A method for improving low temperature traits of rice based on rice OsPDCD5 gene

Abstract

The invention belongs to the technical field of rice OsPDCD5 gene improvement, and specifically relates to a method for improving rice low temperature traits based on rice OsPDCD5 gene. The method comprises the following steps: step S1: constructing a pBWA(V)H-cas9-OsPDCD5 vector, step S2: genetic transformation of the pBWA(V)H-cas9-PDCD5.2 vector, step S3: screening and detecting transformed plants, step S4: screening and detecting plants with mutations in the CDS region of OsPDCD5, and step S5: determining the low temperature resistance of OsPDCD5 mutant strains. A target fragment is selected in the CDS region of the OsPDCD5 gene, the target fragment is constructed into a knockout vector, and then the vector is transferred into an indica rice variety T025, so as to obtain a knockout strain with improved important economic traits.

Description

Technical Field

[0001] The invention relates to the technical field of drug preparation, in particular to a method for improving low temperature traits of rice based on rice OsPDCD5 gene. Background Art

[0002] Rice is one of the most important food crops in the world. About one-third of the world's population relies on rice as their staple food. Rice originated in tropical and subtropical regions. Therefore, compared with other cereal crops, rice is more susceptible to low temperature stress. Low temperature can have a significant impact on rice cultivation in 25 countries, affecting an area of ​​more than 15 million hectares. Rice may be affected by low temperature stress at different developmental stages. During the vegetative growth period, low temperature stress can cause rice to turn yellow, wilt or die. CRISPR / Cas is the latest gene editing technology. In plants, the CRISPR / Cas9 system is widely used in gene editing of various model plants and crops. As one of the most important crops, the genetic breeding and improvement of rice has always been the focus of research. Using the CRISPR / Cas9 system to accurately edit the target bases of the rice genome and obtain stable mutant strains with improved traits, many results have been achieved in laboratory theoretical research. This reveals the important value of CRISPR / Cas9 technology in transgenic breeding. Compared with traditional technologies, CRISPR / Cas9 technology has the advantages of short breeding time, high efficiency and clear goals. Therefore, the application prospects of CRISPR / Cas9 technology in improving rice crop traits and breeding new varieties are very broad.

[0003] Functional analysis of the cloned gene OsPDCD5 revealed that the constitutive expression of OsPDCD5 driven by the cauliflower mosaic virus 35S promoter caused growth and development stunting in transgenic plants, and even showed typical characteristics of programmed cell death, including reduced fresh weight, reduced total protein content, genomic DNA fragmentation, etc. Down-regulating the expression of OsPDCD5 can enhance resistance to salt, drought and low temperature stresses. Summary of the invention

[0004] The purpose of the present invention is to provide a method for improving the low temperature trait of rice based on the rice OsPDCD5 gene, which solves the problems of high cost and danger.

[0005] To achieve the above object, the present invention provides the following technical solution: a method for improving the low temperature trait of rice based on the rice OsPDCD5 gene, comprising the following steps:

[0006] Step S1: construct pBWA(V)H-cas9-OsPDCD5 vector,

[0007] 1) Amplify a 20 bp target sequence in the CDS region of the OsPDCD5 gene using primers yjstgt(+):cagtGGTCTCaggcacccagagttggaagcta and yjstgt(-):cagtGGTCTCaaaacgatagcttccaactctg;

[0008] 2) Recover the PCR product by tapping the gel and purify the DNA fragment using a kit;

[0009] 3) Prepare the enzyme digestion and ligation system:

[0010] Component Volumes pBWA(V)H-cas9i 4μL PCR 4μL BsaI / Eco31I 1μL T4_ligase:1 1μL Buffer 2μL H2O 8μL Total 20μL

[0011] 37°C for 20 min, 5 cycles; 37°C for 10 min; 20°C for 10 min; 37°C for 20 min; obtain the ligation product;

[0012] 4) 5-10 μL of the ligation product was transformed into competent E. coli, and the transformed E. coli was cultured on a kanamycin-resistant plate at 37°C for 12 hours, and then identified by plaque PCR;

[0013] 5) Pick 10 plaques and simultaneously inoculate with 1.5 ml EP tubes and perform PCR to identify whether the connection is successful. The identification primers are Pbw2+: GGCGTCTTCTACTGGTGCTA, Pbw2-: GTCTTACGGCGAGTTCTGT. The length of the amplified fragment is 422 bp. Take the bacterial solution corresponding to the three positive bands and send them for sequencing. The bacterial solution with the correct sequencing results is treated to preserve the bacteria.

[0014] Step S2, genetic transformation of pBWA(V)H-cas9-PDCD5 vector,

[0015] 1) The pBWA(V)H-cas9-PDCD5 vector was transformed into EHA105 Agrobacterium tumefaciens (Wu ZM et al., 2007) to obtain transformants, and the plasmid was extracted from the transformants and sent for sequencing. The results showed that the plasmid was pBWA(V)H-cas9-PDCD5;

[0016] 2) Induction and culture of callus from mature seeds of T025

[0017] The culture medium is shown in the following table:

[0018]

[0019] Take the mature seeds of T025, remove the shells, and wash them with 70% ethanol for 10 minutes under sterile conditions, wash them with sterile water for 5 times, transfer them to 0.1% mercuric chloride and soak them for 20 minutes, wash them with sterile water for 3 times, inoculate them in the induction medium, and culture them at 26℃ in the dark. After 20 days, select the callus for subculture;

[0020] 3) Agrobacterium infection,

[0021] EHA105 / cas9-PDCD5 Agrobacterium was cultured at 28°C for 16 hours, the bacterial solution was collected and diluted into a YEP liquid medium containing 100 μmol / L to a concentration of OD600≈0.5, and the soaking time was divided into three groups: 10 min, 20 min, and 30 min. The callus was shaken from time to time during the soaking period. After the soaking was completed, the callus was taken out, spread on a sterilized filter paper to absorb the excess bacterial solution, and then transferred to the co-cultivation medium. A layer of sterile filter paper was spread on the surface of the medium. The callus was not in direct contact with the medium on the filter paper. The callus was co-cultivated at 26°C for 6 days;

[0022] 4) Screening of transformed callus,

[0023] After the co-culture is completed, the callus pieces are removed, washed 3-5 times with sterile water, and then washed 2-3 times with sterile water containing 50 mg / L rifampicin and 50 mg / L kanamycin resistance. After absorbing excess water with sterile filter paper, the callus is transferred to the primary screening medium;

[0024] The transformed callus is screened in two rounds, primary and secondary. After 2-4 weeks of screening, it is transferred to a differentiation medium to regenerate plants. It is cultured under the conditions of 26°C and 16 hours of light per day until green seedlings are differentiated. The seedlings are then transferred to a rooting medium for culture. When the plantlets grow to about 10 cm in height, they are removed from the rooting medium, the residual medium is washed off, and after a period of hardening, they are transplanted to a greenhouse or field.

[0025] Step S3: screening and testing of transformed plants.

[0026] 1) The surviving calli after screening were cultured on differentiation medium under light for 30 days;

[0027] 2) After the plantlets are differentiated, they are transferred to a rooting and seedling growth medium and moved to a greenhouse after they grow up;

[0028] 3) PCR amplification was used to detect candidate transformed plants, and whether the T0 generation transformed plants contained the hygromycin selection marker, and 21 positive transformed plants containing pBWA(V)H-cas9-PDCD5 were obtained;

[0029] Step S4: screening and detection of plants with mutations in the CDS region of OsPDCD5.

[0030] The T0 positive transformed plants screened were harvested and planted for another generation to obtain the T1 generation. Genomic DNA was extracted from leaves and the OsPCDC5 detection primers MPCD6-F: TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R: ATAAACATGGTTGACAAATAGAGC were used to identify 9 lines containing OsPDCD5 functional mutations.

[0031] Step S5: Determination of low temperature resistance of OsPDCD5 mutant strains.

[0032] Rice seedlings that were about 10 days old were subjected to low temperature stress at an ambient temperature of 4°C for 2 days. The seedlings were then transferred back to the greenhouse to resume growth for 3 to 8 days, and finally the survival rate, ion leakage rate and chlorophyll content were measured.

[0033] As a preferred embodiment of the present invention, in step S1, the nucleotide sequence is: accc agagttggaagctatc, and the amplified PCR product is: cagtGGTCTCaggcacccagagttg gaagctatcgttttGAGACCagtg.

[0034] As a preferred embodiment of the present invention, in step S2, the transformant containing pBWA(V)H-cas9-PDCD5 is named EHA105 / cas9-PDCD5.

[0035] As a preferred embodiment of the present invention, in step S2, the culture medium contains 30 g / L sucrose + 2.5 g / L Lagar.

[0036] As a preferred embodiment of the present invention, in step S3, the amplification primers used for amplification detection are Hyg-CX-S: AGATGTTGGCGACCTCGTATT; Hyg-CX-A: AAGA TCGTTATGTTTATCGGCACT.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention selects a target fragment in the CDS region of the OsPDCD5 gene, constructs the target fragment into a knockout vector, and then transfers it into the indica rice variety T025 to obtain a knockout strain with improved important economic traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the structure of the rice OsPDCD5 gene.

[0040] Figure 2 This is a diagram of the expression vector structure of the rice OsPDCD5 gene.

[0041] Figure 3 This is the result of first-generation sequencing of rice OsPDCD5 knockout strain.

[0042] Figure 4 Field photos and individual plant comparisons of the rice OsPDCD5 knockout line and the control T025 at maturity.

[0043] Figure 5 This is a comparison of the panicle and grain shapes of rice OsPDCD5 knockout lines and the control T025 at maturity.

[0044] Figure 6 Phenotypic comparison between the OsPDCD5 knockout line and the control T025 under low temperature stress. DETAILED DESCRIPTION

[0045] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by ordinary technicians in this field without creative work based on the embodiments of the present invention are within the scope of protection of the present invention.

[0046] Embodiment 1:

[0047] Step S1: construct pBWA(V)H-cas9-OsPDCD5 vector,

[0048] 1) Primers yjstgt(+):cagtGGTCTCaggcacccagagttggaagcta and yjstgt(-):cagtGGTCTCaaaacgatagcttccaactctg were used to amplify a 20 bp target sequence in the CDS region of the OsPDCD5 gene. The nucleotide sequence was: acccagagttggaagctatc, and the amplified PCR product was: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg;

[0049] 2) Recovering the PCR product by tapping the rubber and purifying the PCR product using a kit;

[0050] 3) Prepare the enzyme digestion and ligation system:

[0051] Component Volumes pBWA(V)H-cas9i 4μL PCR 4μL BsaI / Eco31I 1μL T4_ligase:1 1μL Buffer 2μL H2O 8μL Total 20μL

[0052] 37°C for 20 min, 5 cycles; 37°C for 10 min; 20°C for 10 min; 37°C for 20 min; obtain the ligation product;

[0053] 4) 5-10 μL of the ligation product was transformed into competent E. coli, and the transformed E. coli was cultured on a kanamycin-resistant plate at 37°C for 12 hours, and then identified by plaque PCR;

[0054] 5) Pick 10 plaques and simultaneously inoculate with 1.5 ml EP tubes and perform PCR to identify whether the connection is successful. The identification primers are Pbw2+: GGCGTCTTCTACTGGTGCTA, Pbw2-: GTCTTACGGCGAGTTCTGT. The length of the amplified fragment is 422 bp. Take the bacterial solution corresponding to the three positive bands and send them for sequencing. The bacterial solution with the correct sequencing results is treated to preserve the bacteria.

[0055] Step S2, genetic transformation of pBWA(V)H-cas9-PDCD5 vector,

[0056] 1) The pBWA(V)H-cas9-PDCD5 vector was transformed into EHA105 Agrobacterium tumefaciens (Wu ZM et al., 2007) to obtain transformants, and plasmids were extracted from the transformants and sent for sequencing. The results showed that the plasmid was pBWA(V)H-cas9-PDCD5, and the transformant containing pBWA(V)H-cas9-PDCD5 was named EHA105 / cas9-PDCD5;

[0057] 2) Induction and culture of callus from mature seeds of T025

[0058] The culture medium is shown in the following table:

[0059]

[0060] The culture medium contains 30g / L sucrose + 2.5g / L agar.

[0061] Take the mature seeds of T025, remove the shells, and wash them with 70% ethanol for 10 minutes under sterile conditions, wash them with sterile water for 5 times, transfer them to 0.1% mercuric chloride and soak them for 20 minutes, wash them with sterile water for 3 times, inoculate them in the induction medium, and culture them at 26℃ in the dark. After 20 days, select the callus for subculture;

[0062] 3) Agrobacterium infection,

[0063] EHA105 / cas9-PDCD5 Agrobacterium was cultured at 28°C for 16 hours, the bacterial solution was collected and diluted into a YEP liquid medium containing 100 μmol / L to a concentration of OD600≈0.5, and the soaking time was divided into three groups: 10 min, 20 min, and 30 min. The callus was shaken from time to time during the soaking period. After the soaking was completed, the callus was taken out, spread on a sterilized filter paper to absorb the excess bacterial solution, and then transferred to the co-cultivation medium. A layer of sterile filter paper was spread on the surface of the medium. The callus was not in direct contact with the medium on the filter paper. The callus was co-cultivated at 26°C for 6 days;

[0064] 4) Screening of transformed callus,

[0065] After the co-culture is completed, the callus pieces are removed, washed 3-5 times with sterile water, and then washed twice with sterile water containing 50 mg / L rifampicin and 50 mg / L kanamycin resistance. After absorbing excess water with sterile filter paper, the callus is transferred to the primary screening medium;

[0066] The transformed callus is screened in two rounds, primary and secondary. After 2 weeks of screening, it is transferred to a differentiation medium to regenerate plants. It is cultured under the conditions of 26°C and 16 hours of light per day until green seedlings are differentiated. The seedlings are then transferred to a rooting medium for culture. When the plantlets grow to about 10 cm in height, they are removed from the rooting medium, the residual medium is washed off, and after a period of hardening, they are transplanted to a greenhouse or field.

[0067] Step S3: screening and testing of transformed plants.

[0068] 1) The surviving calli after screening were cultured on differentiation medium under light for 30 days;

[0069] 2) After the plantlets are differentiated, they are transferred to a rooting and seedling growth medium and moved to a greenhouse after they grow up;

[0070] 3) PCR amplification was used to detect candidate transformed plants, and whether the T0 generation transformed plants contained hygromycin selection markers, and 21 positive transformed plants containing pBWA(V)H-cas9-PDCD5 were obtained. The amplification primers used for amplification detection were Hyg-CX-S: AGATGTTGGCGACCTCGTATT; Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT;

[0071] Step S4: screening and detection of plants with mutations in the CDS region of OsPDCD5.

[0072] The T0 positive transformed plants screened were harvested and planted for another generation to obtain the T1 generation. Genomic DNA was extracted from leaves and the OsPCDC5 detection primers MPCD6-F: TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R: ATAAACATGGTTGACAAATAGAGC were used to identify 9 lines containing OsPDCD5 functional mutations.

[0073] Step S5: Determination of low temperature resistance of OsPDCD5 mutant strains.

[0074] Rice seedlings that were about 10 days old were subjected to low temperature stress at an ambient temperature of 4°C for 2 days. The seedlings were then transferred back to the greenhouse to resume growth for 3 days. Finally, the survival rate, ion leakage rate and chlorophyll content were measured.

[0075] Embodiment 2:

[0076] Step S1: construct pBWA(V)H-cas9-OsPDCD5 vector,

[0077] 1) Primers yjstgt(+):cagtGGTCTCaggcacccagagttggaagcta and yjstgt(-):cagtGGTCTCaaaacgatagcttccaactctg were used to amplify a 20 bp target sequence in the CDS region of the OsPDCD5 gene. The nucleotide sequence was: acccagagttggaagctatc, and the amplified PCR product was: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg;

[0078] 2) Recovering the PCR product by tapping the rubber and purifying the PCR product using a kit;

[0079] 3) Prepare the enzyme digestion and ligation system:

[0080] Component Volumes pBWA(V)H-cas9i 4μL PCR 4μL BsaI / Eco31I 1μL T4_ligase:1 1μL Buffer 2μL H2O 8μL Total 20μL

[0081] 37°C for 20 min, 5 cycles; 37°C for 10 min; 20°C for 10 min; 37°C for 20 min; obtain the ligation product;

[0082] 4) 5-10 μL of the ligation product was transformed into competent E. coli, and the transformed E. coli was cultured on a kanamycin-resistant plate at 37°C for 12 hours, and then identified by plaque PCR;

[0083] 5) Pick 10 plaques and simultaneously inoculate with 1.5 ml EP tubes and perform PCR to identify whether the connection is successful. The identification primers are Pbw2+: GGCGTCTTCTACTGGTGCTA, Pbw2-: GTCTTACGGCGAGTTCTGT. The length of the amplified fragment is 422 bp. Take the bacterial solution corresponding to the three positive bands and send them for sequencing. The bacterial solution with the correct sequencing results is treated to preserve the bacteria.

[0084] Step S2, genetic transformation of pBWA(V)H-cas9-PDCD5 vector,

[0085] 1) The pBWA(V)H-cas9-PDCD5 vector was transformed into EHA105 Agrobacterium tumefaciens (Wu ZM et al., 2007) to obtain transformants, and plasmids were extracted from the transformants and sent for sequencing. The results showed that the plasmid was pBWA(V)H-cas9-PDCD5, and the transformant containing pBWA(V)H-cas9-PDCD5 was named EHA105 / cas9-PDCD5;

[0086] 2) Induction and culture of callus from mature seeds of T025

[0087] The culture medium is shown in the following table:

[0088]

[0089] The culture medium contains 30g / L sucrose + 2.5g / L agar.

[0090] Take the mature seeds of T025, remove the shells, and wash them with 70% ethanol for 10 minutes under sterile conditions, wash them with sterile water for 5 times, transfer them to 0.1% mercuric chloride and soak them for 20 minutes, wash them with sterile water for 3 times, inoculate them in the induction medium, and culture them at 26℃ in the dark. After 20 days, select the callus for subculture;

[0091] 3) Agrobacterium infection,

[0092] EHA105 / cas9-PDCD5 Agrobacterium was cultured at 28°C for 16 hours, the bacterial solution was collected and diluted into a YEP liquid medium containing 100 μmol / L to a concentration of OD600≈0.5, and the soaking time was divided into three groups: 10 min, 20 min, and 30 min. The callus was shaken from time to time during the soaking period. After the soaking was completed, the callus was taken out, spread on a sterilized filter paper to absorb the excess bacterial solution, and then transferred to the co-cultivation medium. A layer of sterile filter paper was spread on the surface of the medium. The callus was not in direct contact with the medium on the filter paper. The callus was co-cultivated at 26°C for 6 days;

[0093] 4) Screening of transformed callus,

[0094] After the co-culture was completed, the callus pieces were removed, washed 5 times with sterile water, and then washed 3 times with sterile water containing 50 mg / L rifampicin and 50 mg / L kanamycin resistance. After absorbing the excess water with sterile filter paper, the callus was transferred to the primary screening medium;

[0095] The transformed callus is screened in two rounds, primary and secondary. After the three-week screening, it is transferred to a differentiation medium to regenerate plants. The plants are cultured under the conditions of 26°C and 16 hours of light per day until green seedlings are differentiated. The seedlings are then transferred to a rooting medium for culture. When the plantlets grow to about 10 cm in height, they are removed from the rooting medium, the residual medium is washed off, and after a period of hardening, they are transplanted to a greenhouse or field.

[0096] Step S3: screening and testing of transformed plants.

[0097] 1) The surviving calli after screening were cultured on differentiation medium under light for 30 days;

[0098] 2) After the plantlets are differentiated, they are transferred to a rooting and seedling growth medium and moved to a greenhouse after they grow up;

[0099] 3) PCR amplification was used to detect candidate transformed plants, and whether the T0 generation transformed plants contained hygromycin selection markers, and 21 positive transformed plants containing pBWA(V)H-cas9-PDCD5 were obtained. The amplification primers used for amplification detection were Hyg-CX-S: AGATGTTGGCGACCTCGTATT; Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT;

[0100] Step S4: screening and detection of plants with mutations in the CDS region of OsPDCD5.

[0101] The T0 positive transformed plants screened were harvested and planted for another generation to obtain the T1 generation. Genomic DNA was extracted from leaves and the OsPCDC5 detection primers MPCD6-F: TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R: ATAAACATGGTTGACAAATAGAGC were used to identify 9 lines containing OsPDCD5 functional mutations.

[0102] Step S5: Determination of low temperature resistance of OsPDCD5 mutant strains.

[0103] Rice seedlings that were about 10 days old were subjected to low temperature stress and kept at 4°C for 2 days. The seedlings were then transferred back to the greenhouse to resume growth for 5 days. Finally, the survival rate, ion leakage rate and chlorophyll content were measured.

[0104] Embodiment 3:

[0105] Step S1: construct pBWA(V)H-cas9-OsPDCD5 vector,

[0106] 1) Primers yjstgt(+):cagtGGTCTCaggcacccagagttggaagcta and yjstgt(-):cagtGGTCTCaaaacgatagcttccaactctg were used to amplify a 20 bp target sequence in the CDS region of the OsPDCD5 gene. The nucleotide sequence was: acccagagttggaagctatc, and the amplified PCR product was: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg;

[0107] 2) Recovering the PCR product by tapping the rubber and purifying the PCR product using a kit;

[0108] 3) Prepare the enzyme digestion and ligation system:

[0109] Component Volumes pBWA(V)H-cas9i 4μL PCR 4μL BsaI / Eco31I 1μL T4_ligase:1 1μL Buffer 2μL H2O 8μL Total 20μL

[0110] 37°C for 20 min, 5 cycles; 37°C for 10 min; 20°C for 10 min; 37°C for 20 min; obtain the ligation product;

[0111] 4) 5-10 μL of the ligation product was transformed into competent E. coli, and the transformed E. coli was cultured on a kanamycin-resistant plate at 37°C for 12 hours, and then identified by plaque PCR;

[0112] 5) Pick 10 plaques and simultaneously inoculate with 1.5 ml EP tubes and perform PCR to identify whether the connection is successful. The identification primers are Pbw2+: GGCGTCTTCTACTGGTGCTA, Pbw2-: GTCTTACGGCGAGTTCTGT. The length of the amplified fragment is 422 bp. Take the bacterial solution corresponding to the three positive bands and send them for sequencing. The bacterial solution with the correct sequencing results is treated to preserve the bacteria.

[0113] Step S2, genetic transformation of pBWA(V)H-cas9-PDCD5 vector,

[0114] 1) The pBWA(V)H-cas9-PDCD5 vector was transformed into EHA105 Agrobacterium tumefaciens (Wu ZM et al., 2007) to obtain transformants, and plasmids were extracted from the transformants and sent for sequencing. The results showed that the plasmid was pBWA(V)H-cas9-PDCD5, and the transformant containing pBWA(V)H-cas9-PDCD5 was named EHA105 / cas9-PDCD5;

[0115] 2) Induction and culture of callus from mature seeds of T025

[0116] The culture medium is shown in the following table:

[0117]

[0118] The culture medium contains 30g / L sucrose + 2.5g / L agar.

[0119] Take the mature seeds of T025, remove the shells, and wash them with 70% ethanol for 10 minutes under sterile conditions, wash them with sterile water for 5 times, transfer them to 0.1% mercuric chloride and soak them for 20 minutes, wash them with sterile water for 3 times, inoculate them in the induction medium, and culture them at 26℃ in the dark. After 20 days, select the callus for subculture;

[0120] 3) Agrobacterium infection,

[0121] EHA105 / cas9-PDCD5 Agrobacterium was cultured at 28°C for 16 hours, the bacterial solution was collected and diluted into a YEP liquid medium containing 100 μmol / L to a concentration of OD600≈0.5, and the soaking time was divided into three groups: 10 min, 20 min, and 30 min. The callus was shaken from time to time during the soaking period. After the soaking was completed, the callus was taken out, spread on a sterilized filter paper to absorb the excess bacterial solution, and then transferred to the co-cultivation medium. A layer of sterile filter paper was spread on the surface of the medium. The callus was not in direct contact with the medium on the filter paper. The callus was co-cultivated at 26°C for 6 days;

[0122] 4) Screening of transformed callus,

[0123] After the co-culture was completed, the callus pieces were removed, washed 4 times with sterile water, and then washed 3 times with sterile water containing 50 mg / L rifampicin and 50 mg / L kanamycin resistance. After absorbing the excess water with sterile filter paper, the callus was transferred to the primary screening medium;

[0124] The transformed callus is screened in two rounds, primary and secondary. After 2-4 weeks of screening, it is transferred to a differentiation medium to regenerate plants. It is cultured under the conditions of 26°C and 16 hours of light per day until green seedlings are differentiated. The seedlings are then transferred to a rooting medium for culture. When the plantlets grow to about 10 cm in height, they are removed from the rooting medium, the residual medium is washed off, and after a period of hardening, they are transplanted to a greenhouse or field.

[0125] Step S3: screening and testing of transformed plants.

[0126] 1) The surviving calli after screening were cultured on differentiation medium under light for 30 days;

[0127] 2) After the plantlets are differentiated, they are transferred to a rooting and seedling growth medium and moved to a greenhouse after they grow up;

[0128] 3) PCR amplification was used to detect candidate transformed plants, and whether the T0 generation transformed plants contained hygromycin selection markers, and 21 positive transformed plants containing pBWA(V)H-cas9-PDCD5 were obtained. The amplification primers used for amplification detection were Hyg-CX-S: AGATGTTGGCGACCTCGTATT; Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT;

[0129] Step S4: screening and detection of plants with mutations in the CDS region of OsPDCD5.

[0130] The T0 positive transformed plants screened were harvested and planted for another generation to obtain the T1 generation. Genomic DNA was extracted from leaves and the OsPCDC5 detection primers MPCD6-F: TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R: ATAAACATGGTTGACAAATAGAGC were used to identify 9 lines containing OsPDCD5 functional mutations.

[0131] Step S5: Determination of low temperature resistance of OsPDCD5 mutant strains.

[0132] Rice seedlings that were about 10 days old were subjected to low temperature stress at an ambient temperature of 4°C for 2 days. The seedlings were then transferred back to the greenhouse to resume growth for 6 days. Finally, the survival rate, ion leakage rate and chlorophyll content were measured.

[0133] The sequence of the present invention

[0134] SEQ ID NO.1:

[0135] Rice OsPDCD5 gene full-length cDNA sequence:

[0136] GGAGAGAGGCCCAGATGAGTTGCGTTAAATCCACGGGTGAGGAGAGAGAAAAAGGAGGTCAAGTTCTCTCTCTCTTCCTCTCGTCGCCGGAGGCGGGAGGCCATCGACGCTGAAGTGAAGGGGATCGCGATCTCCGGCGAGCGTGCGGGGGAAGATGGCTGACCCAGAGTTGGAAGCTATCAGGCAGAGGAGAATGCAAGAGCTAATGGCACAGCATGGTGCGGCAAATCCGCAAAATGCTGGGCAACAAAAAGCTCAAGAAGATGCAAAGCAGGAAGCTGAGGAACGGCGGCAGATGATGCTTGCTCAGATTTTATCTTCTGAAGCTAGAGAAAGGCTCTCCCGCATAGCTTTGGTCAAACCTGATAAAGCAAGAGGGGTGGAGGATGTTCTTCTGAGAGCTGCTCAGTCCGGTGGAATATCTGAAAAGGTGTCTGAAGAAAGGCTTATCTCACTTCTGGAGCAAATCAATACCCACACTAGCAAACAGACGAAAGTTACGATTCAGAGGCGCCGGAGCGTCCTTGACGATGATGACTAGCTGCATGTGTGTTGTGTGTACGATGAGCTGGTGGAGGAGTCTGCTGTAGCGCAAAACTACTTAGAAATGATGATTATCAAACGCTATATCAACAACCATCAAAACTTGAGCGACTATTTGATGGATATTTGGCCGTATATGAATTAATTCGAGTTTGGTTTGGCTTGTTCCATTGATGACATTCAAACTTTTGACTGCTCCGAAGGGGAATTGCCACACGTCCGACTGGTATGTACGACTTAGCATCCGACCAGTACTTACCTGCTCCTTGCTCTGGCCCACATGGAGAGCAGCTGGCTCGTTGGAGTAAATTGATTAGCGAACAATAGGGTCGGATGTA

[0137] TAGCAGTACTCGCTCCGAAGTGTGTATCCATCAT

[0138] ATCATGAGTATCTTA

[0139] SEQ ID NO.2:

[0140] Target sequence of CDS region of rice OsPDCD5 gene:

[0141] ACCCAGAGTTGGAAGCTATCAGG

[0142] SEQ ID NO.3:

[0143] The amino acid sequence encoded by the rice OsPDCD5 gene is:

[0144] MADPELEAIRQRRMQELMAQHGAANPQNAGQQKAQEDAKQEAEERRQMMLAQILS SEARERLSRIALVKPDKARGVEDVLLRAAQSGGISEKVSEERLISLLEQINTHTSKQTK VTIQRRRSVLDDDD*

[0145] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for improving the low temperature traits of rice based on the rice OsPDCD5 gene, characterized in that: The steps include: Step S1: construct pBWA(V)H-cas9-OsPDCD5 vector, 1) Amplify a 20 bp target sequence in the CDS region of the OsPDCD5 gene using primers yjstgt(+):cagtGGTCTCaggcacccagagttggaagcta and yjstgt(-):cagtGGTCTCaaaacgatagcttccaactctg; 2) Recovering the PCR product by tapping the rubber and purifying the PCR product using a kit; 3) Prepare the enzyme digestion and ligation system: 37°C for 20 min, 5 cycles; 37°C for 10 min; 20°C for 10 min; 37°C for 20 min; obtain the ligation product; 4) 5-10 μL of the ligation product was transformed into competent E. coli, and the transformed E. coli was cultured on a kanamycin-resistant plate at 37°C for 12 hours, and then identified by plaque PCR; 5) Pick the plaques and inoculate the bacteria in 1.5 ml EP tube and identify whether the connection is successful by PCR. The identification primers are Pbw2+: GGCGTCTTCTACTGGTGCTA, Pbw2-: GTCTTACGGCGAGTTCTGT. The length of the amplified fragment is 422 bp. Select the bacterial solution corresponding to the positive band and send it for sequencing. The bacterial solution with the correct sequencing result shall be treated for bacteria preservation; Step S2, genetic transformation of pBWA(V)H-cas9-PDCD5 vector, 1) The pBWA(V)H-cas9-PDCD5 vector was transformed into EHA105 Agrobacterium to obtain transformants, and plasmids were extracted from the transformants and sent for sequencing. The results showed that the plasmid was pBWA(V)H-cas9-PDCD5; 2) Induction and culture of callus from mature seeds of T025 The culture medium is shown in the following table: Take the mature seeds of T025, remove the shells, and wash them with 70% ethanol for 10 minutes under sterile conditions, wash them with sterile water for 5 times, transfer them to 0.1% mercuric chloride and soak them for 20 minutes, wash them with sterile water for 3 times, inoculate them in the induction medium, and culture them at 26℃ in the dark. After 20 days, select the callus for subculture; 3) Agrobacterium infection, EHA105 / cas9-PDCD5 Agrobacterium was cultured at 28°C for 16 hours, the bacterial solution was collected and diluted into a YEP liquid medium containing 100 μmol / L to a concentration of OD600≈0.5, and the soaking time was divided into three groups: 10 min, 20 min, and 30 min. The callus was shaken from time to time during the soaking period. After the soaking was completed, the callus was taken out, spread on a sterilized filter paper to absorb the excess bacterial solution, and then transferred to the co-cultivation medium. A layer of sterile filter paper was spread on the surface of the medium. The callus was not in direct contact with the medium on the filter paper. The callus was co-cultivated at 26°C for 6 days; 4) Screening of transformed callus, After the co-culture is completed, the callus pieces are removed, washed 3-5 times with sterile water, and then washed 2-3 times with sterile water containing 50 mg / L rifampicin and 50 mg / L kanamycin resistance. After absorbing excess water with sterile filter paper, the callus is transferred to the primary screening medium; The transformed callus is screened in two rounds, primary and secondary. After 2-4 weeks of screening, it is transferred to a differentiation medium to regenerate plants. It is cultured under the conditions of 26°C and 16 hours of light per day until green seedlings are differentiated. The seedlings are then transferred to a rooting medium for culture. When the plantlets grow to about 10 cm in height, they are removed from the rooting medium, the residual medium is washed off, and after a period of hardening, they are transplanted to a greenhouse or field. Step S3: screening and testing of transformed plants. 1) The surviving calli after screening were cultured on differentiation medium under light for 30 days; 2) After the plantlets are differentiated, they are transferred to a rooting and seedling growth medium and moved to a greenhouse after they grow up; 3) PCR amplification was used to detect candidate transformed plants, and whether the T0 generation transformed plants contained the hygromycin selection marker, and positive transformed plants containing pBWA(V)H-cas9-PDCD5 were obtained; Step S4: screening and detection of plants with mutations in the CDS region of OsPDCD5. The screened T0 positive transformed plants were harvested and planted for another generation to obtain the T1 generation. Genomic DNA was extracted from leaves and the OsPCDC5 detection primers MPCD6-F: TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R: ATAAACATGGTTGACAAATAGAGC were used to identify the strain with OsPDCD5 functional mutation; the target sequence of the mutant strain was: ACCCAGATTGGAATC; Step S5: Determination of low temperature resistance of OsPDCD5 mutant strains. The rice seedlings, which were about 10 days old, were subjected to low temperature stress at 4°C for 2 days. The seedlings were then transferred back to the greenhouse to resume growth for 3 to 8 days. Finally, the survival rate, ion leakage rate, and chlorophyll content were measured. The target sequence in step S1 is: acccagagttggaagctatc, and the amplified PCR product is: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg; In step S2, the transformant containing pBWA(V)H-cas9-PDCD5 was named EHA105 / cas9-PDCD5; In step S2, the culture medium contains 30 g / L sucrose + 2.5 g / L agar; In step S3, the amplification primer used for amplification detection is Hyg-CX-S: AGATGTTGGCGACCTCGTATT;Hyg-CX-A:AAGATCGTTATGTTTATCGGCACT.

Images