed its effect on the biosynthesis and decomposition of Rhodosporidium involucral ( Rhodosporidium kratochvilovae ) The carotenoid synthesis mechanism of YM25235 was affected, laying the foundation for the large-scale production of carotenoids. Summary of the Invention

[0006] The present invention provides a glutamate dehydrogenase gene RkGDH2 , which is derived from Rhodosporidium Rhodosporidium kratochvilovae ) YM25235. The nucleotide sequence of this gene is shown in SEQ ID NO:1. The gene sequence is 3039 bases (bp) long, and the amino acid sequence encoded by this gene is shown in SEQ ID NO:2. When this gene was linked to a vector and transferred into Rhodosporidium yeast cells, increased expression of this gene promoted carotenoid synthesis.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] 1. Total RNA was extracted from red winter spore yeast YM25235, and then reverse transcribed to synthesize cDNA. The synthesized cDNA was used as a template and amplified by RkGDH2 The target sequence was obtained by polymerase chain reaction amplification using specific primers of the gene. The vector pRH2034 was double-digested and recovered. The target fragment and the vector were connected by one-step cloning to obtain the connection product recombinant plasmid pRHRkGDH2. The recombinant plasmid pRHRkGDH2 was transformed into Escherichia coli and positive single clones were screened by PCR. The recombinant plasmid pRHRkGDH2 was used BamH Ⅰ. EcoR Ⅴ Two restriction endonucleases were used for enzyme digestion verification. After culturing the positive clones, plasmids were extracted and sequenced to obtain a glutamate dehydrogenase gene with a fragment size of 3039 bp. RkGDH2 ;

[0009] 2. The recombinant vector pRHRkGDH2 was transformed into Rhodosporidium spp. YM25235 using the PEG-mediated protoplast method. The transformants were screened to obtain an overexpression strain containing pRHRkGDH2. The overexpression strain containing pRHRkGDH2 was cultured, the pigment was extracted, and the total carotenoid content was measured using a UV-visible spectrophotometer.

[0010] The red winter spore yeast YM25235 strain used in the present invention has the advantages of low raw material cost, short production cycle, genetic stability, high safety, etc. The glutamate dehydrogenase gene is cloned from the cDNA reverse transcribed from the total RNA extracted from the strain. RkGDH2 , the red winter spore yeast was transformed by genetic engineering, and the red winter spore yeast YM25235 RkGDH2 Overexpression of the gene leads to an increase in the content of carotenoids in cells; the present invention provides a new method for producing carotenoids, which provides good application prospects and economic benefits for the industrial production of carotenoids; the method of the present invention is simple, easy to operate, and suitable for industrial production and market promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The present invention is red winter spore yeast YM25235 RkGDH2 Gene PCR amplification diagram; 1. DNA molecular weight marker DL5000; 2. Negative control; 3. Gene RkGDH2 cDNA fragments;

[0012] Figure 2 is the plasmid map of the recombinant plasmid pRHRKGDH2;

[0013] Figure 3 Electrophoresis diagram for colony PCR verification; 1. DNA molecular weight marker DL5000; 2. Negative control; 3. Gene RkGDH2 cDNA fragments; the rest are transformants;

[0014] Figure 4 Restriction enzyme analysis of recombinant plasmid pRHRkGDH2; 1. DNA molecular weight marker DL10000; 2. negative control; 3. plasmid pRH2034 BamHI and EcoRV Double enzyme digestion; 4. Recombinant plasmid pRHRkGDH2 BamHI 、 EcoRV Double enzyme digestion; 5. Gene RkGDH2 cDNA fragment; 6. DNA molecular weight marker DL5000;

[0015] Figure 5Verification of positive clones in Rhodosporidium yeast YM25235 transformed with the recombinant plasmid pRHRkGDH2; 1. DNA molecular marker DL5000; 2. Negative control; 3. PCR product amplified from the YM25235 genome; 4. PCR product amplified from the plasmid pRHRkGDH2; 5. PCR product amplified from the YM25235 / pRHRkGDH2 genome;

[0016] Figure 6 Comparison of carotenoid content between the overexpression strain YM25235 / pRHRkGDH2 and the control strain YM25235. DETAILED DESCRIPTION

[0017] The present invention will be further described in detail below with reference to the accompanying drawings and examples, but the scope of protection of the present invention is not limited to the contents described above. The reagents and methods used in the examples are conventional reagents and methods unless otherwise specified. Example 1

[0018] 1. Total RNA of red winter spore yeast YM25235 was extracted using UNlQ-10 column Trizol total RNA extraction kit (product number: SK1321) from Sangon Biotech (Shanghai) Co., Ltd., and then reverse transcribed to synthesize cDNA according to the operating instructions of Vazyme's kit (product number: R212-02) HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). 1 μL of cDNA was used as a template for polymerase chain reaction. According to the results of transcriptome sequencing, RkGDH2 Sequence, design specific primers RkGDH2 -F and RkGDH2 -R, using the cDNA template obtained above, using primers RkGDH2 -F and RkGDH2 -R, PCR amplification was performed on a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.). The primers, amplification system, and amplification conditions used in the reaction were as follows:

[0019] RkGDH2 -F:5'- ATCACTCACCATGGCGGATCC GATGATTGCCCCGCCGTC-3', (double underline indicates upstream vector end homologous sequence, single underline indicates upstream vector end homologous sequence BamHⅠ enzyme cleavage site);

[0020] RkGDH2 -R:5'- CCGGTCGGCATCTACGATATC TCACGCCTCGGCATCAG-3', (double underline indicates the downstream vector end homologous sequence, single underline indicates EcoRV enzyme cleavage site);

[0021] The PCR amplification system is as follows (50 μL): Template cDNA 1 μL, RkGDH2 -F 2μL, RkGDH2 -R 2μL, dNTPs Mix (10mM each) 1μL, Vazyme 2×Phanta Max Buffer 25μL, Vazyme Phanta MaxSuper-Fidelity DNA Polymerase 1μL, ddH2O added to 50μL;

[0022] Amplification conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 68℃ annealing for 15 s, 72℃ extension for 3 min 5 s, for a total of 30 cycles; final extension at 72℃ for 5 min; after the reaction, 2 μL of the product was taken and analyzed by electrophoresis in 1% agarose gel. The results are as follows Figure 1 As shown; the amplified fragment of about 3039 bp was named RkGDH2 ;

[0023] pRH2034 was injected into BamH Ⅰ [[ID=,43]]、EcoR Ⅴ Double digestion with two restriction endonucleases; the above two fragments were recovered using a multifunctional DNA recovery kit (Beijing Biotech Biotechnology Co., Ltd., product number: DP1502), and the recovered two fragments were ligated using a seamless cloning kit (LightNing™ DNA Assembly Mix Plus, Jiangsu Biotech Biotechnology Co., Ltd.) to obtain the recombinant plasmid pRHRkGDH2. The ligation system was as follows (10 μL): LightNing™ DNA Assembly Mix Plus 5 μL, linearized vector pRH2034 3 μL, RkGDH2 2 μL of fragment was added; the mixture was gently pipetted and mixed, and the reaction solution was collected at the bottom of the tube by brief centrifugation. The reaction was then carried out in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) at 37°C for 30 min; the temperature was lowered to 4°C or immediately placed on ice for cooling.

[0024] 2. Take 10µL of the obtained ligation product and add it to 100µL of DH5α competent cells. Gently tap the tube wall to mix, place on ice for 30 minutes, heat shock in a 42℃ water bath for 90 seconds, and immediately place it on ice to cool for 90 seconds. Add 900µL of LB liquid medium to the ligation system, incubate at 37℃ and 100rpm for 1 hour, centrifuge at 5000rpm for 10 minutes, discard 900µL of supernatant, and gently pipette the remaining 100µL of LB medium to suspend the bacteria and spread it on an LB solid plate (containing 100µg / mL spectinomycin). Incubate it upside down at 37℃ for 12-16 hours. Randomly pick 5 white colonies growing on the plate and verify the positive clones by colony PCR. The results are shown in the figure. Figure 3 As can be seen from the figure, the selected monoclonal strains all amplified specific bands with the same size as the target fragment through colony PCR, indicating that the recombinant plasmids were successfully transferred into the selected DH5α strains. The positive clones were inoculated into LB liquid medium (containing 100μg / mL spectinomycin) and cultured overnight. The bacteria were collected and the plasmids were extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA). BamH Ⅰ 、EcoR Ⅴ Double enzyme digestion verification of pRHRkGDH2 was performed, and the results are shown in Figure 4 The results showed that after double enzyme digestion, the recombinant plasmid pRHRKGDH2 produced two bands of about 3kb and 10kb, which were respectively RkGDH2 The fragment was consistent in size with the fragment of pRH2034 vector after double enzyme digestion, which preliminarily indicated that the recombinant plasmid pRHRkGDH2 was successfully constructed. The plasmid map of the recombinant vector pRHRkGDH2 is shown in Figure 2 Sequencing was performed using sequencing primers, and the plasmids that were correctly digested by enzymes were sent for further sequencing verification. The sequencing results showed that the sequence obtained was completely consistent with the target sequence, without any base mutations or deletions.

[0025] 3. A single clone of the DH5α strain that had successfully been transformed with the correct recombinant vector pRHRkGDH2 was selected and inoculated into LB liquid medium (containing 100µg / mL spectinomycin) for overnight culture. The plasmid was extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA), the concentration was measured, and the cells were stored at -20°C until further use. The recombinant vector pRHRkGDH2 was transformed into Rhodosporidium spp. YM25235 using the PEG-mediated protoplast transformation method. The specific method is as follows: a single colony of Rhodosporidium spp. YM25235 was selected and inoculated into 5mL of YPD liquid medium. The culture was shaken at 28°C and 160rpm overnight to serve as the seed solution. The seed solution was transferred to 50mL of YPD liquid medium at a 1% inoculum volume and shaken at 28°C and 160rpm until the bacterial solution OD reached 0.600The pH value was between 0.45 and 0.5, and the bacterial solution was centrifuged at 4°C and 4500 rcf for 5 min to collect the bacteria; the collected bacteria were washed twice with a pre-prepared citric acid buffer (30 mmol / L citric acid, 83 mmol / L sodium citrate, 600 mmol / L mannitol, and NaOH adjusted to pH 5.4), and the bacteria were suspended in 800-1000 μL citric acid buffer and placed on ice for later use; the enzymatic hydrolysis solution (0.075 g snail enzyme, 0.03 g Sigma lytic enzyme, dilute to 5 mL with citrate buffer), filter with a 0.22 μm sterile filter membrane, and place in a 5 mL sterile centrifuge tube for later use; take 4 mL of enzyme solution and mix with 800-1000 μL of bacteria suspended in citrate buffer and place at 28 ° C, 90 rpm shaking culture for 2.5-3 hours for enzymatic hydrolysis, take a small amount of bacterial solution and observe the enzymatic hydrolysis efficiency under a microscope. When the enzymatic hydrolysis amount is confirmed to be sufficient, the culture is centrifuged at 4 ° C, 1300 rpm for 10 minutes to collect the bacteria; add 10 mL of STC buffer (1.2 mol / L sorbitol, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) and wash the collected bacteria twice on ice to make yeast competent cells; suspend the bacteria with 800-1000 μL of STC buffer and dispense 100 μL into 5 mL sterile centrifuge tubes for later use; add 10 μL to 100 μL of competent cells The pRHRkGDH2 recombinant plasmid was gently mixed and incubated on ice for 10 min. 200 μL of pre-cooled PTC buffer (50% PEG, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) was added and ice-bathed for 10 min. 200 μL of pre-cooled PTC buffer was added again and ice-bathed for 10 min. Finally, 800 μL of pre-cooled PTC buffer was added and gently mixed. The cells were incubated at 42°C for 30 min. After the water bath, the cells were centrifuged at 4°C and 1500 rpm for 10 min to collect the cells. 1 mL of supernatant was discarded and 1 mL of 0.4 mol / L sucrose YPD liquid medium was added to suspend the cells. The cells were shaken at 28°C and 90 rpm for 24 h to recover the cells. The recovered cells were centrifuged at 1300 rpm for 10 min to collect the cells. The supernatant was discarded and the cells were suspended in the remaining 100 μL of culture medium. Finally, the cells were spread on 0.Transformants were cultured inverted on 4 mol / L sucrose YPD solid medium (containing 40 μg / mL hygromycin B) at 28°C for 3-4 days. Once grown on the solid medium, transformants were numbered and transferred to YPD solid medium containing 150 μg / mL hygromycin B and cultured inverted at 28°C for two days. Based on the known function of the gene and the characteristics of the rhodosporidium yeast YM25235, color was used as a criterion for screening overexpressing strains. The transformants were inoculated into a 5 mL tube containing YPD liquid medium and cultured at 28°C with shaking at 160 rpm for 120 h. Wild-type YM25235 strains were used as controls, and color was observed. Transformants with a redder color than YM25235 were selected. Selected transformants were then used to extract genomic DNA from the yeast transformants according to the instructions of a DNA extraction kit (purchased from Shanghai Sangon Biotechnology Co., Ltd.). PCR verification was performed, and the results were as follows. Figure 5 As shown in the figure, it can be seen that the transformant genome can be used as a template by PCR to amplify the RkGDH2 The cDNA fragments of the same size were found in the recombinant transformants, indicating that the genes of the recombinant transformants were correct. RkGDH2 The fragment was successfully introduced into the genome of yeast transformants.

[0026] Example 2: Analysis of carotenoid content in overexpression strain YM25235 / pRHRkGDH2

[0027] Positive transformants were inoculated into 50 mL YPD liquid medium and cultured at 28 °C and 160 rpm for 168 h. The cells were collected by centrifugation at 4500 rpm for 6 min in a 50 mL centrifuge tube and washed twice with pre-cooled ddH2O. The supernatant was completely removed by centrifugation at 4500 rpm for 8 min. The tube wall was gently tapped to make the cells adhere evenly to the inner wall of the tube. The cells were dried in an oven at 55 °C and then ground into powder. 0.4 g of the powder was taken and eluted with acetone-methanol mixture (V （丙酮） :V （甲醇）=4:1) to extract total carotenoids. Referring to the method in "Improved UV spectrophotometric determination of total carotenoids in sea buckthorn oil" by Yang Wanzheng et al. [J]. Journal of Minzu University of China (Natural Science Edition), 2009, 18(03): 5-8," a UV-visible spectrophotometer was used. The wild-type red winter spore yeast YM25235 strain was used as a control. The absorbance was measured at 450 nm and the total carotenoid content (mg / g dry bacteria) was calculated. The total carotenoid synthesis amount of the wild-type red winter spore yeast YM25235 strain was 5.08±0.10 mg / g, while the carotenoid synthesis amount of the overexpression strain YM25235 / pRHRkGDH2 was 6.86±0.07 mg / g. The total carotenoid synthesis amount of the overexpression strain YM25235 / pRHRkGDH2 was 1.35 times that of the control strain. The total carotenoid synthesis of the overexpression strain YM25235 / pRHRkGDH2 was significantly increased compared with the wild-type Rhodosporidium yeast YM25235 strain (e.g. Figure 6 As shown); the results showed that glutamate dehydrogenase gene RkGDH2 Overexpression of can increase the total carotenoid content in Rhodosporidium yeast YM25235 strain. RkGDH2 It should be noted that there seems to be an incorrect comma in "、EcoR" in the original text. This might be a typo. The translation is done as accurately as possible based on the provided text. Genes can promote the synthesis of total carotenoids.

Claims

1. A glutamate dehydrogenase gene RkGDH2 , whose nucleotide sequence is shown in SEQ ID NO:

1.

2. The glutamate dehydrogenase gene according to claim 1 RkGDH2 In promoting the development of Rhodosporidium Rhodosporidium short-lived ) Application in the production of carotenoids.

Images