Capture probe assemblies for identifying individual Nujiang golden snub-nosed monkeys and their applications

By designing a combination of capture probes and using high-throughput sequencing technology, the problem of individual identification of fecal samples from Nujiang golden monkeys was solved, enabling rapid and accurate identification of individual Nujiang golden monkeys and improving the stability and sensitivity of the identification.

CN118222728BActive Publication Date: 2025-10-28YUNNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410537298.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2025-10-28
Estimated Expiration
2044-04-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify individuals in fecal samples of golden snub-nosed monkeys obtained from the wild, especially due to the poor quality and low content of DNA samples, resulting in a low success rate of individual identification.

Method used

A capture probe array was designed, including probes from SEQ ID No. 1 to SEQ ID No. 100. Using biotin as a biomarker, combined with liquid-phase probe hybridization capture technology and high-throughput sequencing technology, a capture DNA library was constructed through enzyme digestion, end repair, adapter processing and magnetic bead purification, followed by high-throughput sequencing. The reads data were then processed by software to calculate the kinship coefficient for individual identification.

Benefits of technology

It enables rapid and accurate identification of individual Nujiang golden snub-nosed monkeys, improves the stability and sensitivity of individual identification, and can identify SNP sites rich in polymorphic information.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118222728B_ABST
    Figure CN118222728B_ABST
Patent Text Reader

Abstract

This invention provides a capture probe assembly for identifying individual Nujiang golden monkeys and its application, belonging to the field of biological DNA marker technology. The capture probe assembly includes probes with sequences shown in SEQ ID No. 1 to SEQ ID No. 100. This invention employs liquid-phase probe hybridization capture technology and high-throughput sequencing technology to hybridize, capture, and sequence target regions of the genome. This capture probe assembly can rapidly and accurately capture target SNP (single nucleotide) sites in Nujiang golden monkeys, providing the data needed for individual identification, thereby achieving the purpose of identifying individual Nujiang golden monkeys. The probe assembly provided by this invention has high stability, high sensitivity, and rich polymorphic information content, enabling research on the identification of individual Nujiang golden monkeys.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological DNA marker technology, and in particular relates to a capture probe combination for identifying individuals of Nujiang golden monkeys and its application. Background Technology

[0002] The Nujiang golden snub-nosed monkey, also known as the Burmese golden snub-nosed monkey or the black snub-nosed monkey (Rhinopithecus strykeri), belongs to the order Primates, family Cercopithecidae, subfamily Colobinae, and genus Rhinopithecus. The Nujiang golden snub-nosed monkey is listed as critically endangered on the IUCN Red List of Threatened Species, with a current population of no more than 300 individuals, teetering on the brink of extinction. Therefore, an assessment of its genetic resource status and conservation efforts are urgently needed.

[0003] Fecal samples obtained through non-invasive sampling methods are commonly used and readily available biological samples in the assessment and conservation of the genetic resources of endangered wildlife. However, the source of feces is uncertain, and individual identification of the obtained fecal samples is necessary to avoid affecting subsequent genetic analysis. Molecular marker-based individual identification technology is currently the most widely used and reliable method in wildlife identification. However, fecal samples obtained from the wild often have poor DNA quality and low host DNA content due to reasons such as delayed collection and long exposure time, resulting in a low success rate for individual identification.

[0004] With the development of molecular technology, high-throughput sequencing and hybridization capture techniques can now be used to obtain SNP sites in target regions, thus acquiring the SNP sites required for individual identification. However, no capture probe combination has yet been found that can be used for individual identification of Nujiang golden monkeys. In view of this, this invention is proposed. Summary of the Invention

[0005] Based on this, the purpose of the present invention is to provide a capture probe combination for identifying individual Nujiang golden monkeys and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] The present invention provides a capture probe assembly for identifying individual Nujiang golden snub-nosed monkeys, the capture probe assembly comprising probes in the sequence shown in SEQ ID No. 1 to SEQ ID No. 100.

[0008] The 5' end of the capture probe has a biomarker.

[0009] The biomarkers include biotin.

[0010] This invention also provides an application of a capture probe assembly in the preparation of products for identifying individual Nujiang golden monkeys.

[0011] The present invention also provides an application of the above-mentioned capture probe combination in identifying individual Nujiang golden monkeys.

[0012] This invention also provides a method for identifying individual Nujiang golden snub-nosed monkeys, comprising the following steps:

[0013] (1) Genomic DNA was extracted from the sample to be tested to obtain genomic DNA;

[0014] (2) Genomic DNA was digested with enzymes, repaired at the ends, added to the 3' end with A (adenine), treated with adapters and purified with magnetic beads to obtain purified DNA;

[0015] (3) Hybridize the above-mentioned capture probe combination with purified DNA to obtain a capture DNA library, and then perform high-throughput sequencing on the capture DNA library to obtain reads data;

[0016] (4) The reads data are processed by software to calculate the kinship coefficient between the samples to be tested, and the kinship coefficient is used to determine whether they are the same individuals as the Nujiang golden monkey.

[0017] The samples to be tested include feces, muscle, or blood.

[0018] A kinship coefficient greater than 0.354 indicates that the individuals are the same as those in the Nujiang golden snub-nosed monkey.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention provides a capture probe combo for identifying individual Nujiang golden snub-nosed monkeys and its application. The invention employs liquid-phase probe hybridization capture technology and high-throughput sequencing technology to hybridize and sequence target regions of the genome. This capture probe combo can rapidly and accurately capture target SNP sites in Nujiang golden snub-nosed monkeys, providing the data needed for individual identification, thereby achieving the goal of identifying individual Nujiang golden snub-nosed monkeys. The probe combo provided by this invention has high stability, high sensitivity, and rich polymorphic information content, enabling research on the identification of individual Nujiang golden snub-nosed monkeys. Attached Figure Description

[0021] Figure 1 This is a flowchart illustrating the design and application of the capture probe for individual identification of Nujiang golden snub-nosed monkeys according to the present invention.

[0022] Figure 2 The quality control results for the size of DNA fragments after the construction of the three DNA libraries in Example 1 of this invention;

[0023] Figure 3These are the fragment size quality control results for the three captured DNA libraries in Example 1 of this invention. Detailed Implementation

[0024] The present invention provides a capture probe assembly for identifying individual Nujiang golden snub-nosed monkeys, the capture probe assembly comprising probes in the sequence shown in SEQ ID No. 1 to SEQ ID No. 100.

[0025] In this invention, as a preferred embodiment, the 5' end of the capture probe has a biomarker, the biomarker including biotin.

[0026] This invention also provides an application of a capture probe assembly in the preparation of products for identifying individual Nujiang golden monkeys.

[0027] The present invention also provides an application of the above-mentioned capture probe combination in identifying individual Nujiang golden monkeys.

[0028] The present invention utilizes the above-mentioned combination of capture probes to quickly and accurately identify whether the Nujiang golden monkeys are the same individuals.

[0029] This invention also provides a method for identifying individual Nujiang golden snub-nosed monkeys, comprising the following steps:

[0030] (1) Genomic DNA was extracted from the sample to be tested to obtain genomic DNA;

[0031] (2) Genomic DNA was subjected to enzyme digestion, end repair, 3' end A addition, adapter treatment and magnetic bead purification to obtain purified DNA;

[0032] (3) Hybridize the above-mentioned capture probe combination with purified DNA to obtain a capture DNA library, and then perform high-throughput sequencing on the capture DNA library to obtain reads data;

[0033] (4) The reads data are processed by software to calculate the kinship coefficient between the samples to be tested, and the kinship coefficient is used to determine whether they are the same individuals as the Nujiang golden monkey.

[0034] In this invention, genomic DNA is extracted from a sample to be tested, including feces, muscle, or blood. This invention does not specifically limit the method for extracting genomic DNA; conventional methods in the art can be used.

[0035] In this invention, genomic DNA is subjected to enzyme digestion, end repair, 3' end A addition, adapter treatment, and magnetic bead purification to obtain purified DNA. The method for preparing the purified DNA includes:

[0036] Step A: Extract genomic DNA from the sample to obtain genomic DNA;

[0037] Step B: Fragment the genomic DNA using enzymes, and repair the ends of the fragmented DNA fragments to obtain blunt-ended DNA;

[0038] Step C: Add A to the 3' end of the blunt-ended DNA fragment to obtain a DNA fragment with A added to the 3' end;

[0039] Step D: Add adapters to the DNA fragment with an A appended to the 3' end to obtain the adapter-adapted DNA fragment;

[0040] Step E: The adapter-added DNA fragments are purified using magnetic beads, subjected to PCR, and the library is quantified and fragment size analyzed to obtain purified DNA.

[0041] In this invention, the above-mentioned capture probe combination is molecularly hybridized with purified DNA to obtain a capture DNA library. The method for preparing the capture DNA library is further preferably as follows:

[0042] (1) Hybridization was performed using a combination of capture probes to obtain hybridization products;

[0043] (2) The hybridization product was amplified by PCR to obtain the hybridized PCR product;

[0044] (3) The PCR products after probe hybridization are recovered and purified. The hybridized PCR products are purified by magnetic beads to obtain a captured DNA library. The captured DNA library is then subjected to high-throughput sequencing to obtain reads data.

[0045] In this invention, reads data are processed by software to calculate the kinship coefficient between test samples, and the kinship coefficient is used to determine whether they are identical individuals of the Nujiang golden snub-nosed monkey. The software processing includes quality control, comparison, variation detection and filtering, and individual identification. In this invention, a kinship coefficient greater than 0.354 indicates that the individuals are identical Nujiang golden snub-nosed monkeys.

[0046] The design and application flowchart of the capture probe for individual identification of Nujiang golden snub-nosed monkeys in this invention are shown below. Figure 1 As shown.

[0047] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0048] In the following examples, the Enzyme Plus Library Prep Kit was purchased from Acytec, catalog number: C11112. The Fragment&ERABuffer v3, Fragment&ERAEnzyme Mix v3, Adapter Ligation Buffer v3, Adapter Ligase v3, and PCR Master Mix buffer are one reagent in the Enzyme Plus Library Prep Kit, purchased from Acytec, catalog number: C11112.

[0049] Example 1

[0050] 1.1 Design and Synthesis of Individual Identification and Capture Probe Assemblies for Nujiang Golden Monkeys

[0051] Probes were designed for specific target regions in the genome of the Nujiang golden snub-nosed monkey. The average length of the probes was 100 bp, and the total number of probes was 100. Based on the principle of complementary base pairing, oligonucleotide probes (RNA probes) were designed to complement the target genomic DNA to obtain a capture probe library (also known as a capture probe combo). The nucleotide sequence information of the 100 probes is shown in Table 1.

[0052] Table 1 Nucleotide sequence information of the capture probe combinatorial

[0053]

[0054]

[0055]

[0056]

[0057] 1.2 Sample Collection and DNA Extraction

[0058] Sample collection: 3 fecal samples from golden snub-nosed monkeys in Nujiang.

[0059] DNA Extraction: Genomic DNA was extracted using a DNA extraction kit, following the instructions in the Qiager kit manual. The obtained genomic DNA was quality checked using a Qubit 2.0 fluorometer and 0.8% agarose gel electrophoresis. Once the DNA passed quality checks, subsequent steps were performed.

[0060] 1.2 Genomic DNA was fragmented and used to construct next-generation sequencing libraries using the Enzyme Plus Library Prep Kit from Aijitech Biotechnology (Beijing) Co., Ltd.

[0061] 1.2.1 Genomic DNA fragmentation, end repair, and 3' end addition of an "A"

[0062] Thaw the working enzyme and buffer for the end repair and 3' end A addition steps on an ice box. Prepare the reaction system according to Table 2 below, and mix thoroughly by pipetting, avoiding vigorous shaking. To avoid temperature changes affecting the size of the digested fragments, this operation must be performed on an ice box to obtain the digestion product. The DNA template is the genomic DNA from step 1.2, the buffer for the end repair and 3' end A addition steps is Fragment&ERABuffer v3, and the working enzyme for the end repair and 3' end A addition steps is Fragment&ERA Enzyme Mix v3. Both Fragment&ERABuffer v3 and Fragment&ERAEnzyme Mix v3 are reagents from the Enzyme Plus Library Prep Kit, purchased from AGI Tech, catalog number: C11112.

[0063] Table 2. End-of-terminal repair and 3'-terminal "A" addition reaction system

[0064] Composition content DNA template 300ng Buffer solution for end repair and A addition steps 10 μL Working enzymes for end repair and A addition steps 10 μL Nuclease-free water Make up to 60μL

[0065] Run the PCR program, set the hot cap temperature to 85℃. The PCR program is shown in Table 3. Immediately after the program finishes running, proceed with the next ligation reaction.

[0066] Table 3 PCR Procedure

[0067] temperature time 94℃ 1min 37℃ 6min 65℃ 30min 4℃ save

[0068] 1.2.2 Connector Connection

[0069] In the PCR tubes of the above reaction, prepare the reaction system on an ice box according to Table 4 below. Use a pipette to mix and then briefly centrifuge to avoid vigorous shaking. The adapters in Table 4 were purchased from Enzyme Plus Library Prep Kit, catalog number C10042. The adapter ligation buffer and adapter ligase were both reagents from Enzyme Plus Library Prep Kit, purchased from Enzyme Plus Library Prep Kit, catalog number C11112.

[0070] Table 4 Joint Reaction System

[0071] reagents volume Enzyme digestion products 60μL Connector 5μL Connector connection buffer 30μL Nuclease-free water 5μL Linker ligase 10 μL

[0072] Run the PCR instrument program (with the hot lid closed), set the PCR instrument parameters as shown in Table 5, and immediately purify the magnetic beads after the program ends.

[0073] Table 5 PCR Instrument Parameters

[0074] temperature time 22℃ 15min 4℃ save

[0075] 1.2.3 Purification after ligation

[0076] (1) Take 33 μL of purified magnetic beads that have been equilibrated at room temperature and vortexed, add them to 110 μL of the adapter ligation reaction system in Table 4, vortex and mix, let stand at room temperature for 5 min; briefly centrifuge, and place the PCR tube on a magnetic rack for 3 min until the solution becomes clear.

[0077] (2) Keep the PCR tube on the magnetic rack, remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube, and let it stand for 30 seconds; keep the PCR tube on the magnetic rack, remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube again, let it stand for 30 seconds, and then completely remove the supernatant; let it stand at room temperature for 3 to 5 minutes to allow the residual ethanol to evaporate completely.

[0078] (3) Add 22 μL of nuclease-free water, remove the PCR tube from the magnetic rack, vortex or pipette to mix, and let stand at room temperature for 2 min; briefly centrifuge, place the PCR tube on the magnetic rack for 2 min to allow the solution to clarify; use a pipette to draw 20 μL of supernatant and transfer it to a new PCR tube (placed on an ice box) to obtain the adapter ligation product purified by magnetic beads, label it, and prepare for the next reaction.

[0079] 1.2.4 Pre-PCR reaction

[0080] (1) Prepare the PCR amplification reaction system on the ice box according to the table below. The concentration of each primer is 10 μM and the reaction volume is 50 μL:

[0081] Table 6 PCR amplification reaction system

[0082] reagents volume Magnetic bead purification of linker ligation products 20μL PCRMasterMix 25 μL UDI PrimerN (10μMeach) 5μL

[0083] The PCR Master Mix is ​​a reagent from the Enzyme Plus Library Prep Kit, purchased from Aijitek (catalog number: C11112). The UDI Pirimer N is... The components in the Adapter & UDI Pirimer kit were purchased from Aijitech, catalog number C10042.

[0084] (2) Vortex or blow to mix, then briefly centrifuge; place the sample on the PCR instrument, set the PCR instrument heating cap temperature to 105℃, and follow the program as shown in Table 7. After the program is completed, immediately purify the magnetic beads to obtain the purified PCR product.

[0085] Table 7 PCR Amplification Procedure

[0086]

[0087]

[0088] 1.2.5 Purification of PCR products with magnetic beads, quantification of libraries, and fragment size analysis

[0089] (1) Take 65 μL of purified magnetic beads that have been equilibrated at room temperature and vortexed, add them to 50 μL of purified PCR product, vortex and mix, let stand at room temperature for 5 min; briefly centrifuge, and place the PCR tube on a magnetic rack for 3 min until the solution becomes clear.

[0090] (2) Keep the PCR tube on the magnetic rack, remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube, and let it stand for 30 seconds; keep the PCR tube on the magnetic rack, remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube again, let it stand for 30 seconds, and then completely remove the supernatant; let it stand at room temperature for 3 to 5 minutes to allow the residual ethanol to evaporate completely.

[0091] (3) Add 53 μL of nuclease-free water, remove the PCR tube from the magnetic rack, vortex or pipette to mix, and let stand at room temperature for 2 min; briefly centrifuge, and place the PCR tube on the magnetic rack for 2 min until the solution becomes clear.

[0092] (4) Use a pipette to draw 50 μL of supernatant, transfer it to a new PCR tube, label it, and obtain the library (also known as purified DNA).

[0093] (5) Take 1 μL of sample for use. The library concentration was determined using a 3.0-liter Fluorometer (Qubit dsDNA HSAssay Kit), and the concentration was recorded. A 1 μL sample was taken and the fragment length was determined using a fragment analyzer (Qsep400 biological fragment analyzer, Hangzhou Houze Biotechnology Co., Ltd.). The library peak chromatogram showed a bell-shaped curve, with the main peak located around 350 bp, and no obvious small peaks or nonspecific large fragments (see...). Figure 2 Proceed with subsequent experimental steps, or store the library in a -20°C freezer.

[0094] 1.3 Probe liquid-phase hybridization capture of target genomic regions

[0095] 1.3.1 Library and probe hybridization

[0096] (1) Use vacuum concentration method to concentrate the library. When vacuum concentrating the library, please control the concentration time to avoid excessive drying and sample loss.

[0097] (2) Prepare the hybridization reaction system according to Table 8 below, with a total volume of 30 μL:

[0098] Table 8 Hybridization reaction system

[0099]

[0100]

[0101] (3) Add the hybridization reaction system to the dried library, vortex for 30 seconds to ensure the DNA at the bottom of the tube dissolves, and briefly centrifuge. Place the hybridization reaction system in a PCR instrument and perform the reaction according to the table below to obtain the hybridization products:

[0102] Table 9 PCR reaction parameters of the hybridization reaction system

[0103] temperature time 80℃ 5min 45℃ 16~18h

[0104] 1.3.2 Recovery and purification of probe hybridization products

[0105] (1) After the hybridization reaction is completed, keep the hybridization product on the PCR instrument at 45°C, then transfer 180 μL of magnetic beads and mix by aspiration; cap the tube, remove the PCR tube from the PCR instrument, place it on a vertical rotary mixer at a speed not exceeding 10 rpm, and bind at room temperature for 30 min; remove the PCR tube, centrifuge briefly, place it on a magnetic rack for 2 min, and discard the supernatant after the solution becomes clear.

[0106] (2) Remove the PCR tube from the magnetic rack, add 150 μL of Wash Buffer 1 (Aijitaikang, catalog number SA0004) to the PCR tube, gently aspirate and mix to resuspend the magnetic beads, replace the tube cap, place it on a vertical spin mixer and wash at room temperature for 15 min at a speed not exceeding 10 rpm; remove the PCR tube, centrifuge briefly, place it on the magnetic rack for 2 min, and discard the supernatant after the solution becomes clear.

[0107] (3) Remove the PCR tube from the magnetic rack and add 150 μL of TargetSeq solution preheated to 45°C. WashBuffer 2v2 (purchased from Aijitaikang, catalog number SA0005), gently mix, briefly centrifuge, place on a constant temperature shaker and incubate at 45℃ for 10 min; remove the PCR tube, briefly centrifuge, place on a magnetic rack for 2 min, and discard the supernatant after the solution becomes clear.

[0108] (4) Repeating step (3) once can further improve the specificity and stability of the capture.

[0109] (5) Remove the PCR tube from the magnetic rack and add 150 μL of TargetSeq preheated at 45°C. Wash Buffer 2v2, gently pipette and mix, briefly centrifuge, place on a constant temperature shaker or metal bath, and incubate at 45°C for 10 min; remove the PCR tube, briefly centrifuge, gently pipette and mix, transfer all liquid (including magnetic beads) to a new PCR tube, place the new PCR tube on a magnetic rack for 2 min, and discard the supernatant after the solution becomes clear; keep the PCR tube on the magnetic rack, add 200 μL of 80% ethanol solution to the PCR tube, let stand for 30 s, then completely discard the ethanol solution, and air dry the magnetic beads at room temperature to allow the residual ethanol to evaporate completely.

[0110] (6) Add 24 μL of nuclease-free water to the PCR tube, remove the PCR tube from the magnetic rack, briefly vortex to resuspend and mix the magnetic beads, and recover and purify the probe hybridization product, which is the captured DNA library a, and proceed to the next amplification reaction.

[0111] 1.3.3 Post-PCR

[0112] After capture, the captured DNA library a needs to be amplified by PCR. Prepare the reaction system according to the table below.

[0113] Table 10 PCR amplification reaction system for captured DNA library

[0114]

[0115]

[0116] The upstream primer of the Post PCR Primer (purchased from Aijitaikang, catalog number SA0007) was AATGATACGGCGACCACCGA (SEQ ID No. 101), and the downstream primer was...

[0117] CAAGCAGAAGACGGCATACGA (SEQ ID No. 102);

[0118] The Post PCR Master Mix was purchased from Aijitaikang, catalog number CA0006.

[0119] The PCR instrument program is shown in Table 11. The heating element temperature is set to 105℃ to obtain the hybridized PCR products:

[0120] Table 11 PCR amplification procedure for captured DNA library

[0121]

[0122] 1.4 Magnetic bead purification of PCR products and quality control of concentration quantification and fragment analysis of captured DNA libraries

[0123] (1) Take 65 μL of purified magnetic beads that have been equilibrated at room temperature and vortexed, add them to 50 μL of the hybridized PCR product, vortex and mix, and let stand at room temperature for 5 min; centrifuge briefly, place the PCR tube on a magnetic rack for 3 min, and wait for the solution to become clear; keep the PCR tube on the magnetic rack, carefully remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube, and let stand for 30 s; keep the PCR tube on the magnetic rack, remove the supernatant, add 200 μL of 80% ethanol solution to the PCR tube again, let stand for 30 s, and remove the supernatant.

[0124] (2) Cover the tube and centrifuge briefly to remove the residual ethanol to the bottom of the tube. Place the PCR tube on a magnetic rack and carefully use a 10μL pipette to remove the residual ethanol at the bottom, being careful not to pick up the magnetic beads. Keep the PCR tube on the magnetic rack and let it stand at room temperature for 3-5 minutes to dry the magnetic beads and allow the residual ethanol to evaporate completely.

[0125] (3) Add 25 μL of nuclease-free water, remove the PCR tube from the magnetic rack, mix by pipetting or vortexing, and let stand at room temperature for 2 min; centrifuge briefly, place the PCR tube on the magnetic rack for 2 min, and wait for the solution to become clear; use a pipette to draw 23 μL of supernatant, transfer it to a new PCR tube, and label it. The liquid in the tube is the purified capture DNA library b.

[0126] (4) Take 1 μL of the purified capture DNA library b and measure its concentration using a Qubit 3.0 Fluorometer (Qubit dsDNA HSAssay Kit), and record the result; take 1 μL of the purified capture DNA library and use a fragment analyzer (Qsep400 biological fragment analyzer, Hangzhou Houze Biotechnology Co., Ltd.) to detect the fragment library length. The peak diagram of the capture library shows a bell-shaped curve, with the main peak located at around 340 bp, and no obvious small peaks or nonspecific large fragments (see...). Figure 3 ).

[0127] 1.5 Illumina platform NovaSeq 6000PE150 sequencing, sequencing data volume 3G.

[0128] 1.6 Data Processing and Analysis

[0129] Example 1 analyzes the sequencing results:

[0130] (1) Perform quality control to remove low-quality sequences, adapter sequences, abnormal sequences such as PloyG from the original sequencing data to obtain the quality-controlled data;

[0131] (2) The quality-controlled data is compared with the reference genome, sorted, and deduplicated to obtain the Bam alignment file;

[0132] (3) Statistical analysis of the number of variant sites and coverage.

[0133] Example 2

[0134] Sample source: Four fecal samples from Nujiang golden snub-nosed monkeys. The capture DNA library data of the four fecal samples from Nujiang golden snub-nosed monkeys were obtained according to the method in Experiment Example 1.

[0135] The four fecal samples from the Nujiang golden snub-nosed monkeys were numbered RS1, RS2, RS3 and RS4. It is known that RS1 and RS2 used in the experiment were from the same individual, while RS1, RS3 and RS4 were from different individuals.

[0136] 2.1 Quality Control

[0137] Use the FASTP software to remove adapters and low-quality reads from the sequencing data. The filtering conditions and parameters are as follows: "-W4-M 20-n 0-q 20-55-35".

[0138] 2.2 Comparison

[0139] The microarray data was aligned to the Nujiang golden snub-nosed monkey reference genome (GenBank ID: GCA_023764705.1) using BWA-mem software. A Bam file was generated using SAMtools software. The "indelRealigner" module in GATK software was used to realign the reads in the region near InDels. Then, redundant sequences were removed using Picard software.

[0140] 2.3 Mutation Detection and Filtering

[0141] Samples with sequencing depths greater than 5× and site coverage greater than 90% were retained for variant detection. Target SNPs were detected using the UnifiedGenotyper module in GATK software, generating VCF files. The VariantFiltration module was used for filtering and annotation, with parameters set to "MQ<40.0||QD<2.0||ReadPosRankSum<-8.0||FS>60.0||MQRankSum<-12.5||QUAL<40.0||SB>=-1.0". The generated VCF files were then filtered using vcftools software to obtain data for individual identification. The filtering criteria were: removing SNP sites with a minimum allele frequency (MAF) less than 0.05, those not conforming to Hay-Wen balance, non-biallelic, and those with a deletion rate greater than 80%.

[0142] 2.4 Individual Identification

[0143] The kinship coefficient between pairs of samples was calculated using the `--make-king` command in the Plink2 software. According to the Plink2 software documentation, a kinship coefficient greater than 0.354 indicates that the individuals are the same.

[0144] The specific results are shown in Table 12 below:

[0145] Table 12 Results of pairwise kinship coefficients of four fecal samples from Nujiang golden snub-nosed monkeys

[0146] RS1 RS2 RS3 RS1 RS2 0.4625 RS3 -0.0694 -0.0735 RS4 -0.0111 -0.0972 -0.5556

[0147] The results in Table 12 show that, based on the magnitude of the kinship coefficient, RS1 and RS2 are the same individual, while RS1 and RS3, RS2 and RS3, RS1 and RS4, RS2 and RS4, and RS3 and RS4 are different individuals, which is completely consistent with the known results. Therefore, using the capture probe combination of the present invention, individual identification of Nujiang golden monkeys can be accurately performed.

[0148] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A capture probe assembly for identifying individual Nujiang golden snub-nosed monkeys, characterized in that, The capture probe assembly includes probes in the sequence shown in SEQ ID No. 1 to SEQ ID No.

100.

2. The capture probe assembly according to claim 1, characterized in that, The 5' end of the capture probe has a biomarker.

3. The capture probe assembly according to claim 2, characterized in that, The biomarkers include biotin.

4. The application of the capture probe assembly according to any one of claims 1 to 3 in the preparation of products for identifying individual Nujiang golden monkeys.

5. The application of the capture probe combination according to any one of claims 1 to 3 in identifying individual Nujiang golden monkeys.

6. A method for identifying individual Nujiang golden snub-nosed monkeys, characterized in that, Includes the following steps: (1) Genomic DNA was extracted from the sample to be tested to obtain genomic DNA; (2) Genomic DNA was subjected to enzyme digestion, end repair, 3' end adenine addition, adapter treatment and magnetic bead purification to obtain purified DNA; (3) Hybridize the capture probe combination according to any one of claims 1 to 3 with purified DNA to obtain a capture DNA library, and then perform high-throughput sequencing on the capture DNA library to obtain reads data; (4) Process the reads data with software, calculate the kinship coefficient between the samples to be tested, and use the kinship coefficient to determine whether they are the same individuals of the Nujiang golden snub-nosed monkey; A kinship coefficient greater than 0.354 indicates that the individuals are the same as those in the Nujiang golden snub-nosed monkey.

7. The method according to claim 6, characterized in that, The samples to be tested include feces, muscle, or blood.

Citation Information

Patent Citations

  • Identification and monitoring method for habitat of golden monkeys in Nujiang River

    CN106446331A