Molecular beacon and high-throughput sequencing library absolute quantification method thereof

Abstract

The invention relates to the technical field of biology, and discloses a molecular beacon and a high-throughput sequencing library absolute quantification method thereof, and a fluorescent molecular beacon oligonucleotide (Oligo) sequence comprises a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region at the 5'upstream of the nucleotide chain (Loop chain) of the sequencing library recognition region, and a second universal sequence region at the 3 'downstream of the nucleotide chain (Loop chain) of the sequencing library recognition region; 5'of the first universal sequence region is modified into a fluorophore, and 3 'of the second universal sequence region is modified into a quenching group; and a nucleotide chain of the sequencing library recognition region is from an Illumina anmena sequencing platform or an MGI Huazai sequencing platform. The invention comprises a fluorescent molecular beacon for high-throughput sequencing library sequencing before-loading quantification, a sequence applied to a high-throughput sequencing platform and a detection method for library absolute quantification based on the molecular beacon, and overcomes the defects of a current gold standard detection method in technology and efficiency. The quantitative precision of the sequencing library is ensured; meanwhile, the economic and time cost of an actual application end is greatly reduced.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a molecular beacon and a method for absolute quantification of high-throughput sequencing libraries. Background Technology

[0002] Library quantification in next-generation sequencing (NGS) is a crucial step in sequencing experiments. Its core purpose is to accurately determine the "effective library concentration" before sequencing, which is the concentration of the inserted nucleic acid fragments that have been successfully ligated to complete sequencing adapters and can be recognized and amplified by the sequencer. Accurately quantifying the molar concentration of the library, based on the cluster density or the number of photolithographic nanopores on the sequencing chip, avoids library quality abnormalities caused by excessively high effective library concentration leading to sequencing cluster accumulation, or insufficient data volume due to excessively low concentration requiring supplementary sequencing. This directly impacts the data quality and economic / time cost control of the sequencing project.

[0003] Currently, the mainstream quantitative techniques for high-throughput sequencing libraries can be divided into two main categories: 1) Quantitative techniques and methods based on the analysis of the total nucleic acid content and fragment size of a library: These include quantification using ultraviolet spectrophotometers, such as Nanodrop, or fluorescent dye methods, such as the Qubit fluorometer. Ultraviolet spectrophotometry utilizes the specific ultraviolet absorption of nucleic acid molecules (purine / pyrimidine bases) at a wavelength of 260 nm, and calculates the library mass concentration (A = εbc) using Lambert-Beer's law (A = εbc). Fluorescent dye methods utilize the fluorescence signal emitted after specific fluorescent dyes (such as double-stranded DNA dyes) bind to the target library nucleic acids (double-stranded). Quantification is achieved by comparing the fluorescence intensity with that of standards of known concentrations. Both of the aforementioned methods have significant limitations in distinguishing the specificity of valid libraries. For example, ultraviolet spectrophotometry cannot differentiate between common interfering structures in sequencing libraries, such as free sequencing adapters and primer dimers. While fluorescent dye methods using double-stranded DNA dyes can avoid fluorescent labeling of free sequencing adapters and single-stranded nucleic acids and offer higher sensitivity, they still cannot effectively distinguish between double-stranded DNA with both ends ligated to sequencing adapters (valid libraries) and double-stranded DNA with no or only one end ligated to sequencing adapters (invalid libraries). Furthermore, to more accurately quantify the molar concentration of sequencing libraries, agarose gel electrophoresis or capillary microelectrophoresis is required before sequencing to determine fragment size and calculate the molar concentration using formulas. This approach is neither precise in quantifying the library nor effective in controlling pre-sequencing quality control time and costs. It is worth mentioning that some sequencing service providers currently use 96-channel or 384-channel microplate readers combined with double-stranded DNA dyes to quantify up to 384 sequencing libraries simultaneously. Although time and production costs are well controlled, accuracy still needs to be further improved due to the aforementioned technical drawbacks.

[0004] 2) Molecular molar-based quantitative techniques: Real-time quantitative PCR based on specific amplification of library adapter regions. Specific primers are designed for universal adapters in high-throughput sequencing libraries, such as Illumina's P5 / P7 adapters or universal adapter sequences in MGI sequencing libraries (the 5' and 3' sequences of the single strand containing the 5' phosphorylation used for subsequent library circularization in double-stranded libraries, i.e., 5'-CTCTCAGTACGTCAGCAGTT-3' and 5'-CTGATAAGGTCGCCATGC-3'). Effective libraries are amplified using real-time quantitative PCR (qPCR). The amplification curve is monitored in real-time using SYBR Green or other saturated nucleic acid dyes. A standard curve is established based on the Ct value of the amplification curve of the high-throughput sequencing library to be tested and a library standard with known molar concentrations, to calculate the absolute concentration (nM) of the effective library in the sample. As the current gold standard method for high-precision sequencing library quantification, its advantages include: extremely high detection specificity by amplifying only effective libraries containing adapter sequences; and the inherent sensitivity of PCR technology allows this quantification method to achieve library molar concentration detection sensitivity at the 10-1000 fM level. However, its disadvantages are equally obvious: ① Due to the exponential amplification capability of the PCR reaction for the target library, the target library (nanomolar / µL concentration) often requires high-order dilutions, easily introducing errors caused by library dilution and cascade errors; ② The operation is complex, requiring the amplification efficiency of 5 or more serially diluted library standards to reach within ±10% of the theoretical amplification efficiency when constructing a standard curve. If any point shows an abnormal amplification efficiency due to experimental operation, it will affect the correlation coefficient of the standard curve. If the coefficient (R²) cannot reach 99.9% or higher, the standard curve often needs to be redrawn, which requires a high level of operational skill from the experimenter; ③ Since the serially diluted library standards also need to undergo 30-40 cycles of amplification, the molar concentration of the standard library is low (the highest concentration standard library is often 10-30 pM, and based on the conventional library size of 400 bp, its mass concentration is only about 3.5-6.5 pg / ). Due to the low concentration, even if stored at -20℃, degradation and other problems are likely to occur. Therefore, the standard curve of the standard library needs to be redrawn separately for each reaction to ensure the reliability of the standard curve when used for subsequent calculation of the concentration of the target library; ④ A single test often takes more than 2 hours. Since this method involves diluting the library to be tested, the choice of dilution factor often depends on the experimenter's experience with similar sequencing projects in the past, setting two or more dilution factor gradients. At the same time, in order to ensure the accuracy of the quantitative results, technical repetitions must be set up to calibrate the Ct value, which invisibly reduces the amount of reaction that can be detected in a single library quantification test, increases reagent costs, and also greatly increases the time cost of detection.

[0005] Based on the above problems, it is essential to develop an accurate, low-cost, efficient, and rapid technical method for high-throughput library quantification. Summary of the Invention

[0006] This invention provides a molecular beacon and a method for absolute quantification of high-throughput sequencing libraries, including a fluorescent molecular beacon for pre-sequencing quantification of high-throughput sequencing libraries, the sequence applied to the high-throughput sequencing platform, and a detection method for absolute quantification of libraries based on the molecular beacon. This avoids the technical and efficiency drawbacks of current gold standard detection methods, thereby ensuring the accuracy of sequencing library quantification while significantly reducing the economic and time costs in practical applications.

[0007] This invention provides a fluorescent molecular beacon oligonucleotide (Oligo) sequence, comprising a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region upstream of the 5' end of the sequencing library recognition region nucleotide chain (Loop chain), and a second universal sequence region downstream of the 3' end of the 5' end of the Loop chain; The first universal sequence region 5' is modified with a fluorescent group, and the second universal sequence region 3' is modified with a quenching group; the nucleotide chain (Loop chain) of the sequencing library recognition region is from the Illumina sequencing platform or the MGI sequencing platform.

[0008] Furthermore, the nucleotide chains (loop chains) of the sequencing library recognition region are derived from the Illumina sequencing platform. The entire sequence of P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; Or a partial sequence of the P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; P5 inverse complementary sequence, the complete sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3'; Or the P5 inverse complementary sequence, a partial sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3' The entire sequence of P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; Or a partial sequence of the P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; The complete sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; Or a partial sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

[0009] Furthermore, the nucleotide chains (loop chains) of the sequencing library recognition region are derived from the MGI sequencing platform. The universal sequence of the 5' phosphorylation end, the reverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and the complete sequence of 5'-AACTGCTGACGTACTGAGAG-3'; Or a general sequence at the 5' phosphorylation end, a partial sequence of the inverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and 5'-AACTGCTGACGTACTGAGAG-3'. The 3' universal sequence of the single strand containing 5' phosphorylation, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and the complete sequence of 5'-GCATGGCGACCTTATCAG-3'; Or the 3' universal sequence of the single strand where 5' phosphorylation is located, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and a partial sequence of 5'-GCATGGCGACCTTATCAG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

[0010] Furthermore, the length of the first general sequence region is the same as the length of the second general sequence region; The first universal sequence region has a length of 5-7 nt, and the proportion of G+ bases and C bases is greater than 50%. The second universal sequence region has a length of 5-7 nt, with G+ bases accounting for more than 50%; The first universal sequence region and the second universal sequence region satisfy the Watson-Crick complementary pairing principle.

[0011] Furthermore, the 5' fluorescent group in the first universal sequence region is a commonly used fluorescent group in the laboratory, including 5'6-FAM, Cy5, and HEX; The 3' quenching group in the second universal sequence region is a commonly used laboratory fluorescence quenching group, including Dabcyl, BHQ1, or BHQ2.

[0012] Furthermore, the fluorescent molecular beacon oligonucleotide for the Illumina sequencing platform is Seq1: 5'-CGCGCACAAGCAGAAGACGGCATACGAGATTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group; or, Seq2: 5'-CGCGCAATGATACGGCGACCACCGAGATCTACACTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group.

[0013] Furthermore, the fluorescent molecular beacon oligonucleotide for the MGI sequencing platform is Seq3: 5'-CGCGCAAACTGCTGACGTACTGAGAGTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group; or, Seq4: 5'-CGCGCAGCATGGCGACCTTATCAGTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group.

[0014] Furthermore, the fluorescent molecular beacon oligonucleotide (Oligo) is annealed in the laboratory using an annealing buffer or LowTE buffer to form a stem-ring structure of fluorescent molecular beacon, which activates the FRET effect without releasing a fluorescent signal.

[0015] This invention also provides an application of a molecular beacon, based on the fluorescent molecular beacon oligonucleotide (Oligo) sequence as described above, comprising: The reaction buffer for absolute quantification of the library based on the fluorescent molecular beacon includes MgCl2, glycerol, NaCl, Tween 20, and water; the reaction buffer includes 4-8 mM MgCl2, 10-30% glycerol, 300-500 mM NaCl, and 0.6-1.2% Tween 20. The PCR reaction system for absolute library quantification based on the fluorescent molecular beacon and reaction buffer includes: a total reaction volume of 50-100 μL, a final concentration of 1× in the reaction buffer, and a molar amount of 2-4 pmol for the molecular beacon; after the reaction system is prepared, add 2 μL of the sample to be tested, 2 μL of NF-κB water, or 2 μL of the library standard sample, and place it on a real-time PCR instrument for reaction; or... The reaction system is as follows: total reaction volume 50 μL, final concentration of reaction buffer 1×, and the amount of molecular beacon added is 3.5 pmol; after the reaction system is prepared, add 2 μL of the library sample to be tested, or 2 μL of NF water, or 2 μL of library standard sample, and place it on a real-time PCR instrument for reaction; The PCR reaction procedure for absolute quantification of the library based on the fluorescent molecular beacon and reaction buffer includes: setting the heat cap to 105℃, denaturing at 95℃ for 3 minutes, annealing the loop chain Tm of the fluorescent molecular beacon oligonucleotide at -5℃ for 5 minutes, collecting fluorescence at 25℃ for 45 seconds and 25℃ for 15 seconds, wherein the fluorescence collection at 25℃ for 45 seconds and 25℃ for 15 seconds is repeated 5 times, and a total of 5 fluorescence signals are collected; the Tm value of the loop chain of the fluorescent molecular beacon oligonucleotide is determined by the online tool IDT Oligo Analyzer, and the parameters are selected according to the concentration of each component in the reaction buffer.

[0016] This invention also provides a method for absolute quantification of high-throughput sequencing libraries based on the aforementioned molecular beacon, using fluorescent molecular beacon oligonucleotide (Oligo) sequences as described above, comprising the following steps: (1) The fluorescent molecular beacon oligonucleotide is prepared by annealing, wherein the molecular beacon oligonucleotide synthesized in the same batch is processed once; (2) Background fluorescence detection of the fluorescent molecular beacon, wherein the fluorescent molecular beacons of the same batch are operated once; (3) Preparation of nanomolar / microliter concentration level library standards, wherein the preparation of nanomolar / microliter concentration level library standards in the same batch is performed once; (4) Fluorescence detection based on library standards, wherein the preparation of nanomolar / microliter concentration-level library standards in the same batch is performed once; (5) Fitting a nonlinear regression equation based on the fluorescence detection values ​​of library standards; (6) Fluorescence detection and molar concentration calculation of the sample to be tested; (7) After mixing the samples according to the calculated molar concentration, the samples are sequenced.

[0017] The beneficial effects of this invention are as follows: 1. Fluorescence can be collected and absolute quantitative analysis can be performed without diluting the test library, reducing errors caused by dilution of the test library and errors caused by cascade errors.

[0018] 2. The PCR reaction procedure does not involve amplification. Compared with the existing qPCR library absolute quantification reaction time of 1-2 hours, the reaction time for absolute quantification of 48 test libraries is about 10-15 minutes. The total quantification time including output data is 30 minutes, which greatly reduces laboratory time costs.

[0019] 3. The inherent properties of fluorescent molecular beacons determine that their background fluorescence remains stable within a controllable error range (±5%) when stored at -20℃ for a long time under light-protection treatment. Therefore, it is not necessary to re-measure the background fluorescence for each reaction, which reduces the cost of reagent use.

[0020] 4. Compared to commercially available picomolar / microliter and femtomolar / microliter standards, nanomolar / microliter concentration libraries are extremely resistant to degradation when stored at -20°C for extended periods, effectively preventing standard failure. Therefore, it is not necessary to re-establish a standard curve for each reaction, reducing time costs and laboratory reagent usage costs. Attached Figure Description

[0021] Figure 1 This is a schematic diagram illustrating the technical principle of the present invention.

[0022] Figure 2 This is a schematic diagram of the fluorescent molecular beacon structure of Example 1 of the present invention.

[0023] Figure 3 This is a schematic diagram of the nonlinear regression curve of the molar concentration of the gradient dilution library and the fluorescence value in Example 1 of the present invention.

[0024] Figure 4 This is a schematic diagram illustrating the consistency of 12 test libraries in Embodiment 1 of the present invention under two detection methods.

[0025] Figure 5 This is a schematic diagram of the nonlinear regression curve of the molar concentration of the gradient dilution library and the fluorescence value in Example 2 of the present invention.

[0026] Figure 6 This is a fluorescence value acquisition table of the gradient dilution standard library of Example 1 of the present invention.

[0027] Figure 7 This is a table of nonlinear regression parameters for fitting the fluorescence values ​​of the gradient dilution standard library in Example 1 of the present invention.

[0028] Figure 8 The fluorescence values ​​of the 12 test libraries in Example 1 of this invention and the molar concentrations calculated by nonlinear regression curves are represented.

[0029] Figure 9 This is a table showing the molar concentrations of 12 test libraries from Example 1 of the present invention, quantified using a non-gold standard commercial reagent kit.

[0030] Figure 10 This table shows the stability test results of the background fluorescence value of the fluorescent molecular beacon in Example 1 of the present invention over a period of 3 months.

[0031] Figure 11 This is a table showing the fluorescence value collection and calculation results of the gradient dilution standard library in Example 2 of the present invention.

[0032] Figure 12 This is a table of nonlinear regression parameters for fitting the fluorescence values ​​of the gradient dilution standard library in Example 2 of the present invention.

[0033] Figure 13 This table shows the fluorescence values ​​of 10 test libraries in Example 2 of the present invention and the molar concentration calculated by nonlinear regression curves.

[0034] Figure 14 This is the actual sequencing volume table for 10 test libraries in Example 2 of the present invention, which were sequenced twice.

[0035] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0036] It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. For a better understanding of the invention and not to limit its scope, all figures representing quantities, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods. In this invention, "approximately" means within 10% of a given value or range, preferably within 5%. The technical solutions of the present invention will now be clearly and completely described in conjunction with embodiments thereof.

[0037] like Figure 1 As shown, the present invention provides a fluorescent molecular beacon oligonucleotide (Oligo) sequence, which is composed of a nucleotide chain (Loop chain) of the sequencing library recognition region, a first universal sequence region upstream of the 5' of the sequencing library recognition region nucleotide chain (Loop chain), and a second universal sequence region downstream of the 3' of the 3' of the 5 ...

[0038] The nucleotide chains (loop chains) of the sequencing library recognition region were obtained from the Illumina sequencing platform. The entire sequence of P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; Or a partial sequence of the P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; P5 inverse complementary sequence, the complete sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3'; Or the P5 inverse complementary sequence, a partial sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3' The entire sequence of P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; Or a partial sequence of the P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; The complete sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; Or a partial sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

[0039] The nucleotide chains (loop chains) of the recognition region of the sequencing library were obtained from the MGI sequencing platform. The universal sequence of the 5' phosphorylation end, the reverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and the complete sequence of 5'-AACTGCTGACGTACTGAGAG-3'; Or a general sequence at the 5' phosphorylation end, a partial sequence of the inverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and 5'-AACTGCTGACGTACTGAGAG-3'. The 3' universal sequence of the single strand containing 5' phosphorylation, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and the complete sequence of 5'-GCATGGCGACCTTATCAG-3'; Or the 3' universal sequence of the single strand where 5' phosphorylation is located, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and a partial sequence of 5'-GCATGGCGACCTTATCAG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

[0040] In one embodiment, the first universal sequence region has the same sequence length as the second universal sequence region; the first universal sequence region has a sequence length of 5-7 nt and a G+ base-C base ratio greater than 50%; the second universal sequence region has a sequence length of 5-7 nt and a G+ base-C base ratio greater than 50%; the first universal sequence region and the second universal sequence region satisfy the Watson-Crick complementary pairing principle.

[0041] In one embodiment, the 5' fluorescent group of the first universal sequence region is a commonly used laboratory fluorescent group such as 5'6-FAM, Cy5, or HEX, and the 3' quenching group of the second universal sequence region is a commonly used laboratory fluorescent quenching group such as Dabcyl, BHQ1, or BHQ2, preferably a Dabcyl quenching group.

[0042] In one embodiment, the fluorescent molecular beacon oligonucleotide for the Illumina sequencing platform is preferably Seq1: 5'-CGCGCACAAGCAGAAGACGGCATACGAGATTGCGCG-3'; wherein, 5' is modified with a 5'6-FAM fluorescent group, and 3' is a Dabcyl quencher group; or... More preferably, Seq2 is 5'-CGCGCAATGATACGGCGACCACCGAGATCTACACTGCGCG-3'; wherein, 5' is modified with a 5'6-FAM fluorescent group, and 3' is a Dabcyl quencher group.

[0043] In one embodiment, the fluorescent molecular beacon oligonucleotide for the MGI sequencing platform is preferably Seq3: 5'-CGCGCAAACTGCTGACGTACTGAGAGTGCGCG-3'; wherein, 5' is modified with a 5'6-FAM fluorescent group, and 3' is a Dabcyl quencher group; or... More preferably, Seq4 is 5'-CGCGCAGCATGGCGACCTTATCAGTGCGCG-3'; wherein, 5' is modified with a 5'6-FAM fluorescent group, and 3' is a Dabcyl quencher group.

[0044] In one embodiment, the fluorescent molecular beacon oligonucleotide (Oligo) is annealed in a laboratory-standard annealing buffer or LowTE buffer to form a stem-ring structure, which activates the FRET effect without releasing a fluorescent signal.

[0045] This invention also provides an application of a molecular beacon, based on the fluorescent molecular beacon oligonucleotide (Oligo) sequence as described above, comprising: (1) A reaction buffer for absolute quantification of the library based on the fluorescent molecular beacon, comprising MgCl2, glycerol, NaCl, Tween 20, and water; The reaction buffer (2×Reaction Buffer) comprises 4-8 mM MgCl2, 10-30% glycerol (v / v), 300-500 mM NaCl, and 0.6-1.2% Tween 20 (v / v).

[0046] (2) A PCR reaction system for absolute quantification of a library based on the fluorescent molecular beacon and reaction buffer includes: a total reaction volume of 50-100 μL, a final concentration of 1× in the reaction buffer, and a molar amount of 2-4 pmol for the molecular beacon; after the reaction system is prepared, add 2 μL of the library sample to be tested or 2 μL of NF water (for background fluorescence detection) or 2 μL of the library standard sample, and place it on a real-time PCR instrument for reaction; The preferred reaction system is as follows: total reaction volume 50 μL, final concentration of the reaction buffer 1×, and the amount of molecular beacon added is 3.5 pmol. After the reaction system is prepared, add 2 μL of the library sample to be tested, 2 μL of NF water, or 2 μL of the library standard sample, and place it on a real-time PCR instrument for reaction. (3) The PCR reaction procedure for absolute quantification of the library based on the fluorescent molecular beacon and reaction buffer includes: setting the heat cap to 105℃, denaturing at 95℃ for 3 minutes, annealing the loop chain of the fluorescent molecular beacon oligonucleotide at Tm-5℃ (melting temperature-5℃) for 5 minutes, collecting fluorescence at 25℃ for 45 seconds and 25℃ for 15 seconds, wherein the fluorescence collection at 25℃ for 45 seconds and 25℃ for 15 seconds is repeated 5 times, and a total of 5 fluorescence signals are collected; The Tm value of the loop chain of the fluorescent molecular beacon oligonucleotide can be determined using the online tool IDT Oligo Analyzer (www.idtdna.com / pages / tools / oligoanalyzer), with the parameters selected according to the concentrations of each component in the reaction buffer.

[0047] This invention also provides a method for absolute quantification of high-throughput sequencing libraries based on the aforementioned molecular beacon, using fluorescent molecular beacon oligonucleotide (Oligo) sequences as described above, comprising the following steps: (1) The fluorescent molecular beacon oligonucleotide is annealed to prepare the fluorescent molecular beacon (the synthetic molecular beacon oligonucleotide of the same batch is operated once). (2) Background fluorescence detection of the fluorescent molecular beacon (the fluorescent molecular beacon in the same batch is operated once); (3) Preparation of nanomolar / microliter concentration level library standards (the preparation of nanomolar / microliter concentration level library standards in the same batch is performed once); (4) Fluorescence detection based on the library standard (one operation for preparing nanomolar / microliter concentration level library standards in the same batch); (5) Fitting a nonlinear regression equation based on the fluorescence detection values ​​of library standards; (6) Fluorescence detection and molar concentration calculation of the sample to be tested; (7) After mixing the samples according to the calculated molar concentration, the samples are sequenced.

[0048] Specifically, Examples 1 and 2 are used to explain the method for absolute quantification of high-throughput sequencing libraries based on the molecular beacons. Example 1

[0049] This embodiment uses 12 different types of constructed RNA samples fed into transcriptome (RNA-seq) and methylated RNA immunoprecipitation (meRIP-seq) libraries obtained using the VAHTS Universal V10 RNA-seqLibrary Prep Kit (Novizan, NR616). The insert fragments in these libraries have complete sequences at both ends for P5 and P7 end recognition during Illumina sequencing. These libraries are used to evaluate the consistency between the data generated from pre-sequencing pooling using the method disclosed in this invention and the expected output data. Simultaneously, the technical advantages and operational convenience of this method compared to the commercially available VAHTS Library Quantification Kit for Illumina 2.0 (Novizan, NQ107) for accurate library quantification are assessed.

[0050] The specific operation steps of this embodiment are as follows: Step 1: Annealing of fluorescent molecular beacon oligonucleotides The fluorescent molecular beacon oligonucleotide sequence used in this embodiment is: 5'6-FAM-CGCGCAATGATACGGCGACCACCGAGATCTACACTGCGCG-3'BHQ1.

[0051] Take 5 nmol of the above fluorescent molecular beacon oligonucleotide powder and centrifuge at 4000 rpm for 60 seconds using a desktop centrifuge to collect it at the bottom of the tube. Carefully open the tube cap and add 50 μL of Low TE buffer (pH 8.0) as required by the synthesis instructions to prepare a 100 μM stock solution. Use a pipette to repeatedly pipette and retract the solution at least 20 times to ensure complete dissolution. Transfer the entire stock solution to a 0.2 ml PCR tube and place it on a PCR instrument. Perform the annealing program: set the lid to 105℃, 95℃ for 5 minutes, cool from 95℃ to 25℃ at 0.1℃ / s (0.1℃ / s ramp), and hold at 25℃. The annealing structure is as follows: Figure 2 As shown; Figure 2 The image shows the fluorescent molecular beacon structure predicted by the DNA folding module in the UNAFold website tool. In a 1.5 ml centrifuge tube, 100 μM stock solution was diluted to 1 μM working solution using Low TE buffer (pH 8.0). The solution was then aliquoted at 150 μL / tube into sterile nuclease-free EP tubes (48 reactions + approximately 20% loss; discard after each use). The tubes were completely wrapped in aluminum foil and stored at -20°C in the dark, labeled with fluorescent molecular beacons.

[0052] Step 2: Background fluorescence detection of fluorescent molecular beacons Thaw the fluorescent molecular beacon working solution (1 μM) from a -20°C freezer, mix thoroughly by pipetting at least 20 times, and centrifuge for 3 seconds to collect the solution at the bottom of the tube. Prepare the 2× reaction buffer. Take a clean eight-tube (KIRGEN, KG2531N) and prepare the reaction system on ice: 25 μL of 2× reaction buffer, 2.5 μL of fluorescent molecular beacon working solution (1 μM), and 22.5 μL of nuclease-free water, for a total of 50 μL, with 40 replicates. Execute the following procedure: heat cap 105°C, denature at 95°C for 3 minutes, anneal at 62°C for 5 minutes, collect fluorescence at 25°C for 45 seconds and 25°C for 15 seconds. Repeat the 25°C for 45 seconds and 25°C for 15 seconds fluorescence collection five times, collecting a total of five fluorescence signals; average the five raw fluorescence values ​​for each reaction. After removing outliers from 40 replicates using Excel, the average value (mean fluorescence ± 2 standard deviations) was taken and used as the background fluorescence value of the fluorescent molecular beacon.

[0053] Step 3: Preparation of nanomolar / microliter concentration-level library standards Genomic DNA from lymphocytes of healthy volunteers was amplified by two rounds of PCR, and the amplicon library products with complete Illumina sequencing library structures were obtained by gel extraction and recovery. The sequences are shown below (only the single-stranded structures of the amplicon library are shown): 5'- AATGATACGGCGACCACCGAGATCTACAC (i5)ACACTCTTTCCCTACACGACCGCTTCCGATctaacaaaggagaagtctcagatggctacagtgtctctagatcaaacacagaggacctccccctcactctggagtctgctgcctcctcccaga catctgtatatttctgcgccagcagtgagtcgggacagggggctgaacactgaagctttctttggacaaggcaccagactcacagttgtagAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC(i7) ATCTCGTATGCCGTCTTCTGCTTG -3'.

[0054] The bold uppercase letters represent the P5 and P7 sequences of the Illumina sequencing library, while the lowercase letters represent the fixed insert sequences. The target fixed sequence library of the original amplicon library was quantified using digital PCR after dilution, and the copy concentration was converted to molar concentration. Library standards were concentrated and quantified by digital PCR to a maximum molar concentration of 500 nM. These standards were then serially diluted 2× to a series of concentrations, such as 250 nM, 125 nM, 62.5 nM, 31.25 nM, and 15.63 nM, and the standard concentrations were labeled. In this example, the molar concentrations converted from the serially diluted library copy concentrations detected by dPCR were 436.55 nM, 234.04 nM, 125.26 nM, 67.15 nM, 37.82 nM, and 18.60 nM, respectively. Figure 6 The fluorescence value acquisition table for the medium gradient dilution standard library is shown.

[0055] Step 4: Fluorescence detection of library standards Thaw the fluorescent molecular beacon working solution (1 μM) from a -20°C freezer, mix thoroughly by pipetting at least 20 times, and centrifuge for 3 seconds to collect the solution at the bottom of the tube. Prepare the 2× reaction buffer. Take a clean eight-tube (KIRGEN, KG2531N) and prepare the reaction system on ice: 25 μL of 2× reaction buffer, 2.5 μL of fluorescent molecular beacon working solution (1 μM), and 20.5 μL of nuclease-free water, for a total of 48 μL. Add 2 μL of gradient concentration standards (436.55 nM, 234.04 nM, 125.26 nM, 67.15 nM, 37.82 nM, 18.60 nM) to the system, setting up 4 replicates. Procedure: The thermostat was set to 105℃, followed by denaturation at 95℃ for 3 minutes, annealing at 62℃ for 5 minutes, and fluorescence collection at 25℃ for 45 seconds and 25℃ for 15 seconds. This 25℃ 45-second and 25℃ 15-second fluorescence collection was repeated 5 times, resulting in 5 fluorescence signals. The average of the five raw fluorescence values ​​for each reaction was taken. Using Excel, outliers were removed from the 4 replicates, and the average value (mean fluorescence ± 2 standard deviations) was taken. This average value was used as the fluorescence value for each gradient standard. Figure 6 The fluorescence value acquisition table for the medium gradient dilution standard library is shown.

[0056] Step 5: Fit nonlinear regression equations to the fluorescence detection values ​​of library standards. Using GraphPad Prism 10.1.2, the molar concentration (X) of the gradient standards was used as the x-axis, and the difference between the fluorescence value (Yn) of each gradient standard obtained in step 4 and the fluorescence intensity (Y0) of the blank control obtained in step 3 was used as the y-axis. The data were added to the table provided with GraphPad Prism. In the analysis, the "Binding-Saturation > One site-Specific binding mode" in the "Nonlinear Regression Fitting Curve" module was selected. The resulting nonlinear regression equation is: Yn-Y0=Bmax*X / (Kd+X), where Bmax=105.3, Kd=166.6, deriving X=166.6*(Yn-Y0) / (105.3-Yn+Y0), the obtained nonlinear standard curve is as follows. Figure 3 As shown, the parameters are as follows Figure 7 The table shows the nonlinear regression parameters for fitting the fluorescence values ​​of the gradient dilution standard library; where Yn is the fluorescence value of the sample to be tested, Y0 is the background value of the fluorescent molecular beacon, which can be the instantaneous fluorescence value of the zero-library addition (NTC) during standard curve construction or the batch historical average value of the fluorescent molecular beacon detection in step 2 (if NTC group settings are not performed during standard curve construction), and X is the molar concentration of the sample to be tested.

[0057] Step 6: Fluorescence detection and molar concentration calculation of the sample to be tested. Thaw the fluorescent molecular beacon working solution (1 μM) from a -20°C freezer, mix thoroughly by pipetting at least 20 times, and centrifuge for 3 seconds to collect the solution at the bottom of the tube. Prepare the 2× reaction buffer. Take a clean eight-tube (KIRGEN, KG2531N) and prepare the reaction system on ice: 25 μL of 2× reaction buffer, 2.5 μL of fluorescent molecular beacon working solution (1 μM), and 20.5 μL of nuclease-free water, for a total of 48 μL. Add 2 μL of the library sample to be tested (undiluted library stock solution) to the system, and set up two replicates. Execute the following procedure: heat cap set to 105°C, denature at 95°C for 3 minutes, anneal at 62°C for 5 minutes, and collect fluorescence at 25°C for 45 seconds and 25°C for 15 seconds. Repeat the 25°C for 45 seconds and 25°C for 15 seconds fluorescence collection five times, collecting a total of five fluorescence signals; average the five raw fluorescence values ​​for each reaction. The average fluorescence values ​​from two replicates are taken and used as the fluorescence value of the sample to be tested. Substituting this value into the formula in step 5, the molar concentration of the sample to be tested is calculated, such as... Figure 8 The molar concentrations of 12 test libraries are shown in the table. The calculated molar concentrations of the test library samples are compared with the results of quantification using the commercial VAHTSLibrary Quantification Kit for Illumina 2.0 (Novizan, NQ107) (e.g., ...). Figure 9 A consistency analysis was performed on 12 samples of the target library using a commercially available gold standard kit (as shown in the table). The results showed no significant difference between the two methods for quantifying the molar concentration of the target library. Figure 4 As shown.

[0058] Steps 1 to 5 above involve synthesizing fluorescent molecular beacon oligonucleotides from the same batch and preparing nanomolar / microliter concentration libraries from the same batch. The fluorescent molecular beacon oligonucleotides are stored in aliquots at a minimum synthesis amount of 5 nmol and are disposable after use, allowing for up to 2000 detections. This invention tests the stability of the background fluorescence signal of the same batch of fluorescent molecular beacons stored at -20℃ under light-protected conditions for 3 months. The results are as follows: Figure 10The table showing the stability test results of the background fluorescence value of the fluorescent molecular beacon is presented. The CV of the background fluorescence signal value is <0.5% over 3 months. Due to the high concentration of the prepared nanomolar / microliter concentration-level library, there was no significant difference in the detected fluorescence signal after 3 months of storage (data not listed). Therefore, in the specific implementation, the fluorescent molecular beacon oligonucleotide synthesized in the same batch and the prepared nanomolar / microliter concentration-level library in the same batch can support a usage time of at least 3 months. It is determined that the background fluorescence value of the same batch of fluorescent molecular beacon and the historical nonlinear standard curve prepared by the same batch of standards can be used for detection each time. In the specific implementation, the molar concentration of the test library can be quantified only from step 6, which greatly shortens the cycle of a single reaction. Example 2

[0059] This embodiment uses 10 different types of constructed DNA samples fed into genomic libraries (DNA-seq) and chromatin immunoprecipitation (ChIP-seq) libraries obtained using the UltraClean Universal Plus DNALibrary Prep Kit for MGI V3 (Novizan, UNDM637). The insert fragments in these libraries have complete sequences at both ends for circularization into DNB and binding to sequencing primers during sequencing on the BGI DNBSEQ T7 sequencing platform. These libraries are used to evaluate the consistency and ease of operation of the data generated from pre-sequencing pooling using the method disclosed in this invention with the expected output data.

[0060] The specific operation steps of this embodiment are as follows: Step 1: Annealing of fluorescent molecular beacon oligonucleotides The fluorescent molecular beacon oligonucleotide sequence used in this embodiment is 5'6-FAM-CTCTCAGTACGTCAGCAGTT-3'Dabcyl.

[0061] Take 5 nmol of the above fluorescent molecular beacon oligonucleotide powder and centrifuge at 4000 rpm for 60 s using a desktop centrifuge to collect it to the bottom of the tube. Carefully open the tube cap and add 50 μL of Low TE buffer (pH 8.0) according to the synthesis instructions to prepare a 100 μM stock solution. Use a pipette to repeatedly pipette more than 20 times to ensure it is fully dissolved. Transfer all stock solutions to 0.2 ml PCR tubes and place them on a PCR instrument. Perform the annealing procedure: set the lid to 105°C, 95°C for 5 minutes, cool from 95°C to 25°C at 0.1°C / s (0.1°C / s ramp), and hold at 25°C. In a 1.5 ml centrifuge tube, dilute the 100 μM stock solution to 1 μM working solution using Low TE buffer (pH 8.0), and aliquot 150 μL of 1 μM working solution per tube into sterile nuclease-free EP tubes (48 reactions + approximately 20% loss; discard after each use). Completely wrap the tubes with aluminum foil and store them at -20°C in the dark. Label with fluorescent molecular beacons.

[0062] Step 2: Preparation of nanomolar / microliter concentration-level library standards Genomic DNA from peripheral blood mononuclear cells of healthy volunteers was amplified by two rounds of PCR (GAPDH, NM_002046.7), and the amplicon products with intact MGI sequencing library structures were obtained by gel excision and recovery. The sequences are shown below (only the single-stranded portion of the library is shown): 5'-CTCTCAGTACGTCAGCAGTT(Barcode2)CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTcccagcgtcaaaggtggaggagtgggtgtcgctgttgaagtcagaggagaccacctggtgctcagtgtagcccaggatgcccttgagggggccctccgacgcctgcttc accaccttcttgatgtcatcatatttggcaggtttttctagacggcaggtcaggtccaccactgacacgttggcagtggggacggaaggccatgccagtgagcttcccgttcagctcagAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA(Barcode1)CTGATAAGGTCGCCATGC-3' The bold uppercase letters represent the complete sequence of the MGI sequencing library circularized into DNB and bound to the sequencing primers, while the lowercase letters represent the fixed insert sequence. The target fixed sequence library of the original amplicon library was quantified using digital PCR after dilution, and the copy concentration was converted to molar concentration. Library standards were concentrated and quantified by digital PCR to a maximum molar concentration of approximately 500 nM. These standards were then serially diluted 2× to a series of concentrations such as 250 nM, 125 nM, 62.5 nM, 31.25 nM, and 15.63 nM, and the standard concentrations were labeled. In this example, the molar concentrations converted from the serially diluted library copy concentrations detected by dPCR were 585.62 nM, 315.67 nM, 151.20 nM, 79.48 nM, 42.09 nM, and 24.33 nM, respectively. Figure 11 The fluorescence value acquisition table for the medium gradient dilution standard library is shown.

[0063] Step 3: Fluorescence detection of library standards Thaw the fluorescent molecular beacon working solution (1 μM) from the -20°C freezer, mix thoroughly by pipetting at least 20 times, and centrifuge for 3 seconds to collect the solution at the bottom of the tube. Prepare the 2× reaction buffer. Take a clean eight-tube (KIRGEN, KG2531N) and prepare the reaction system on ice: 25 μL of 2× reaction buffer, 2.5 μL of fluorescent molecular beacon working solution (1 μM), 20.5 μL of nuclease-free water, for a total of 48 μL. Add 2 μL of gradient concentration standards (585.62 nM, 315.67 nM, 151.20 nM, 79.48 nM, 42.09 nM, 24.33 nM, and 0 nM library-free blank control) to the system, setting up 4 replicates. Procedure: Heat treatment was performed at 105℃, followed by denaturation at 95℃ for 3 minutes, annealing at 62℃ for 5 minutes, and fluorescence collection at 25℃ for 45 seconds and 25℃ for 15 seconds. This process was repeated five times, resulting in five fluorescence signals. The average of the five raw fluorescence values ​​for each reaction was calculated. Using Excel, outliers were removed from the four replicates, and the average value (mean fluorescence ± 2 standard deviations) was calculated. This average value was used as the fluorescence value for each gradient standard. The difference between the library fluorescence value and the background fluorescence value was calculated. Figure 11 The fluorescence value acquisition table for the medium gradient dilution standard library is shown.

[0064] Step 4: Fitting the fluorescence detection values ​​of the library standards using a nonlinear regression equation. Using GraphPad Prism 10.1.2, the molar concentration (X) of the gradient standards was used as the x-axis, and the difference between the fluorescence value (Yn) of each gradient standard obtained in step 3 and the fluorescence intensity (Y0) of the blank control obtained in step 3 was used as the y-axis. The data were added to the table provided with GraphPad Prism. In the analysis, the "Binding-Saturation > One site-Specific binding mode" in the nonlinear regression fitting curve module was selected. The obtained nonlinear regression equation is as follows: Yn-Y0=Bmax*X / (Kd+X), where Bmax=105.3, Kd=166.6, deriving X=163.2*(Yn-Y0) / (126.3-Yn+Y0), the obtained nonlinear standard curve is as follows. Figure 5 As shown, the parameters are as follows Figure 12 The table shows the nonlinear regression parameters for fitting the fluorescence values ​​of the medium-gradient dilution standard library; where Yn is the fluorescence value of the sample to be tested, and Y0 is the background value of the fluorescent molecular beacon.

[0065] Step 5: Fluorescence detection and molar concentration calculation of the sample to be tested. Thaw the fluorescent molecular beacon working solution (1 μM) from a -20°C freezer, mix thoroughly by pipetting at least 20 times, and centrifuge for 3 seconds to collect the solution at the bottom of the tube. Prepare the 2× reaction buffer. Take a clean eight-tube (KIRGEN, KG2531N) and prepare the reaction system on ice: 25 μL of 2× reaction buffer, 2.5 μL of fluorescent molecular beacon working solution (1 μM), and 20.5 μL of nuclease-free water, for a total of 48 μL. Add 2 μL of the library sample to be tested (undiluted library stock solution) to the system, and set up 2 replicates. Execute the following procedure: heat cap set to 105°C, denature at 95°C for 3 minutes, anneal at 62°C for 5 minutes, and collect fluorescence at 25°C for 45 seconds and 25°C for 15 seconds. Repeat the 25°C for 45 seconds and 25°C for 15 seconds fluorescence collection five times, collecting a total of five fluorescence signals; average the five raw fluorescence values ​​for each reaction. The average fluorescence values ​​from two replicates are taken and used as the fluorescence value of the sample to be tested. Substituting this value into the formula in step 5, the molar concentration of the sample to be tested is calculated, such as... Figure 13 The table shows the molar concentrations of 10 test libraries.

[0066] Step 6: After mixing the samples according to the calculated molar concentration, proceed with sequencing. Based on the calculated molar concentration of the test libraries, calculate the mixing volume of each test library using the following formula:

[0067] Where K represents the Kth mixed library, i represents the total number of mixed libraries, n represents the sequence number of the mixed library, and the total volume to be mixed can be adjusted to the total volume applicable to the instrument based on the amount of remelting after the construction of a single library.

[0068] The test libraries were mixed and then cyclized into molecular nanospheres using a cyclization kit. Sequencing was performed twice on a DNBSEQ-T7 microarray at different lanes. The difference between the data output from the two sequencing runs and the expected data output was compared. The differences in data output between the two sequencing runs were also compared. Figure 14 The actual sequencing volume of the 10 libraries to be tested in the two sequencing runs is shown in the table. The sequencing data volume of the two runs produced by the two lanes is uniformly distributed. Except for one library which had less than the expected data volume of 0.03G, the rest met the expected requirements.

[0069] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, apparatus, article, or method that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, apparatus, article, or method. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, apparatus, article, or method that includes that element.

[0070] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A fluorescent molecular beacon oligonucleotide (Oligo) sequence, characterized in that, This includes the nucleotide chain (Loop chain) of the sequencing library recognition region, the first universal sequence region upstream of the 5' of the sequencing library recognition region nucleotide chain (Loop chain), and the second universal sequence region downstream of the 3' of the 3' of the nucleotide chain; The first universal sequence region 5' is modified with a fluorescent group, and the second universal sequence region 3' is modified with a quenching group; the nucleotide chain (Loop chain) of the sequencing library recognition region is from the Illumina sequencing platform or the MGI sequencing platform.

2. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 1, characterized in that, The nucleotide chains (loop chains) of the sequencing library recognition region were obtained from the Illumina sequencing platform. The entire sequence of P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; Or a partial sequence of the P5 sequence, 5'-AATGATACGGCGACCACCGAGATCTACAC-3'; P5 inverse complementary sequence, the complete sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3'; Or the P5 inverse complementary sequence, a partial sequence of 5'-GTGTAGATCTCGGTGGTCGCCGTATCATT-3' The entire sequence of P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; Or a partial sequence of the P7 sequence, 5'-CAAGCAGAAGACGGCATACGAGAT-3'; The complete sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; Or a partial sequence of the P7 inverse complementary sequence 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

3. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 1, characterized in that, The nucleotide chains (loop chains) of the recognition region of the sequencing library were obtained from the MGI sequencing platform. The universal sequence of the 5' phosphorylation end, the reverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and the complete sequence of 5'-AACTGCTGACGTACTGAGAG-3'; Or a general sequence at the 5' phosphorylation end, a partial sequence of the inverse complementary sequence of 5'-CTCTCAGTACGTCAGCAGTT-3', and 5'-AACTGCTGACGTACTGAGAG-3'. The 3' universal sequence of the single strand containing 5' phosphorylation, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and the complete sequence of 5'-GCATGGCGACCTTATCAG-3'; Or the 3' universal sequence of the single strand where 5' phosphorylation is located, the reverse complementary sequence of 5'-CTGATAAGGTCGCCATGC-3', and a partial sequence of 5'-GCATGGCGACCTTATCAG-3'; The complete sequence means that the Loop chain is the listed publicly available sequence itself, and the partial sequence means that the Loop chain is a portion of the listed publicly available sequence, and the length of the Loop chain is ≥17nt and < the full length of the listed publicly available sequence.

4. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 1, characterized in that, The length of the first general sequence region is the same as the length of the second general sequence region; The first universal sequence region has a length of 5-7 nt, and the proportion of G+ bases and C bases is greater than 50%. The second universal sequence region has a length of 5-7 nt, with G+ bases accounting for more than 50%; The first universal sequence region and the second universal sequence region satisfy the Watson-Crick complementary pairing principle.

5. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 1, characterized in that, The 5' fluorescent group in the first universal sequence region is a commonly used fluorescent group in the laboratory, including 5'6-FAM, Cy5, and HEX; The 3' quenching group in the second universal sequence region is a commonly used laboratory fluorescence quenching group, including Dabcyl, BHQ1, or BHQ2.

6. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 2, characterized in that, The fluorescent molecular beacon oligonucleotide for the Illumina sequencing platform is Seq1: 5'-CGCGCACAAGCAGAAGACGGCATACGAGATTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group; or, Seq2: 5'-CGCGCAATGATACGGCGACCACCGAGATCTACACTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group.

7. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 3, characterized in that, The fluorescent molecular beacon oligonucleotide for the MGI sequencing platform is Seq3: 5'-CGCGCAAACTGCTGACGTACTGAGAGTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group; or, Seq4: 5'-CGCGCAGCATGGCGACCTTATCAGTGCGCG-3'; where 5' is modified with a 5'6-FAM fluorescent group and 3' is a Dabcyl quencher group.

8. The fluorescent molecular beacon oligonucleotide (Oligo) sequence according to claim 1, characterized in that, The fluorescent molecular beacon oligonucleotide (Oligo) is annealed in the laboratory using an annealing buffer or LowTE buffer to form a stem-ring structure, which activates the FRET effect without releasing a fluorescent signal.

9. An application of a molecular beacon, based on the fluorescent molecular beacon oligonucleotide (Oligo) sequence according to any one of claims 1-8, characterized in that, include: The reaction buffer for absolute quantification of the library based on the fluorescent molecular beacon includes MgCl2, glycerol, NaCl, Tween 20, and water; The reaction buffer comprises 4-8 mM MgCl2, 10-30% glycerol, 300-500 mM NaCl, and 0.6-1.2% Tween 20. The PCR reaction system for absolute library quantification based on the fluorescent molecular beacon and reaction buffer includes: a total reaction volume of 50-100 μL, a final concentration of 1× in the reaction buffer, and a molar amount of 2-4 pmol for the molecular beacon; after the reaction system is prepared, add 2 μL of the sample to be tested, 2 μL of NF-κB water, or 2 μL of the library standard sample, and place it on a real-time PCR instrument for reaction; or... The reaction system is as follows: total reaction volume 50 μL, final concentration of reaction buffer 1×, and the amount of molecular beacon added is 3.5 pmol; after the reaction system is prepared, add 2 μL of the library sample to be tested, or 2 μL of NF water, or 2 μL of library standard sample, and place it on a real-time PCR instrument for reaction; The PCR reaction procedure for absolute quantification of the library based on the fluorescent molecular beacon and reaction buffer includes: setting the heat cap to 105℃, denaturing at 95℃ for 3 minutes, annealing the loop chain Tm of the fluorescent molecular beacon oligonucleotide at -5℃ for 5 minutes, collecting fluorescence at 25℃ for 45 seconds and 25℃ for 15 seconds, wherein the fluorescence collection at 25℃ for 45 seconds and 25℃ for 15 seconds is repeated 5 times, and a total of 5 fluorescence signals are collected; the Tm value of the loop chain of the fluorescent molecular beacon oligonucleotide is determined by the online tool IDT Oligo Analyzer, and the parameters are selected according to the concentration of each component in the reaction buffer.

10. A method for absolute quantification of a high-throughput sequencing library based on the aforementioned molecular beacon, based on the fluorescent molecular beacon oligonucleotide (Oligo) sequence of claim 9, characterized in that, Includes the following steps: (1) The fluorescent molecular beacon oligonucleotide is prepared by annealing, wherein the molecular beacon oligonucleotide synthesized in the same batch is processed once; (2) Background fluorescence detection of the fluorescent molecular beacon, wherein the fluorescent molecular beacons of the same batch are operated once; (3) Preparation of nanomolar / microliter concentration level library standards, wherein the preparation of nanomolar / microliter concentration level library standards in the same batch is performed once; (4) Fluorescence detection based on library standards, wherein the preparation of nanomolar / microliter concentration-level library standards in the same batch is performed once; (5) Fitting a nonlinear regression equation based on the fluorescence detection values ​​of library standards; (6) Fluorescence detection and molar concentration calculation of the sample to be tested; (7) After mixing the samples according to the calculated molar concentration, the samples are sequenced.

Images