Application of PdDA1 gene in improving poplar biomass and changing cell components

By knocking out the PdDA1 gene and using CRISPR/Cas9 technology to carry out genetic transformation of poplars, the biological yield of poplars and their cell components are significantly improved, which solves the problem of difficulty in increasing poplar bioproduction in the existing technology, and achieves the development of poplar varieties with high cellulose content and high total sugar release.

CN118256549BActive Publication Date: 2025-06-10QINGDAO AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410554498.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-07
Publication Date
2025-06-10
Estimated Expiration
2044-05-07

AI Technical Summary

Technical Problem

The prior art is difficult to effectively increase the bioproduction of poplars and change their cell components, especially in the Nanlin 895 poplar planting area, and there is a lack of effective genetic modification methods to improve bioproduction.

Method used

By knocking out the PdDA1 gene, the PdDA1-CRISPR/Cas9 vector was constructed using CRISPR/Cas9 technology to carry out genetic transformation of poplar trees, significantly improving the plant height, ground diameter growth rate, stem weight, cellulose content and total sugar release of poplar trees.

Benefits of technology

Knocking out the PdDA1 gene can significantly increase the bioproduction of poplars, increase cellulose content and total sugar release, and provide high-quality poplar varieties for textile, papermaking and polymer material preparation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118256549B_ABST
    Figure CN118256549B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components, belonging to the technical field of poplar genetic engineering breeding. The CDS sequences of the PdDA1 gene are shown in SEQ ID NO.1 and SEQ ID NO.2. The application is that knocking out the PdDA1 gene can improve the biological yield of poplar and change cell components. The present invention provides the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components. Knocking out the PdDA1 gene can significantly increase the growth rates of the plant height and ground diameter of poplar and the stem dry weight; it can significantly increase the cellulose content while not affecting the lignin content of poplar, and can be used for the directional cultivation of poplar varieties with high cellulose content; it can significantly increase the total sugar release amount of poplar; the transgenic poplar with the PdDA1 gene knocked out has great application prospects in the fields of textile, papermaking, and polymer material preparation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of poplar genetic engineering breeding, and particularly to the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components. Background Art

[0002] Forest trees are an important renewable energy source with a wide range of uses. They not only play an important role in construction and furniture manufacturing but also in various other fields. Their main uses include the following aspects:

[0003] 1. Wood has good strength and durability, can withstand weight and external impacts, and is widely used in building structures such as beams, columns, and floors. It can also be used for architectural decoration such as doors, windows, floors, and cabinets, providing people with a warm and natural feeling.

[0004] 2. Due to the plasticity and aesthetics of wood, it is often used to make various furniture such as tables, chairs, beds, and cabinets.

[0005] 3. The natural texture and texture of wood are deeply loved by people. It also has good durability and stability and can be used to make various handicrafts and ornaments such as carvings, ornaments, and picture frames, attracting the favor of many consumers. Wood is also widely used in the interior decoration of transportation tools such as airplanes, trains, and cars, increasing comfort and aesthetics.

[0006] 4. Wood is an important raw material for making pulp and paper. By processing and bleaching wood fibers, high-quality paper can be made for writing, printing, packaging, etc. It is also an important raw material for preparing liquid ethanol fuel.

[0007] China is the world's largest wood importer, with an annual wood demand of approximately 800 million cubic meters and a foreign dependence of over 50%. Therefore, the development of forestry is of great strategic significance to China. Poplar is one of the main tree species in China's artificial forests, with the characteristics of a short growth cycle, high yield, and easy planting. It is also a fast-growing and high-yield tree species widely planted worldwide. Currently, the area of poplar artificial forests in China reaches 82.5 million mu, accounting for 13.7% of the total area of artificial timber forests in China, ranking first in the world. Therefore, cultivating excellent poplar varieties and optimizing the quality of poplar wood have great research value and application prospects for promoting the sustainable development of forestry in China.

[0008] With the continuous improvement of the poplar genetic transformation system and the completion of the whole-genome sequencing of multiple poplar species, the directional cultivation of high-quality and high-yield poplar new varieties through genetic engineering technology has become an important means and effective method to accelerate the process of forest tree improvement in China, solve the wood demand, and promote the development of the modern forestry industry.

[0009] Cellulose is the oldest natural polymer on Earth and is humanity's most precious natural renewable resource. More than 8 million tons of cellulose are used for papermaking every year worldwide. Because of its wide sources, non-toxicity, good biocompatibility, and strong durability, cellulose occupies an important position in the field of polymer synthesis and is incomparable to non-renewable resources such as coal, oil, and natural gas. For example, cellulose can be used to manufacture medical materials (artificial blood vessels, artificial skin, artificial organs, etc.), industrial materials (automobile parts, aerospace components, and building materials), and daily necessities (clothes, furniture, and decorations). Summary of the Invention

[0010] The object of the present invention is to provide the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components, so as to provide functional genes for the directional cultivation of poplar varieties with fast growth rate, high cellulose content, and high total sugar release amount, in order to relieve the market demand pressure for wood products.

[0011] To achieve the above object, the present invention provides the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components. The CDS sequences of the PdDA1 gene are shown in SEQ ID NO.1 and SEQ ID NO.2. The application is that knocking out the PdDA1 gene can improve the biological yield of poplar and change cell components.

[0012] Preferably, the improvement of the biological yield of poplar refers to the improvement of the growth rates of poplar plant height, ground diameter, and stem dry weight.

[0013] Preferably, the change of cell components refers to the improvement of cellulose content and total sugar release amount.

[0014] The application of the vector and / or strain containing the above PdDA1 gene in poplar breeding. The vector includes overexpression vector, knockout vector, and silencing vector, and the strain includes Escherichia coli and Agrobacterium.

[0015] Poplar plants with the above PdDA1 gene knocked out.

[0016] The application of the above poplar plants, and the application is in textile, papermaking, ethanol fuel preparation, and polymer material preparation.

[0017] The Nanlin 895 poplar is a new variety selected through the "9th Five-Year Plan" scientific and technological research project of Nanjing Forestry University. It features fast growth, high quality, and high yield. In 2002, it passed the national forest tree improved variety certification and was included in the first batch of national forest tree improved variety list, becoming a new poplar variety that the State Forestry Administration focused on promoting (Zhang Yuehu, Liu Gang. Breeding Techniques of New Poplar Varieties Nanlin 95 Poplar and 895 Poplar [J]. Forest By-Products and Specialties in China, 2003, 000(004): 38-39.). Subsequently, it quickly became the main poplar variety planted south of the Yellow River. However, current research on poplars mainly focuses on varieties planted in the north, such as Populus trichocarpa and 84K, and there are relatively few reports on methods for genetically modifying Nanlin 895 poplar to effectively improve its biological yield. Success in genetically modifying Nanlin 895 poplar will have a significant impact on increasing the biological yield of poplars in the areas south of the Yellow River and the total output of timber in China.

[0018] Therefore, the application of the PdDA1 gene provided by the present invention in improving the biological yield of poplars and changing cell components has the following specific technical effects:

[0019] (1) Knocking out the PdDA1 gene can significantly increase the growth rate of plant height, ground diameter, and stem dry weight of poplars;

[0020] (2) Knocking out the PdDA1 gene can significantly increase its cellulose content without affecting the lignin content of poplars, and can be used for the directional cultivation of poplar varieties with high cellulose content;

[0021] (3) Knocking out the PdDA1 gene can significantly increase the total sugar release of poplars;

[0022] (4) The transgenic poplars with the PdDA1 gene knocked out have great application prospects in the fields of textile, papermaking, and polymer material preparation.

[0023] The technical solutions of the present invention will be further described in detail below through the accompanying drawings and examples. Brief Description of the Drawings

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0025] Figure 1 It is a schematic diagram of the PdDA1-CRISPR / Cas9 vector constructed in Example 1 of the present invention;

[0026] Figure 2 It is the sequencing alignment result of the transgenic positive seedlings obtained in Example 3 of the present invention;

[0027] Figure 3 These are the photos of some transgenic plants in Example 4 of the present invention on the 60th day after being transferred to the greenhouse for growth;

[0028] Figure 4 These are the determination results of the total lignin and cellulose contents in Example 5 of the present invention;

[0029] Figure 5 These are the glucose standard curves prepared in the determination of the total cellulose content in Example 5 of the present invention;

[0030] Figure 6 These are the determination results of the total sugar release amount in Example 5 of the present invention;

[0031] Figure 7 These are the determination results of the stem dry weight in Example 5 of the present invention. Detailed implementation manners

[0032] The technical solutions of the present invention will be further described below with reference to the drawings and examples.

[0033] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and complete, the technical solutions of the present invention will be clearly and completely described below with reference to the drawings and examples. The following detailed descriptions are all descriptions of examples, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meanings as those generally understood by those of ordinary skill in the technical field to which the present application belongs.

[0034] The instrument equipment and reagent materials used in the examples are all obtained through commercial channels.

[0035] The information of the culture media used in the examples is as follows:

[0036] Co-culture medium: WPM 2.14 g / L, Ca(NO3) 2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min, and then add acetosyringone (AS) with a concentration of 100 mM / L; add 8 g / L of agar to the solid medium.

[0037] Selection medium: WPM 2.14 g / L, Ca(NO3) 2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, 2,4-D 1 mg / L, Kinetin 0.5 mg / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min, and then add hygromycin (Hyg) 3 mg / L, ticarcillin disodium / clavulanate potassium (TMT) 300 mg / L, cefotaxime (cef) 300 mg / L; add 8 g / L of agar to the solid medium;

[0038] Screening medium: WPM 2.14 g / L, Ca(NO3) 2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, TDZ 0.02 mg / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min, and then add hygromycin (Hyg) 3 mg / L, ticarcillin (TMT) 300 mg / L, cefotaxime (cef) 300 mg / L; add 8 g / L of agar to the solid medium.

[0039] Rooting medium: 1 / 2MS 2.203 g / L, MES 0.5 g / L, sucrose 20 g / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min; add 8 g / L of agar to the solid medium.

[0040] Example 1

[0041] Construct the PdDA1 - CRISPR / Cas9 vector as follows:

[0042] S1.1. For two homologous genes of the PdDA1 gene: PdDA1a (CDS sequence shown in SEQ ID NO.1) and PdDA1b (CDS sequence shown in SEQ ID NO.2), design 2 specific sgRNA targets DA1a and DA1b in the specific sequence region of the PdDA1 gene respectively through the online software CRISPR - P2.0 (http: / / cbi.hzau.edu.cn / crispr / ). The sequence of the DA1a target is shown in SEQ ID NO.3, and the sequence of the DA1b target is shown in SEQ ID NO.4.

[0043] SEQ ID NO.1

[0044] PdDA1a (Potri.002G132700) CDS sequence (1464 bp)

[0045]

[0046] SEQ ID NO.2

[0047] CDS sequence of PdDA1b (Potri.014G039900) (1440bp)

[0048]

[0049] SEQ ID NO.3: CCGTTGTCATGCTTGCGGCCTAC

[0050] SEQ ID NO.4: TGCAATACAGAGATTGGCCAGGG

[0051] S1.2. Sequentially concatenate the target sequences into the pYLCRISPR / Cas9P35S-H vector (kindly provided by Academician Liu Yaoguang) to obtain the PdDA1-specific gene editing vector PdDA1-CRISPR / Cas9 (schematic diagram as shown in Figure 1 shown), and the specific steps can be referred to Tang et al., Plant Cell, 2022).

[0052] Example 2

[0053] Genetically transform the poplar leaves with the PdDA1-CRISPR / Cas9 vector constructed in Example 1. The steps are as follows:

[0054] S2.1. Take out the preserved bacterial liquid from the -80°C refrigerator, add it to 1 mL of liquid LB medium containing 50 mg / L kanamycin and rifampicin resistance, incubate at 28°C and 220 rpm for 24 h to activate the strain. Then, take 200 μL of the bacterial liquid and add it to 50 mL of liquid LB medium containing 50 mg / L kanamycin and rifampicin resistance, and culture until the OD 600 is 0.6 - 0.8.

[0055] S2.2. Centrifuge at 5000 rpm for 10 min to collect the bacterial cells, add the bacterial cells to the co-culture liquid medium containing 100 μM / L acetosyringone (AS), and culture in an incubator at 28°C and 220 rpm until the OD 600 is 0.3 - 0.4, as the infection solution.

[0056] S2.3. Take the upper 2 - 5 young leaves of the sterile seedlings of "Nanlin 895", make 3 - 4 cuts on the main vein with a sterile scalpel, put them into the infection solution and soak for about 8 min, place the leaves on sterile filter paper to absorb the moisture, and spread them flat on the co-culture solid medium, and perform dark treatment at 28°C for 2 d.

[0057] S2.4. Transfer the leaves to the selection medium for dark culture. When the callus grows to the size of rice grains, cut it off with a sterile scalpel, transfer it to the screening medium for inducing buds for culture. When the callus grows out of young buds, cut off the buds and insert them into the rooting medium for culture.

[0058] Example 3

[0059] Identification of transgenic poplar seedlings is as follows:

[0060] S3.1. Use the Edward Buffer method to extract the DNA of the leaves of the genetically transformed seedlings that have grown in the rooting medium for 1 month in Example 2. After amplifying the fragments on both sides of the target, send them to the company for sequencing. Compare the sequencing results with the WT sequence to identify the PdDA1 gene knockout mutants. Use primers SP-L2 and SP-R to amplify the fragments on both sides of the target. The sequence of SP-L2 is shown in SEQ ID NO.5, and the sequence of SP-R is shown in SEQ ID NO.6.

[0061] SEQ ID NO.5: 5′-GTCGTGCTCCACATGTTGA-3′

[0062] SEQ ID NO.6: 5′-CGACATAGATGCAATAACTTCG-3′

[0063] S3.2. Perform 1% agarose gel electrophoresis on the amplification products of the leaves of the genetically transformed seedlings, and then use the kit to cut and recover the bands of the appropriate size according to the attached instructions. Send the recovered products to the company for sequencing, and compare the sequencing results with the sequence at the target position in the wild type. As Figure 2 shown, a total of two double mutant gene editing lines with different numbers of base losses at the two targets of DA1a and DA1b were screened.

[0064] Example 4

[0065] Investigate the plant height and ground diameter of the transgenic plants, and the steps are as follows:

[0066] Transfer the transgenic seedlings that have grown in the rooting medium for 1 month and the non-transgenic seedlings (wild type) grown from callus to a 24 cm × 19.5 cm × 26.5 cm gallon pot, and place them in a greenhouse (photoperiod 16 h / 8 h, light intensity 80 μmol × m -2 × s -1 , temperature 24 - 26 °C, humidity 70%) for propagation. Starting from the day of transplantation, measure the plant height and ground diameter of the plants every two weeks for a total of 4 times. Set 3 biological replicates for the transgenic plants and the wild type plants respectively. The statistical results of the plant height and ground diameter are shown in Table 1. Photos of some transgenic plants on the 60th day after being transferred to the greenhouse for growth are shown as Figure 3 shown.

[0067] Table 1

[0068] Plant Plant height (cm) Ground diameter (mm) WT-1 57.5 4.6 WT-2 56.5 4.6 WT-3 56.8 4.7 DA1-CR-12 62.7 5.0 DA1-CR-23 64.5 5.2 DA1-CR-26 64.3 5.1

[0069] From Table 1 and Figure 3It can be seen that under the same growth conditions, the plant height and ground diameter of transgenic plants are significantly greater than those of wild-type plants, that is, knocking out the PdDA1 gene can increase the growth rate of poplar plant height and ground diameter, thereby increasing the biomass of poplar.

[0070] Example 5

[0071] Identify the cell wall components of transgenic seedlings, and the steps are as follows:

[0072] (1) Extract cell wall alcohol-insoluble residue (AIR):

[0073] ① Select wild-type and transgenic positive seedlings grown in the greenhouse for about 60 days, and take the fifth internode stem as the experimental material.

[0074] ② Put the taken materials into liquid nitrogen for quick freezing, grind them into powder with a tissue crusher, and put them into a centrifuge tube for extracting AIR.

[0075] ③ Take about 1 mL of the ground sample and put it into a 2 mL centrifuge tube, add 80% ethanol to 1.8 mL, centrifuge at 12,000 rpm for 10 min, and gently suck out the upper layer liquid with a pipette after centrifugation, avoiding sucking the precipitate.

[0076] ④ Add 1 mL of 80% ethanol to the above precipitate respectively, centrifuge at 12,000 rpm for 10 min, gently suck out the upper layer liquid with a pipette after centrifugation, and wash twice with 1 mL of absolute ethanol, then gently suck out the upper layer liquid with a pipette after centrifuging at 12,000 rpm for 10 min.

[0077] ⑤ Add 1 mL of a mixture of chloroform and methanol (volume ratio of chloroform:methanol is 1:1) to the obtained precipitate, heat in a water bath at 37 °C for 40 min, centrifuge at 12,000 rpm for 10 min, discard the supernatant, and repeat the above steps of adding the mixture, water bath, and centrifugation once.

[0078] ⑥ Put the obtained precipitate into the fume hood to dry the precipitate to obtain pure cell wall alcohol-insoluble residue (AIR).

[0079] (2) Determination of lignin content:

[0080] ① Weigh 1.5 mg of the AIR sample obtained in (1) into a 2 mL centrifuge tube (leave 1 empty tube as a control).

[0081] ② Gently and slowly add 100 μL of freshly prepared acetyl bromide solution (25% v / v acetyl bromide / acetic acid) along the tube wall.

[0082] ③ Cover the lid of the centrifuge tube and place it in a water bath, react at 50 °C for 2 h.

[0083] ④ Continue heating and reacting for 1 h, shake and mix evenly every 15 min in the middle.

[0084] ⑤ The reacted material was cooled on ice to room temperature.

[0085] ⑥ 400 μL of 2 M NaOH and 70 μL of freshly prepared 0.5 M hydroxylamine hydrochloride were added to the cooled reaction sample, and vortexed thoroughly.

[0086] ⑦ The reacted sample was transferred to a 10 mL centrifuge tube, and glacial acetic acid was added to make up to 2 mL, and mixed well.

[0087] ⑧ 200 μL of the reacted solution was pipetted into an ELISA plate, and the absorbance value at 280 nm was measured. The lignin content was calculated according to the following formula:

[0088] Acetyl bromide soluble lignin (%ABSC) = abs(absorbance value) / coeff(coefficient) × 0.1 cm × 2 mL × 100% / weight (unit: mg).

[0089] The results are shown in Figure 4 。

[0090] (III) Determination of total cellulose content:

[0091] ① 2 mg of the AIR sample obtained in step (I) was weighed into a glass tube, and 0.5 mL of 2 M trifluoroacetic acid (TFA) was slowly added along the wall. The reaction was carried out in a metal bath at 121 °C for 90 min to dissolve hemicellulose.

[0092] ② The reacted sample was cooled to room temperature and centrifuged at 5000 g for 5 min, and the supernatant was carefully removed.

[0093] ③ 800 μL of ultrapure water was added to the obtained precipitate to wash the precipitate, and centrifuged at 5000 g for 5 min. The supernatant was carefully removed, and the operation of adding ultrapure water and centrifuging was repeated once.

[0094] ④ The supernatant was aspirated completely, and 200 μL of 72% sulfuric acid was added and reacted at room temperature for 30 min to dissolve the cellulose in the precipitate.

[0095] ⑤ 800 μL of ultrapure water was added to the reacted sample, and centrifuged at 12000 rpm for 5 min. 500 μL of the supernatant was taken for standby.

[0096] ⑥ Preparation of glucose standard curve: Weigh 1 mg of glucose standard sample and dissolve it in 1 mL of ultrapure water to prepare a stock solution. Dilute it into solutions of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1 mg / mL respectively. Add 150 μL of phenol (5%) and mix well, and then add 750 μL of sulfuric acid (98%) and mix well. Measure the absorbance values of the above solutions at 490 nm, and prepare a glucose standard curve according to the diluted solution concentration and the corresponding absorbance values, as Figure 5The standard curve shown

[0097] ⑦ Take the supernatant obtained in step ⑤, add 150 μL of phenol (5%) and mix well, then add 750 μL of sulfuric acid (98%) and mix well.

[0098] ⑧ Pipette an equal amount of the mixture obtained in step ⑦, add it to an ELISA plate, and measure the absorbance value at 490 nm. According to the glucose standard curve drawn in step ⑥, calculate the glucose content in the sample, which is the cellulose content.

[0099] The results are as Figure 4 shown. The lignin content of the transgenic plants is slightly higher than that of the wild-type plants, but the cellulose content is significantly higher than that of the wild-type plants, indicating that the transgenic plants with the PdDA1 gene knocked out can slightly increase the lignin content of the plants and significantly increase the cellulose content of poplar.

[0100] (IV) Detection of total sugar release

[0101] a. Extraction of total sugar, the method is as follows:

[0102] ① Accurately weigh 100 mg of the prepared AIR sample and transfer it to a 10 mL quartz centrifuge tube;

[0103] ② Add 1.5 mL of 72% H 2 SO 4 to the centrifuge tube, incubate in a water bath at 30 °C for 1 h, and shake well every 10 min during this period to make the sample evenly mixed;

[0104] ③ Transfer all the above materials to a 50 mL glass bottle and add 42 mL of ultrapure water;

[0105] ④ Autoclave at 121 °C for 1 h, and then cool to room temperature;

[0106] ⑤ Transfer the above materials to a new 50 mL test tube, wash the glass bottle with 10 mL of ultrapure water, and combine them in the 50 mL test tube;

[0107] ⑥ Centrifuge at 4000 rpm for 30 min, take the supernatant as the total sugar solution, and store it in a -20 °C refrigerator.

[0108] b. Extraction of enzymatically released sugar

[0109] ① Weigh 100 mg of the prepared AIR sample and transfer it to a 15 mL test tube;

[0110] ② Add 2.5 mL of 1.5% H 2 SO 4 , autoclave at 121 °C for 1 h;

[0111] ③Centrifuge the glass tube, transfer the supernatant to a new 15 mL test tube, add 5 mL of ultrapure water to wash the precipitate, centrifuge and transfer the supernatant to a 15 mL centrifuge tube. The supernatant collected twice is the sugar solution released by enzymatic hydrolysis after acid pretreatment;

[0112] ④Centrifuge the above test tube at 4000 rpm, and the supernatant is the sugar solution released by enzymatic hydrolysis after acid pretreatment, which is stored in a refrigerator at -20 °C;

[0113] ⑤Resuspend the precipitate with ultrapure water, transfer it to a new 15 mL centrifuge tube, continue to add water to the old precipitate tube until all the precipitate is transferred to the new 15 mL centrifuge tube. Centrifuge to remove the supernatant, and then wash the residue with citrate solution 2 - 3 times until the pH = 4.8;

[0114] ⑥Centrifuge the solution to remove the supernatant. Add 10 mL of enzyme digestion solution to a 15 mL sealed tube and mix well (enzyme digestion solution formula: 8.8 mL of 0.1 M, pH = 4.8 sodium citrate buffer + 0.2 mL of 2% NaN 3 + 1 mL of cellulase);

[0115] ⑦After mixing well, incubate at 50 °C and 100 rpm for 72 h, then centrifuge at 4000 rpm for 10 min. Transfer the supernatant and combine it with the sugar solution released by enzymatic hydrolysis after acid pretreatment obtained in step ④ to obtain the total sugar solution released by enzymatic hydrolysis after acid pretreatment.

[0116] c. Detection of sugar content by phenol - sulfuric acid method

[0117] ①Standard curve: Weigh 1 mg of glucose standard sample, dissolve it in 1 mL of ultrapure water to prepare the mother solution. Dilute it into solutions with concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1 mg / mL respectively. Add 150 μL of 5% phenol and 750 μL of concentrated sulfuric acid to each solution for mixing. Then incubate the mixed solution in a water bath at 30 °C for 30 min, measure the absorbance at 490 nm using a spectrophotometer, and then prepare the standard curve;

[0118] ②Take 100 μL of the total sugar solution prepared in a and 100 μL of the sugar solution released by enzymatic hydrolysis after acid pretreatment prepared in b respectively, add 150 μL of 5% phenol and 750 μL of concentrated sulfuric acid to each for mixing. Then incubate the mixed solution in a water bath at 30 °C for 30 min, and measure the absorbance at 490 nm using a spectrophotometer;

[0119] ③Record the measured total sugar content as S1 and the sugar released by enzymatic hydrolysis after acid pretreatment as S2. Calculate the sugar release efficiency under enzymatic hydrolysis conditions by S2 / S1.

[0120] The results are as Figure 6As shown, after enzymatic hydrolysis treatment, the sugar release amount of DA1-CR was significantly higher than that of the WT wild type, indicating that the PdDA1 gene can significantly improve the saccharification efficiency of forest tree wood.

[0121] (V) Stem dry weight detection, the method is as follows:

[0122] ① Take wild-type and DA1-CR transgenic poplars that have grown in the greenhouse for 60 days and are in good growth condition as experimental materials, and cut 20 internode stems (counting from top to bottom) as sample materials;

[0123] ② After removing the branches, leaves and bark from the sample materials, dry them to a constant weight at (102 ± 3) °C as the sample dry weight.

[0124] The results are as Figure 7 shown. The transgenic plants with the PdDA1 gene knocked out had a biomass about 36% higher than that of the wild type, indicating that the PdDA1 gene can significantly increase the biomass of poplar wood.

[0125] Therefore, in the application of the PdDA1 gene in improving the biological yield of poplar and changing cell components, knocking out the PdDA1 gene can significantly increase the growth rate of the plant height and ground diameter and the stem dry weight of poplar; it can significantly increase its cellulose content without affecting the lignin content of poplar, and can be used for the directional cultivation of poplar varieties with high cellulose content; it can significantly increase the total sugar release amount of poplar; the transgenic poplar with the PdDA1 gene knocked out has great application prospects in the fields of textile, papermaking, and polymer material preparation.

[0126] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that: they can still modify or equivalently replace the technical solutions of the present invention, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. PdDA1 The application of genes in changing poplar cell components is characterized by: PdDA1 The CDS sequence of the gene is shown in SEQ ID NO.1 and SEQ ID NO.2, and the application is to knock out PdDA1 The gene is used to change the poplar cell components; the change of the poplar cell components refers to increasing the cellulose content and the total sugar release.

2. PdDA1 The application of the gene in the breeding of poplar varieties with high cellulose content and total sugar release is characterized by: Knock out the PdDA1 Genes improve poplar cellulose content and total sugar release; PdDA1 The CDS sequences of the genes are shown in SEQ ID NO.1 and SEQ ID NO.2.