Alginate lyase mutant

Abstract

The present invention relates to the field of genetic engineering and protein engineering technology, and in particular to a mutant of alginate lyase. The present invention provides a mutant comprising S60T and / or T419N mutation sites based on wild-type alginate lyase ALE. Compared with the wild-type alginate lyase, the specific activity of the alginate lyase mutant is generally increased by 17.1-31.9%. Among them, the alginate lyase mutant containing the S60T / T419N two-point mutation has the highest specific activity, reaching 160.13U / mg, which is 31.9% higher than the wild-type alginate lyase ALE, and has achieved unexpected technical effects.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and protein engineering, and in particular to an alginate lyase mutant. Background Art

[0002] Alginate is produced by brown algae and Gram-negative bacteria. It is a linear polymer formed by random polymerization of β-D-mannuronic acid (M) and α-L-guluronic acid (G) as monomers; its primary structure is determined by different sources. Alginate lyase can be divided into two categories according to the different alginate fragments it degrades: 1,4-β-D-polymannuronic acid lyase and 1,4-α-L-polyguluronic acid lyase. They act on the mannuronic acid segment and guluronic acid segment of alginate, respectively, to generate oligosaccharide uronic acid, and produce C4 and C5 unsaturated double bonds at the non-reducing end. Alginate lyase, as a tool enzyme for the preparation of alginate oligosaccharides, is widely used in the research of medical food and biomass energy, for example, in the production of alginate oligosaccharides, the preparation of brown algae protoplasts, the analysis of alginate structure and the management of cystic fibrosis.

[0003] Alginate lyases are a class of enzymes that can degrade alginic acid. They play an important role in the carbon cycle of marine ecosystems and the biotransformation of brown algae. Alginate lyases degrade alginate into smaller fragments, namely algal oligosaccharides, through β-elimination reactions. These oligosaccharides have unsaturated uronic acids at the non-reducing end, such as 4,5-unsaturated uronic acid monomers mannuronic acid and guluronic acid. With the deepening of research, the understanding of the structural characteristics of alginate lyases and their catalytic mechanisms has gradually improved. These enzymes can be classified according to the type of their cleavage bond, and a variety of different structural forms have been found. Alginate lyases have broad application prospects. They can not only be used to study carbon cycles in marine ecosystems, but also to develop alginate digestion products with anti-tumor, anti-inflammatory and antioxidant properties. In addition, these enzymes are also one of the important tools for degrading biofilms. Advances in genetic engineering technology have enabled researchers to improve the catalytic performance of alginate lyases through molecular modification methods. For example, enzyme variants with expected excellent performance can be screened using techniques such as rational design, truncation expression of non-catalytic domains, and recombination of conservative domains.

[0004] In the degradation of marine biological resources, biological enzymes can effectively promote the release of active ingredients of seaweed oligosaccharides, improve product yield, and replace traditional high-energy consumption and high-pollution physical and chemical degradation processes. The main degradation methods of alginate are: (1) Chemical degradation. Acid, hydrothermal or alkaline pretreatment has been used for the hydrolysis of alginate. Acid hydrolysis is more commonly used in chemical degradation, but alginate is relatively acid-resistant and it is difficult to control the production of uronic acid. In addition, high concentrations of acid are required to obtain high yields of uronic acid. (2) Water preheating treatment. Alginate can produce alginate monomers (mannuronate and guluronate) by hydrothermal treatment (180-240℃), and at the same time produce substances such as lactic acid and glycolic acid. (3) Enzymatic degradation. Enzymatic degradation of alginate has mild conditions, controllable processes, high yields, green safety, environmental friendliness, clear mechanisms of action, and determined products. According to the specific requirements of the target product, enzyme preparations with different substrate specificities can be selected or used in combination.

[0005] However, the current production of alginate lyase mostly relies on enriching alginate decomposing bacteria to produce enzymes. However, the original strain has limited enzyme production, and its extraction and purification steps are cumbersome and costly. Therefore, if you want to obtain a large amount of efficient enzymes, genetic engineering research is an important method. Among them, protein engineering is an effective method to solve the low content in natural organisms, high production costs, and difficult purification, and obtain high-yield, active enzymes.

[0006] In recent years, with the widespread application of protein engineering technology in the field of enzyme preparations, the development of new alginate lyases with high enzyme activity and excellent properties has become a research hotspot in this field, which is of great significance for reducing the production cost of alginate lyase and promoting the industrialization of alginate lyase. Summary of the invention

[0007] The present invention provides a mutant of alginate lyase to solve the problems of the prior art. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in the industrial field.

[0008] One aspect of the present invention relates to an alginate lyase mutant, wherein the 60th amino acid of the alginate lyase with the amino acid sequence of SEQ ID NO: 1 is changed from Ser to Thr, and / or the 419th amino acid is changed from Thr to Asn.

[0009] The amino acid sequence of the alginate lyase mutant is shown in SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5.

[0010] The present invention also relates to a DNA molecule encoding the alginate lyase mutant.

[0011] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0012] The present invention also relates to a host cell, comprising the above-mentioned recombinant expression vector, which is a non-plant cell or an animal cell.

[0013] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed alginate lyase is significantly improved.

[0014] The host cell is Pichia pastoris or Trichoderma reesei.

[0015] The present invention is based on the wild-type alginate lyase ALE, and provides a mutant containing S60T and / or T419N mutation sites. Compared with the wild-type alginate lyase, the specific activity of the alginate lyase mutant is generally improved by 17.1-31.9%. Among them, the alginate lyase mutant containing the S60T / T419N two-point mutation has the highest specific activity, reaching 160.13U / mg, which is 31.9% higher than the wild-type alginate lyase ALE, and has achieved unexpected technical effects. It is thus shown that the S60T and T419N mutation sites provided by the present invention can significantly improve the expression level of alginate lyase ALE in the recombinant bacteria of Trichoderma reesei, and have achieved unexpected technical effects.

[0016] In summary, compared with the wild type, the alginate lyase mutant screened and obtained by the present invention has significantly improved specific activity, which is beneficial to reducing the production cost of alginate lyase and has broad market prospects. DETAILED DESCRIPTION

[0017] The invention relates to an alginate lyase mutant, a preparation method and application thereof, a DNA molecule encoding the protease mutant, a vector and a host cell.

[0018] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the above. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0019] The method of the present invention is further described below in conjunction with examples. The experimental methods for which specific conditions are not indicated in the embodiments can be operated under conventional conditions, such as the conditions described in the "Molecular Cloning Experiment Guide" compiled by J. Sambrook (Sambrook) and others, or under the conditions recommended by the manufacturer. Those skilled in the art can better understand and grasp the present invention with the help of the embodiments. However, the method for implementing the present invention should not be limited to the specific method steps recorded in the embodiments of the present invention.

[0020] The components and contents of the culture medium in the embodiment of the present invention are respectively:

[0021] LB plate: 1% tryptone, 0.5% yeast powder, 1% NaCl, 1.5% agar;

[0022] LB liquid medium: tryptone 1%, yeast powder 0.5%, NaCl 1%;

[0023] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCL, 100 μg / mL ampicillin, pH 7.0;

[0024] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCL, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0025] Example 1 Screening of alginate lyase mutants

[0026] In order to improve the specific activity of wild-type alginate lyase ALE (amino acid sequence is SEQ ID NO: 1, encoding nucleotide sequence is SEQ ID NO: 2, synthesized by Shanghai Sangon Biotechnology Co., Ltd.), the applicant screened a large number of mutations of the enzyme by directed evolution technology, and designed PCR primers ALE-F1 and ALE-R1 as follows:

[0027] ALE-F1: GCGGACTGCGCACCATGAAGATCAACCGCTCCTCC;

[0028] ALE-R1:GGCTTTCGCCACGGAGCTTTAGTCGTGGGTGTGTTCGAGGC.

[0029] The wild-type alginate lyase ALE gene (SEQ ID NO: 2) was used as a template, and PCR amplification was performed using the above primers and a GeneMorph II random mutation PCR kit (Stratagene). The PCR product was recovered by gel, connected to the pSZX302 plasmid, transformed into Escherichia coli BL21 (DE3), spread on an LB+Amp plate, and cultured inverted at 37°C. After the transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, and 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h, and the supernatant was discarded after centrifugation. The cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain an Escherichia coli cell lysate containing alginate lyase.

[0030] Take 50 μL of lysate to two new 96-well plates, and measure the alginate lyase activity at pH 7.5. The results show that compared with the wild-type alginate lyase ALE, some mutants have no change in specific activity at pH 7.5, and some mutants even have reduced specific activity. Finally, the applicant screened out mutation sites that can significantly improve the specific activity of alginate lyase at pH 7.5: S60T, T419N.

[0031] Based on the wild-type alginate lyase ALE, the present invention provides mutants comprising a single mutation site of S60T or T419N, and mutants comprising two mutation sites of S60T and T419N, whose amino acid sequences are SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, respectively.

[0032] The coding gene fragments of the above-mentioned alginate lyase mutants were synthesized by Shanghai Jierui Biological Company.

[0033] Example 2 Expression of alginate lyase in Trichoderma reesei

[0034] First, according to the codon preference of Trichoderma, the gene sequences of alginate lyase ALE and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, KpnI and MluI, were added at the 5' and 3' ends of the synthetic sequence.

[0035] 2.1 Construction of expression vector

[0036] The synthesized alginate lyase gene fragment and pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas), respectively, and the digestion products were purified using a gel purification kit, and the alginate lyase gene and the digestion products of the pSC1G vector were ligated with T4 DNA ligase (Fermentas) and transformed into Escherichia coli Trans5α (Transgen), selected with ampicillin, and the clones were sequenced (Invitrogen) for verification. After sequencing was correct, a recombinant plasmid containing the alginate lyase gene was obtained.

[0037] 2.2 Construction of recombinant strains of Trichoderma reesei

[0038] (1) Protoplast preparation

[0039] A spore suspension of the host fungus Trichoderma reesei was inoculated on a PDA plate and cultured at 30°C for 6 days. After the spores were abundant, a colony of about 1 cm × 1 cm was cut and placed in a liquid culture medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine), and cultured at 30°C and 220 rpm for 14 to 16 hours.

[0040] The mycelium was collected by filtering with sterile gauze and washed once with sterile water; the mycelium was placed in a conical flask containing 20 mL of 10 mg / mL lysing enzyme solution (Sigma L1412) at 30°C and 90 rpm for 1-2 h; the progress of protoplast transformation was detected by observation under a microscope.

[0041] Add 20 mL of pre-cooled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the above-mentioned conical flask, shake gently, collect the filtrate through sterile Miracloth filter cloth, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-cooled 1.2 M sorbitol solution to suspend the cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-cooled 1.2 M sorbitol to suspend and package (200 μL / tube, protoplast concentration is 10 8 / mL).

[0042] (2) Expression vector transformation

[0043] The following operations were all performed on ice. 10 μg of the recombinant plasmid constructed above was added to a 7 mL sterile centrifuge tube containing 200 μL of protoplast solution, and then 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the tube bottom was flicked to mix, and the mixture was placed on ice for 20 min; 2 mL of 25% PEG was added, the mixture was mixed and placed at room temperature for 5 min; 4 mL of 1.2 M sorbitol was added, the mixture was gently mixed and poured into the upper culture medium melted and maintained at 55° C.; the mixture was gently mixed and spread on the prepared lower culture medium plate, and cultured at 30° C. for 5 to 7 days until transformants grew out. The grown transformants were picked up to the lower culture medium plate for rescreening, and the strains with smoother colony edge morphology were positive transformants.

[0044] According to the above method, the applicant constructed and obtained engineered strains of Trichoderma reesei that recombinantly expressed alginate lyase ALE and its mutants.

[0045] (3) Shake flask fermentation verification and enzyme activity determination

[0046] The engineered strain of Trichoderma reesei obtained by the above construction was inoculated on a PDA solid plate, inverted and cultured in a 30°C constant temperature incubator for 6-7 days. After the spores were abundant, two mycelium blocks with a diameter of 1 cm were taken and inoculated in a 250mL triangular flask containing 50mL fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements), and cultured at 30°C for 48 hours, and then at 25°C for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing alginate lyase ALE and its mutants. The fermentation supernatants were respectively subjected to alginate lyase enzyme activity assay and protein content assay, and the specific activity was calculated.

[0047] (I) Determination of alginate lyase activity

[0048] (1) Definition of enzyme activity units

[0049] At 40°C and pH 7.5, in the reaction system specified in this method, the substrate sodium alginate is degraded to produce unsaturated bonds per minute. At 235 nm, each increase of 0.1 in absorbance is one enzyme activity unit U.

[0050] (2) Principle

[0051] Alginate lyase can cut the glycosidic bond in the alginate molecule through β-elimination reaction, producing an unsaturated double bond at the non-reducing end. The double bond is located between C4 and C5 of the non-reducing end of the product and produces maximum ultraviolet absorption at 235nm.

[0052] (3) Measurement method

[0053] Liquid samples: Dilute with buffer to an appropriate multiple, control the absorbance OD235 between 0.22-0.35, and the enzyme activity is about 0.5U / mL.

[0054] Enzyme reaction: Take three 15mm*150mm test tubes, add 1.8mL substrate, preheat in a 40℃ water bath for 5min, add 0.2mL diluted enzyme solution, accurately time, vortex, keep warm at 40℃ for 10min, take the test tubes out of the water bath and immediately add 2mL phosphoric acid stop solution, vortex, and place the test tubes on a test tube rack outside the water bath.

[0055] Blank: Take a 15mm*150mm test tube, add 1.8mL of substrate, preheat in a 40℃ water bath for 5min, add 0.2mL of buffer, vortex, and keep warm at 40℃ for 10min. Take the test tube out of the water bath and immediately add 2mL of phosphoric acid stop solution, vortex, and place the test tube on a test tube rack outside the water bath.

[0056] Colorimetry: After the blank and enzyme reaction of each sample are terminated, colorimetry is performed immediately at 235 nm, and the absorbance values ​​A0 and A are recorded.

[0057] Remark:

[0058] (4) Calculation

[0059] X = (A0 - A sample) × 2 × N / (t × 0.1).

[0060] Where:

[0061] X—enzyme activity, U / mL or U / g;

[0062] 2—volume factor of adding 2 mL of phosphoric acid stop solution;

[0063] t(min)—enzyme reaction time (within the linear range of enzyme reaction);

[0064] 0.1—System coefficient, which converts the absorbance value growth unit to 0.1;

[0065] N—dilution multiple.

[0066] Simplified: Enzyme activity (U / mL) = (A0 - Sample A) × 2 × N.

[0067] (5) Measurement results

[0068] The results of enzyme activity determination showed that the enzyme activity of the shake flask fermentation supernatant of the recombinant Trichoderma reesei expressing the wild-type alginate lyase ALE was 85U / mL, while the enzyme activity of the shake flask fermentation supernatant of the recombinant Trichoderma reesei expressing the alginate lyase mutant was as high as 95-113U / mL.

[0069] (II) Method for determining the protein content of alginate lyase

[0070] (1) Measurement method

[0071] The Coomassie Brilliant Blue (Bradford) binding method for determining protein content is a composite method that combines colorimetry with pigmentation. Coomassie Brilliant Blue G-250 is brownish red in acidic solution, and turns blue when combined with protein. It conforms to Beer's law within a certain protein concentration range and can be measured colorimetrically at 595nm. A large amount of absorption is achieved in 3 to 5 minutes and is stable for at least 1 hour. In the range of 10 to 1000 μg / mL, the absorbance is proportional to the protein concentration.

[0072] The enzyme solution and the Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, allowed to stand for 10 minutes, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0073] (2) Measurement results

[0074] The protein content was detected according to the above method. The results showed that the protein content of the fermentation supernatant of the recombinant strain of Trichoderma reesei expressing wild-type alginate lyase ALE and its mutants constructed above was 0.70-0.75 mg / mL.

[0075] (III) Specific activity calculation method

[0076] “Specific Activity” refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0077] The specific activity calculation formula is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0078] The specific calculation results are shown in Table 1.

[0079] Table 1 Comparison of specific activity of alginate lyase

[0080] Alginate lyase and its mutants Specific activity (U / mg) wild-type ALE 121.42 S60T single point mutant 142.15 T419N single point mutant 145.66 S60T / T419N double-point mutant 160.13

[0081] From the results in Table 1, it can be seen that compared with the wild-type alginate lyase ALE, the specific activity of the alginate lyase mutants provided by the present invention is generally increased by 17.1-31.9%. Among them, the specific activity of the alginate lyase mutant containing the two-point mutation S60T / T419N is the highest, reaching 160.13U / mg, which is 31.9% higher than that of the wild-type alginate lyase ALE, achieving unexpected technical effects. This shows that the S60T and T419N mutation sites provided by the present invention can significantly improve the expression level of alginate lyase ALE in the recombinant bacteria of Trichoderma reesei, and achieve unexpected technical effects.

[0082] In summary, compared with the wild type, the alginate lyase mutant screened and obtained by the present invention has significantly improved specific activity, which is beneficial to reducing the production cost of alginate lyase and has broad market prospects.

Claims

1. An alginate lyase mutant, characterized in that: The alginate lyase mutant is an alginate lyase with an amino acid sequence of SEQ ID NO: 1, in which the 60th amino acid is changed from Ser to Thr, and / or the 419th amino acid is changed from Thr to Asn.

2. The alginate lyase mutant according to claim 1, characterized in that The amino acid sequence of the alginate lyase mutant is shown in SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:

5.

3. A DNA molecule encoding the alginate lyase mutant according to claim 1 or 2.

4. A recombinant expression plasmid comprising the DNA molecule of claim 3.

5. A host cell, characterized in that The host cell is Trichoderma reesei ( Trichoderma reesei ) or Pichia pastoris ( Pichia pastoris ).