A silique gene of Brassica napus and its identification and application

Abstract

The present invention discloses a silique gene of Brassica napus and its identification and application, wherein the gene comprises a CDS sequence belonging to Hap1 of the BnaA09CRF6 gene, wherein the 319th base of the sequence is mutated from thymine to guanine, and the 107th amino acid of the core domain is changed from hydrophilic serine to hydrophobic alanine, and a dCAPS marker based on specific SNP variation is provided for identifying the silique length of Brassica napus. The present invention develops a dCAPS marker closely related to silique length based on whole genome association analysis, haplotype analysis, and sequence specificity analysis, and the marker can provide a new method for variety screening of silique materials, molecular marker-assisted selection, and variety breeding of aggregate breeding of genes related to multiple excellent traits in the future.

Description

Technical Field

[0001] The invention belongs to the field of crop genetic breeding, and relates to a molecular marker for screening materials with different silique lengths of Brassica napus, and a method for screening materials with different silique lengths of Brassica napus using the marker, including a method for screening target strains and selecting breeding prospects using the marker. Background Art

[0002] Rapeseed oil is one of the most important edible vegetable oils in my country, and its output accounts for about 55% of the total vegetable oil in the country. Rapeseed oil can not only play an important role in biochemical engineering, but rapeseed cake is also an important animal feed. With the continuous development of my country's population and social economy, my country has gradually become a major consumer of rapeseed oil, so the demand for improving rapeseed yield and quality has become more urgent. In the late stage of rapeseed development, siliques are important photosynthetic organs of the plant. Siliques play a vital role in the accumulation and distribution of "source" and "sink". The variation of silique-related traits has an important impact on improving seed yield.

[0003] Silique length, 1000-grain weight, number of grains per silique, silique weight, husk rate, seed density and other traits are all silique-related traits. Among these traits, silique length is most closely related to 1000-grain weight and number of grains per silique and rapeseed yield, and these three traits show significant correlation. Studies have shown that 60% of the assimilation products of rapeseed seeds are produced by the silique skin. When the silique skin becomes longer, its photosynthesis area increases, which can provide more energy to the seeds, which is beneficial to the development of seeds and the increase of 1000-grain weight.

[0004] So far, a large number of QTLs related to silique length in Brassica napus have been reported, and a few genes that control silique development have also been cloned, and some progress has been made using genetic engineering breeding technology, but the public's doubts about genetically modified crops have not been eliminated, and the society generally has a low acceptance of genetically modified products, making it difficult to promote and demonstrate genetically modified varieties on a large scale and apply them in actual production. Therefore, the applicant is funded by the National Key R&D Program-Agricultural Biological Breeding Major Project "Mining and Breeding Value Evaluation of New Genes Controlling Plant Type, 2023ZD0406801" to carry out research related to mining excellent alleles for silique-related traits and designing related molecular markers, and applying these markers to prospect selection in breeding practice, which can significantly improve breeding efficiency, reduce breeding years, and facilitate the selection of excellent and high-yield new varieties of Brassica napus. Summary of the invention

[0005] In view of this, one of the objectives of the present invention is to provide a gene related to silique length development of Brassica napus that has not been reported before.

[0006] The second object of the present invention is to provide a specific molecular marker based on a specific SNP locus and capable of screening out different silique lengths in Brassica napus varieties.

[0007] The third object of the present invention is to provide a method for identifying the length of Brassica napus siliques using the specific dCAPS marker provided by the present invention.

[0008] A fourth object of the present invention is to provide a method for breeding silique Brassica napus varieties using the CDS sequence of Hap1 of the BnaA09CRF6 gene.

[0009] A fifth object of the present invention is to provide a method for breeding Brassica napus using the specific dCAPS marker-assisted selection.

[0010] The sixth object of the present invention is to provide a method for genome-wide association analysis using the CDS sequence of Hap1 of the BnaA09CRF6 gene.

[0011] The seventh object of the present invention is to provide a molecular breeding material for Brassica napus.

[0012] To solve the above technical problems, the technical solution provided by the present invention is to provide a Brassica napus silique gene, comprising a CDS sequence belonging to Hap1 of the BnaA09CRF6 gene, wherein the 319th base of the sequence is mutated from thymine to guanine. The nucleotide sequence is shown in the sequence table Seq ID NO.1.

[0013] According to one embodiment of the silique gene of the present invention, the 107th amino acid of the core domain of BnaA09CRF6 is changed from hydrophilic serine to hydrophobic alanine. The amino acid sequence is shown in Seq ID NO.2.

[0014] The present invention also provides a dCAPS marker based on specific SNP variation, which is used to identify the length of siliques of Brassica napus. The marker is based on the SNP site at the 319th base of the BnaA09CRF6 gene coding sequence.

[0015] According to one embodiment of the dCAPS marker of the present invention, it comprises a pair of primers:

[0016] Upstream primer F: 5'-TCCTCCTCCTCCTCTTCGAGAAAAGCT-3'; as shown in Seq ID NO.3 in the sequence list;

[0017] Downstream primer R: 5'-CGAGACGACGGATCTCTGATCTCCCTCG-3'; as shown in the sequence listing Seq ID NO.4.

[0018] The present invention also provides a method for identifying the length of Brassica napus siliques using the specific dCAPS marker, comprising the following steps:

[0019] S1.1 Select one or more Brassica napus varieties to be tested for DNA extraction;

[0020] S1.2 perform PCR amplification using the dCAPS marker to obtain a PCR product;

[0021] S1.3 digest the PCR amplification product obtained in the previous step with a restriction endonuclease to create restriction endonuclease polymorphism;

[0022] S1.4 The fragments obtained by enzyme digestion in S1.3 were subjected to electrophoresis detection. The electrophoresis results showed obvious high and low bands among different varieties; the high bands corresponded to short-silique rape varieties, and the low bands corresponded to long-silique rape varieties.

[0023] According to one embodiment of the method for identifying the length of Brassica napus siliques using the specific dCAPS marker of the present invention, the specific operation of the PCR amplification is as follows:

[0024] The PCR reaction system was: 12.5 μL of 2× SanTaq PCR Mix, 0.5 μL of each of 10 μM forward primer and 10 μM, 2 μL of 100 ng / μL DNA template, and then double distilled water was used to make up to 25 μL system;

[0025] PCR reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 68°C for 30 s, extension at 72°C for 20 s, 10 cycles, with the annealing temperature decreasing by 1°C in each cycle; then denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, 35 cycles; full extension at 72°C for 10 min.

[0026] The specific operation of the enzyme cutting is as follows:

[0027] The enzyme digestion reaction system was: 10×FastDigest Buffer 2 μL, first PCR amplification product 10 μL, XhoI restriction endonuclease 2 μL, ddH2O to 20 μL, 37°C enzyme digestion reaction for 2 h, and thermal denaturation at 80°C for 20 min.

[0028] The electrophoresis detection conditions are:

[0029] 3.0% agarose gel; electrophoresis voltage 130V; electrophoresis time 50 minutes.

[0030] The present invention also provides a method for breeding silique Brassica napus varieties by using the CDS sequence belonging to Hap1 of the BnaA09CRF6 gene, and the Brassica napus varieties containing the CDS sequence are screened by molecular marker-assisted selection technology.

[0031] The present invention also provides a method for breeding Brassica napus using the specific dCAPS marker-assisted selection, wherein genotype identification is performed on Brassica napus materials at the seedling stage, and materials with SNP genotype T are selected for backcrossing and breeding.

[0032] The present invention also provides a method for performing genome-wide association analysis using the CDS sequence belonging to Hap1 of the BnaA09CRF6 gene, and the method is used for screening and breeding by analyzing the correlation between the sequence and the length of the silique.

[0033] The present invention also provides a Brassica napus molecular breeding material, comprising the CDS sequence to which Hap1 of the BnaA09CRF6 gene belongs; the material is used to improve the silique length characteristic of Brassica napus.

[0034] Compared with the prior art, the above technical solution has the following advantages:

[0035] a) Based on genome-wide association analysis and haplotype analysis, the present invention discovered an unreported gene controlling the rapeseed silique length trait, and developed a dCAPS marker for a specific SNP locus.

[0036] a) Using dCAPS markers that are closely linked to superior alleles will provide a new method for the future screening of Brassica napus silique germplasm resources and molecular marker-assisted breeding, as well as the screening and utilization of high-yield and high-quality breeding materials or varieties.

[0037] b) The present invention develops dCAPS markers for specific genes, and uses markers to assist in breeding selection of other excellent breeding materials in lower generations, which helps to perform aggregate breeding of siliques and other excellent genes in breeding materials in lower generations, effectively reducing the workload of high-generation variety breeding.

[0038] c) The dCAPS marker involved in the present invention is a co-dominant marker, which can distinguish the homozygotes and heterozygotes in the target site through simple PCR and electrophoresis detection. The genotype of the plant can be identified by using this marker in the early growth stage of Brassica napus, which can effectively avoid the self-pollination step in the backcrossing process.

[0039] d) The present invention develops dCAPS markers that are closely linked to the nucleic acid sequence of a specific gene, and uses a marker-assisted strategy to select breeding materials at low generations, which helps to aggregate excellent yield-related genes in breeding materials at low generations, reduce the workload of high-generation breeding selection, reduce the breeding scale, and shorten the breeding period.

[0040] e) The molecular marker provided by the present invention is a co-dominant marker, which can distinguish between homozygotes and heterozygotes. The marker can be used to identify the genotype of the plant at the seedling stage of Brassica napus, eliminating the step of self-pollination in each generation during the backcrossing infiltration process. In addition, the molecular marker in the present invention can be used to perform polymorphism analysis based on the agarose electrophoresis results after enzyme digestion of the PCR product, so that the alleles from different varieties can be identified, thereby determining the silique length characteristics of the variety, without the need for sequencing or complicated polyacrylamide gel electrophoresis operations, and the entire detection process has the characteristics of simple operation, reliable results, rapidity and high efficiency.

[0041] f) A marker provided by the present invention has important application potential and breeding value. This marker can be used to quickly select and breed silique varieties, while improving the application prospects of various superior genes in aggregate breeding, and can significantly accelerate the selection process of silique-type cabbage-type rapeseed varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain implementation cases of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0043] Figure 1 It is the result of genome-wide association analysis and expression analysis of BnaA09CRF6 and its homologs in extreme materials. Figure 1 In the figure, a and b are the results of genome-wide association analysis at different locations; c is the LD analysis of the candidate segments of the association analysis; d is the expression pattern of the genes involved in the present invention at different stages of silique development.

[0044] Figure 2 It is a haplotype analysis of the genes involved in the present invention. Figure 2 In the figure, a is the result of SNP differences among different haplotypes; b is the silique length among different haplotypes.

[0045] Figure 3 It is the silique performance of different haplotype materials of the gene involved in the present invention. Figure 3In the figure, a is a diagram of siliques of different haplotype materials; b is a microscopic section observation of cells of silique peel of different haplotype materials; c is a statistical diagram of cell length of silique peel of different haplotype materials; d is a statistical diagram of cell width of silique peel of different haplotype materials.

[0046] Figure 4 The figure is a comparison diagram of nucleic acid (a) and amino acid (b) sequences of different haplotype materials with respect to the gene involved in the present invention.

[0047] Figure 5 This is the agarose gel electrophoresis result of restriction digestion after dCAPS marker amplification. DETAILED DESCRIPTION

[0048] The following is a description with reference to the accompanying drawings and a specific embodiment.

[0049] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0050] Example 1

[0051] The present invention develops a specific dCAPS marker that is closely related to silique length and has a clear targeting based on whole genome association analysis, haplotype analysis, and sequence analysis. This marker can provide a new method for screening silique Brassica napus germplasm resources and variety breeding, promoting breeding with multiple excellent genes, and creating high-quality and high-yield breeding materials.

[0052] In this implementation case, how to use the molecular marker will be described in detail, and these descriptions can make ordinary technicians in the field relatively easy to understand and apply the technical innovations and operating methods of the present invention.

[0053] 1. BnaA09CRF6 is significantly associated with silique development

[0054] In the previous research, the present invention used 286 Brassica napus data materials with wide variations obtained from different units across the country, planted them in Beibei, Chongqing and Yongchuan, Chongqing respectively, and investigated and counted the length of siliques at maturity, and then combined with 286 resequencing data (5×) from the laboratory for whole genome association analysis.

[0055] According to the analysis results, the inventors found a SNP peak on chromosome A09 that was significantly correlated with silique length ( Figure 1 In a and b), the SNP peak includes 40 significant SNP sites. All candidate genes in the region were analyzed, and it was found that a candidate gene BnaA09CRF6 (gene ID: BnaA09g39350D) significantly correlated with silique length was detected near the significant SNP site of A09 (S9_27892728).

[0056] When the SNPs in this region were subjected to linkage disequilibrium (LD) analysis, it was found that all SNPs within the gene BnaA09CRF6 involved in the present invention had a high LD value ( Figure 1 c). Subsequently, the important candidate genes in this region were further analyzed, and it was found that BnaA09CRF6 showed relatively high expression in long silique materials and relatively low expression in short silique materials at different stages of silique development. At the same time, the homologous gene AtCRF6 of the BnaA09CRF6 gene in Arabidopsis thaliana played an important role in the development of pistil and silique. Therefore, the present invention uses BnaA09CRF6 as an important candidate gene for silique length development.

[0057] Based on the above resequencing data, the inventors found a total of 5 SNPs within the gene, and then analyzed these SNPs in 286 data sets, and finally obtained 3 different haplotypes (Hap, Haplotype) ( Figure 2 A statistical analysis was performed on the above three different haplotype silique materials, and it was found that the silique length of the material carrying Hap1 was significantly longer than that of the materials carrying Hap2 and Hap3 haplotypes ( Figure 2 (b)

[0058] The inventors observed the length of siliques of different haplotype materials in the field and found that the siliques of materials carrying Hap1 were the longest, while the siliques of materials carrying Hap2 and Hap materials were similar in length, both significantly shorter than those of materials carrying Hap1 ( Figure 3 (a), which is consistent with the previous research results. At the same time, the microstructure of the silique skin carrying materials with different haplotypes was observed. The results showed that compared with the cell size of materials carrying Hap2 and Hap3, the haplotype material of Hap1 had significantly larger volume of silique inner epidermal cells ( Figure 3 (b)

[0059] In addition, the inventors quantified the cell sizes of different haplotype materials and the results showed that the length of cells carrying Hap1 was significantly longer than that of cells carrying Hap2 and Hap3 ( Figure 3c), but the width of cells carrying Hap1 material is slightly larger than that of cells carrying Hap2 and Hap3 materials. The statistical results show that the difference is not significant ( Figure 3 (d)

[0060] The above results indicate that in different haplotype materials, the change in silique length is mainly caused by cell expansion rather than cell proliferation.

[0061] Sequence analysis results showed that Hap1 had a thymine-to-guanine mutation at base 319 in the CDS region compared to Hap2 and Hap3 ( Figure 4 a), the nucleotide sequence is shown in Seq ID NO.1. This mutation directly causes the 107th amino acid of the core domain of BnaA09CRF6 involved in the present invention to change from hydrophilic serine to hydrophobic alanine ( Figure 4 b), the amino acid sequence is shown in Seq ID NO. 2. This may be the reason for the functional differentiation between different haplotypes.

[0062] 2. Development of dCAPS markers based on specific SNP variations

[0063] Based on the sequence differences of the BnaA09CRF6 gene between different haplotype materials obtained from the above resequencing data, the inventors performed first-generation sequencing on different materials to verify the authenticity of this site in different haplotype materials. Therefore, it is feasible to design dCAPS markers for this site to distinguish different haplotype materials, thereby distinguishing the silique length of different haplotypes.

[0064] This site is as described above ( Figure 4 From a), we can see that the base 319 of the Hap1 long silique material is T, while the base 319 of the Hap2 and Hap3 short silique materials is G. Since there is no restriction endonuclease cleavage site at this position, other mutant bases need to be introduced to form a restriction endonuclease cleavage site at this position.

[0065] The inventors designed dCAPS markers using the dCAPS Finder 2.0 website (http: / / helix.wustl.edu / dcaps / dcaps.html), extracted 25 bp sequences before and after amino acid position 319, input the sequence of the Hap1 haplotype as the WT sequence frame, and manually changed the 319th base to G as the Mutant sequence frame input. When the number of mismatched bases was selected as 1 for primer design, it was found that no commonly used enzyme cutting sites were found in all 24 primers obtained. The number of mismatched bases was selected as 2 for the second primer design, and 62 selectable primers and restriction endonuclease information were obtained.

[0066] The inventors chose to introduce mismatched base CT near the specific SNP position in the reverse primer, so that the XhoI restriction site CTCGAG can be introduced into the specific SNP site. The mismatched base can be used to obtain the SWU_BnCRF6dCAPSR primer sequence: (CGAGACGACGGATCTCTGATCTCCCTCG); the SWU_BnCRF6dCAPSF primer sequence: (TCCTCCTCCTCCTCTTCGAGAAAAGCT) is designed upstream of the specific SNP site. This pair of primers is the dCAPS marker used in the present invention.

[0067] The present invention randomly adopts 15 resource materials with different haplotypes, wherein 5 copies of each haplotype are used for plant leaf DNA extraction, and the first PCR amplification is performed using dCAPS marker, the amplified product is digested with endonuclease XhoI, and then the polymorphism of the digested product is analyzed by agarose gel electrophoresis, so that different haplotypes of the material can be identified.

[0068] The specific operation of the first PCR amplification is as follows:

[0069] The first PCR reaction system was: 2×SanTaq PCR Mix 25 μL, 10 μM forward primer SWU_BnCRF6dCAPSF and 10 μM reverse primer SWU_BnCRF6dCAPS, 1 μL each, 100 ng / μL DNA template 2 μL, and then double distilled water was used to make up to 25 μL system;

[0070] The first PCR reaction program was: pre-denaturation at 94°C for 5 min; 10 cycles of denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 20 s, with the annealing temperature decreasing by 1°C in each cycle; then 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 20 s; and full extension at 72°C for 10 min.

[0071] The reaction system for the first PCR amplification reaction product digested with restriction endonuclease XhoI was: 10×Fast Digest Buffer 2 μL, first PCR amplification product 10 μL, XhoI restriction endonuclease 2 μL, followed by double distilled water to make up to 20 μL system, digestion at 37°C for 2h, and thermal denaturation at 80°C for 20min.

[0072] 10 μL of the digested product was subjected to electrophoresis on a 3.0% agarose gel at 130 V for 50 minutes.

[0073] The first electrophoresis test results are as follows Figure 5As shown, the PCR amplification product of the variety (silique) with the SNP locus genotype of T is a single 105 bp fragment after XhoI digestion, and the electrophoresis detection band is a low band ( Figure 5 The PCR amplification product of the variety with genotype G is still a single 134bp fragment after restriction digestion with XhoI, and the electrophoresis detection band is a higher band ( Figure 3 The above results show that the dCAPS marker has high specificity and recognition and wide applicability. It can be used to distinguish the Brassica napus varieties with longer siliques (Hap1 material) and the varieties with shorter siliques (Hap2 and Hap3) relatively conveniently, quickly and accurately. Therefore, the specific dCAPS marker pair described in the present invention has good reliability and practicality.

[0074] The molecular marker of the present invention is developed based on the SNP site in the exon region of the gene. The Brassica napus material screening method of the present invention is achieved by detecting the SNP genotype variation site (T / G) at the 319th base of the BnaA09CRF6 gene coding sequence in the Brassica napus genome.

[0075] By using the marker for breeding, the SNP genotype of T in the BnaA09CRF6 gene is selected, which is the screened target variety / material. The dCAPS marker in the present invention can be used to assist in the selection of different varieties at the seedling stage. For example, the genotype of the Brassica napus material is identified at the seedling stage, and the material with the SNP genotype T is selected for backcrossing and breeding, and applied to the breeding of excellent varieties for improving the silique length characteristics of Brassica napus, which can significantly shorten the cycle of breeding long-silique Brassica napus varieties / materials and reduce the breeding years.

[0076] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A dCAPS marker based on specific SNP variation for identifying silique length in Brassica napus, characterized in that: The marker is based on the SNP site at the 319th base of the coding sequence of the BnaA09CRF6 gene, and the SNP is T or G; the nucleotide sequence of the BnaA09CRF6 gene is shown in the sequence table Seq ID NO.1; Includes a pair of primers: Upstream primer F: 5′-TCCTCCTCCTCCTCTTCGAGAAAAGCT -3′; Downstream primer R: 5′- CGAGACGACGGATCTCTGATCTCCCTCG-3′.

2. A method for identifying the length of Brassica napus siliques using the dCAPS marker according to claim 1, characterized in that: The following steps are involved: S1.1 Select one or more Brassica napus varieties to be tested for DNA extraction; S1.2 performing PCR amplification using the dCAPS marker to obtain a PCR product; S1.3 Digest the PCR amplification product obtained in the previous step with restriction endonuclease XhoI to create restriction endonuclease polymorphism; S1.4 The fragments obtained by enzyme digestion in S1.3 were subjected to electrophoresis detection. The electrophoresis results showed obvious high and low bands among different varieties. The high band was a single 134bp fragment of the PCR amplification product after enzyme digestion, corresponding to the short-silique rapeseed variety; the low band was a single 105bp fragment of the PCR amplification product after enzyme digestion, corresponding to the long-silique rapeseed variety.

3. The method according to claim 2, characterized in that The specific operation of the PCR amplification is as follows: The PCR reaction system was: 12.5 μL of 2× SanTaq PCR Mix, 0.5 μL of each of 10 μM forward primer and 10 μM, 2 μL of 100 ng / μL DNA template, and then double distilled water was used to make up to 25 μL system; PCR reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 68°C annealing for 30 s, 72°C extension for 20 s, 10 cycles, annealing temperature decreased by 1°C in each cycle; then 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 20 s, 35 cycles; 72°C full extension for 10 min; The specific operation of the enzyme cutting is as follows: The enzyme digestion reaction system was as follows: 10×FastDigest Buffer 2 μL, first PCR amplification product 10 μL, XhoI restriction endonuclease 2 μL, ddH2O to 20 μL, 37°C enzyme digestion reaction for 2 h, 80°C heat denaturation for 20 min; The electrophoresis detection conditions are: 3.0% agarose gel; electrophoresis voltage 130V; electrophoresis time 50 minutes.

4. A method for breeding Brassica napus using the dCAPS marker-assisted selection according to claim 1, characterized in that: The genotype of the Brassica napus material is identified at the seedling stage; PCR amplification is performed using the dCAPS marker to obtain a PCR product; the PCR amplification product obtained in the previous step is digested with the restriction endonuclease XhoI to create enzyme digestion polymorphism; the fragments obtained by enzyme digestion are subjected to electrophoresis detection, and the electrophoresis results show obvious high and low bands among different varieties; the high band is a single 134bp fragment of the PCR amplification product after enzyme digestion, corresponding to the short-silique rapeseed variety; the low band is a single 105bp fragment of the PCR amplification product after enzyme digestion, corresponding to the long-silique rapeseed variety; and the long-silique material is selected for backcrossing and breeding.

Images