Application of TOX as a marker for regulating adhesion and proliferation of head and neck squamous cell carcinoma cells

Abstract

The present invention discloses an application of TOX as a marker for regulating adhesion and proliferation of head and neck squamous cell carcinoma cells, belonging to the field of molecular biology technology. Also disclosed is a preparation for regulating adhesion between head and neck squamous cell carcinoma cells, the preparation comprising a TOX inhibitor or a mimetic or analog with TOX biological activity. Through experiments, it was found that the TOX gene regulates the ability of adhesion and proliferation between head and neck squamous cell carcinoma cells through the TGF-β signaling pathway, providing a theoretical basis for the research on the biological characteristics of head and neck squamous cell carcinoma and its clinical and medical applications.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to the application of TOX as a marker for regulating adhesion and proliferation of head and neck squamous cell carcinoma cells. Background Art

[0002] Head and neck squamous cell carcinoma is a heterogeneous epithelial tumor that is more common in men and ranks sixth in cancer mortality worldwide. Despite the continuous improvement of diagnostic methods and treatment methods in recent decades, the overall 5-year survival rate of patients with head and neck squamous cell carcinoma (HNSCC) has remained at around 60%. Especially in patients with stage III and IV HNSCC, the 5-year survival rate is less than 50%, and there has been no significant improvement in the past few decades. Rapid progression, recurrence and metastasis caused by tumor gene mutations and cancer cells escaping immune clearance are the main reasons for the low survival rate of HNSCC patients. Therefore, we can start from in-depth research on the molecular mechanisms of the occurrence, development, proliferation and intercellular adhesion communication of head and neck squamous cell carcinoma to design diagnosis and treatment plans that are beneficial to improving the survival rate of patients with head and neck squamous cell carcinoma, but there are currently no research results in this regard.

[0003] The TOX gene (thymocyte selection associated high mobility group box), also known as TOX1, encodes a protein containing an HMG box DNA binding domain, which is involved in chromatin assembly, transcription and replication, and plays a role in regulating T cell development. TOX was originally identified as an important regulatory molecule that directly or indirectly regulates thymocyte selection. TOX is a key factor in T cell exhaustion and is crucial in T cell exhaustion and immune failure. TOX-induced exhaustion of T cells and immune attenuation promote the occurrence and development of tumors.

[0004] EMT is a well-recognized form of cellular plasticity that confers invasiveness to tumor cells and alters their sensitivity to various drugs, thus posing a major challenge to cancer therapy. EMT is often associated with changes in gene transcription mediated by “EMT transcription factors” (EMT-TFs), including members of the Snail, Twist, and Zeb families of DNA-binding proteins. In response to extracellular signals such as TGF-β or WNT, EMT-TFs repress epithelial-related genes such as adhesion and tight junction components and induce mesenchymal-related genes such as intermediate filament proteins and matrix components. E-cadherin is an important member of the cadherin family. As a transmembrane protein involved in adhesion and connection, it is a major component of the epithelial phenotype of various cells, including tumor cells. Loss of E-cadherin expression is closely associated with tumor metastasis and progression. Rescuing the expression of E-cadherin in cancer cells can make it a tumor suppressor factor and prevent tumor progression. E-cadherin is an important mediator of cell-to-cell adhesion and the exchange of substances and signals.

[0005] The transforming growth factor (TGF-β1) signaling axis is involved in a variety of cellular biological functions, including cell adhesion and cell proliferation. TGF-β1 can induce the proliferation of fibroblasts and reduce the accumulation of intercellular adhesion matrix. TGF-β1 inhibitors can inhibit the E-cadherin-dependent epithelial-mesenchymal transition process. Summary of the invention

[0006] The purpose of the present invention is to provide an application of TOX as a marker for regulating adhesion and proliferation between head and neck squamous cell carcinoma cells, so as to solve the problem raised in the background art that there is currently no in-depth study of the molecular mechanism of the occurrence, development, proliferation and intercellular adhesion communication of head and neck squamous cell carcinoma, and no design of diagnosis and treatment related programs that are beneficial to improving the survival rate of head and neck squamous cell carcinoma patients.

[0007] To achieve the above object, the present invention provides an application of TOX as a marker for regulating adhesion and proliferation of head and neck squamous cell carcinoma cells.

[0008] In a specific embodiment, the TOX gene regulates tumor cell adhesion via the TGF-β signaling pathway.

[0009] In a specific embodiment, by knocking down the TOX gene, the expression of the key adhesion molecule E-cadherin is significantly downregulated and the expression of the cytokine - transforming growth factor TGF-β is significantly upregulated, thereby promoting the adhesion and proliferation ability of head and neck squamous cell carcinoma cells.

[0010] In a specific embodiment, the TOX gene is affected by a TOX inhibitor or a TOX promoter, thereby affecting the TGF-β signaling pathway.

[0011] In a specific embodiment, the TOX inhibitor includes siRNA, dsRNA, shRNA, miRNA, sgRNA and antisense nucleotides that can reduce the expression amount of TOX, and constructs that can express or form the siRNA, dsRNA, shRNA, miRNA and antisense nucleotides that can reduce the expression amount of TOX.

[0012] In a specific embodiment, the TOX promoter is a mimetic or analog having TOX biological activity.

[0013] The present invention also provides a preparation for regulating adhesion between head and neck squamous cell carcinoma cells, wherein the preparation comprises a TOX inhibitor or a mimetic or analog having TOX biological activity.

[0014] In a specific embodiment, the TOX inhibitor is a TOX sgRNA having a nucleotide sequence as shown in SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.3.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] Through experiments, it was found that the TOX gene regulates the adhesion and proliferation of head and neck squamous cell carcinoma cells through the TGF-β signaling pathway, providing a theoretical basis for the study of the biological characteristics of head and neck squamous cell carcinoma and its clinical and medical applications; therefore, TOX can be used to prepare products that regulate the adhesion and proliferation of tumor cells, such as the adhesion molecule E-cadherin or inhibitors or promoters of cell proliferation.

[0017] The present invention successfully and rapidly established a stable TOX gene knockdown efficiency for head and neck squamous cell carcinoma cells, and confirmed the obvious difference in the expression levels of key adhesion molecules and transforming growth factor in the head and neck squamous cell carcinoma cells after knockdown through cell proliferation experiments.

[0018] In addition to the above-described purposes, features and advantages, the present invention has other purposes, features and advantages. The present invention will be further described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The drawings constituting a part of this application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0020] Figure 1 is the expression level of TOX in different head and neck squamous cell carcinoma cell lines;

[0021] Figure 2The expression and distribution of TOX in tissue specimens of head and neck squamous cell carcinoma patients, as well as local magnified comparison images;

[0022] Figure 3 is the vector map of sgRNA;

[0023] Figure 4 It is the target location map of sgRNA;

[0024] Figure 5 This is a comparison of TOX gene expression in parental CAL27 and CAL27 cells after TOX gene knockdown;

[0025] Figure 6 Comparison of E-cadherin gene expression between parental CAL27 control (TOX-vector) and TOX gene knockdown cells;

[0026] Figure 7 This is a comparison of the protein expression levels of transforming growth factor TGF-β in wild-type and TOX gene knockdown tumor cells;

[0027] Figure 8 CCK8 proliferation curves of control group and TOX gene knockdown tumor cells;

[0028] Fig. 9 The figure shows the clone formation results of the control group and TOX gene knockdown tumor cells. DETAILED DESCRIPTION

[0029] The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] The present invention provides an application of TOX as a marker for regulating adhesion and proliferation of head and neck squamous cell carcinoma cells.

[0031] TOX gene regulates tumor cell adhesion through TGF-β signaling pathway.

[0032] By knocking down the TOX gene, the expression of the key adhesion molecule E-cadherin was significantly downregulated and the expression of the cytokine - transforming growth factor TGF-β was significantly upregulated, thereby promoting the adhesion and proliferation ability of head and neck squamous cell carcinoma cells.

[0033] TOX inhibitors or TOX promoters affect the TOX gene, thereby affecting the TGF-β signaling pathway.

[0034] The TOX inhibitors include siRNA, dsRNA, shRNA, miRNA, sgRNA and antisense nucleotides that can reduce the expression amount of TOX, and constructs that can express or form the siRNA, dsRNA, shRNA, miRNA and antisense nucleotides that can reduce the expression amount of TOX.

[0035] The TOX promoter is a mimetic or analog having TOX biological activity.

[0036] The present invention also provides a preparation for regulating adhesion between head and neck squamous cell carcinoma cells, wherein the preparation comprises a TOX inhibitor or a mimetic or analog having TOX biological activity.

[0037] The TOX inhibitor is a TOX sgRNA having a nucleotide sequence as shown in SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.3.

[0038] Application of TOX as a marker in the preparation of products regulating adhesion and proliferation of head and neck squamous cell carcinoma cells.

[0039] Example 1

[0040] The expression of TOX in head and neck squamous cell carcinoma cell lines and its expression distribution in tissue specimens of head and neck squamous cell carcinoma patients.

[0041] Precancerous lesion cells DOK and head and neck squamous cell carcinoma cells Tu686, Cal27, SAS, SCC4, Fadu1, Fadu2, HN8, D562, JHU011, MEER and 6-10B were cultured respectively. When the cell confluence reached 80-90%, the supernatant was discarded, the cells were washed twice with pre-cooled PBS, the washing solution was aspirated, and the cells were lysed with 100ul cell lysis buffer and lysed on a shaker on ice for 10 minutes. The total protein was extracted and Western blot was performed to detect the expression difference of TOX in different head and neck squamous cell carcinoma cells. Figure 1 is the expression level of TOX in different head and neck squamous cell carcinoma cell lines. The specific experimental steps are as follows:

[0042] 1. Total protein extraction

[0043] (1) Discard the cell culture medium, add pre-cooled 1× PBS to rinse 2 to 3 times, aspirate dry PBS, try to remove any residue, add an appropriate amount of cell lysis buffer according to the size of the culture dish, and then place on an orbital shaker on ice for lysis;

[0044] (2) After lysis on ice for 30 min, scrape the adherent cells thoroughly with a cell scraper, transfer them to a 1.5 ml centrifuge tube with a 200 μl pipette, and then disrupt them in an ultrasonic cell disruptor for 5 to 10 s until the viscous lysate becomes clear;

[0045] (3) Centrifuge at 1200 g for 5 min at 4°C in a small tabletop refrigerated centrifuge. After centrifugation, aspirate the supernatant into a new 1.5 ml centrifuge tube and store in a -80°C refrigerator for later use.

[0046] 2. Protein concentration determination

[0047] (1) Dilute the standard protein sample BSA according to its concentration (2 mg / ml) for use in drawing a standard curve;

[0048] (2) Thaw the protein sample to be tested at room temperature. After it is completely thawed, mix it thoroughly on a vortex shaker and dilute the protein 5 times with 1× PBS, i.e., add 5 μl of protein to 20 μl of PBS to make the total volume 25 μl;

[0049] (3) Prepare BCA working solution: According to the microplate method, add 200 μl of working solution to each well. Set up 3 replicate wells for each standard sample and test sample. Calculate the required working solution volume according to the formula (number of standard proteins + number of test samples) * 3 * 200. Then take out reagent A solution and B solution and mix them in a ratio of 50:1 to form the working solution.

[0050] (3) Add 25 μl of diluted standard protein and test protein sample to each well of a 96-well plate, then add 200 μl of the pre-prepared BCA working solution to each well and incubate in a 37°C thermostat for 30 min.

[0051] (4) After the incubation is completed, the wavelength of the multifunctional microplate reader is set to 562 nm and the absorbance value (OD value) is detected;

[0052] (5) Draw a standard curve based on the standard protein concentration and the corresponding OD value. The R2 of the standard curve should preferably be greater than 0.99. Then calculate the concentration of the protein to be tested based on the obtained standard curve formula.

[0053] 3. Protein sample denaturation

[0054] Mix the target protein and 5× loading buffer in a 100 μl centrifuge tube or an eight-tube strip at a ratio of 4:1. After mixing, place the mixture in a PCR instrument and denature at 99°C for 10 min. After cooling to room temperature, use it directly or store it in a -20°C refrigerator.

[0055] 4. Preparation of SDS-PAGE gel

[0056] (1) Use the Bio-Tech gel preparation kit to prepare SDS-PAGE gel. The separation gel concentration used in this experiment is 10%, and the stacking gel concentration is 5%. Both the separation gel and the stacking gel are prepared according to the instructions:

[0057] (2) Use a detergent and a brush to carefully clean the glass plates, including thick and thin plates, rinse with clean water, and then dry naturally or place in an oven at 60°C to dry;

[0058] (3) After drying, align the thick plate and the thin plate and assemble them tightly, and assemble them to the glue clamp and glue pouring rack to ensure that the glass plate is clamped;

[0059] (4) Prepare 10% separation gel according to the instructions and mix well. Slowly add liquid along one edge of the glass plate, be gentle and avoid bubbles. When the liquid level reaches an appropriate height, stop adding separation gel and replace it with double distilled water to fill it up to the highest point of the glass plate to isolate the air and flatten the surface of the separation gel. Leave it at room temperature for 30 minutes to 1 hour to wait for the separation gel to completely solidify. At the same time, observe whether the liquid level drops. If it drops, it means the separation gel is leaking.

[0060] (5) Observe whether there is a clear dividing line between the double distilled water and the separation gel. If a dividing line can be seen, it means that the separation gel has solidified. Then, tilt the gel-filling rack to discard the double distilled water and use filter paper to absorb the remaining double distilled water;

[0061] (6) Prepare 5% concentrated gel according to the instructions, and add concentrated gel along the edge of the glass plate to the highest point of the glass plate. Insert a 15-hole comb into the concentrated gel, and move as slowly and gently as possible to avoid bubbles. Let it stand at room temperature for 20-30 minutes to wait for the concentrated gel to solidify. After the concentrated gel is completely solidified, electrophoresis can be performed. If you do not plan to perform electrophoresis immediately, place the glass plate with the prepared gel in a container filled with double distilled water, with the water surface as low as possible above the top of the gel, and then store it in a 4°C refrigerator for later use. It can generally be stored for one week.

[0062] 5. Electrophoresis and membrane transfer

[0063] (1) Prepare electrophoresis solution and transfer solution by mixing Trizmabase, Glycine, SDS, methanol and double distilled water in appropriate proportions. Store the electrophoresis solution at room temperature for future use, and pre-cool the transfer solution at 4°C;

[0064] (2) Assemble the electrophoresis gel plate with the thin glass plate facing inward and the thick glass plate facing outward, and make sure to tighten it as much as possible to avoid leakage; place it in the electrophoresis tank in the direction corresponding to the electrodes, add an appropriate amount of electrophoresis liquid, and fill the tank as much as possible. It is best to keep the liquid level inside and outside the gel plate consistent to avoid leakage and uneven bands; slowly pull out the comb to prevent deformation of the sample lane;

[0065] (3) Calculate the loading volume of the protein to be tested based on the concentration of the protein to be tested and the total protein loading volume of 30 μg. According to the size of the loading lane (15 wells), the loading volume of the protein to be tested should not exceed 20 μl;

[0066] (4) When loading the sample, first add 3 to 4 μl of pre-stained protein marker to the lanes at both ends of the protein to be tested, and then load the sample in the order of loading. After loading the sample, connect the power supply, cover the electrophoresis instrument cover, ensure that the electrodes are in good contact, set the initial voltage to 80V, observe the separation of the protein marker staining band after 30 minutes of electrophoresis and increase the voltage to 120V. When the bromophenol blue indicator band runs to the bottom of the separation gel, end the electrophoresis, take out the gel glass plate and soak it in the pre-cooled transfer solution;

[0067] (5) Cut the PVDF membrane and filter paper of appropriate size to fully cover the gel, soak the PVDF membrane in methanol for 1 min, and soak the filter paper to make it completely wet; open the transfer clip, place it in a container filled with pre-cooled transfer solution, and lay the filter paper, gel and PVDF membrane in order, patiently remove the bubbles and close the transfer clip; then insert the transfer clip into the transfer tank in the correct direction, place two ice bags in the electrophoresis tank and pour in an appropriate amount of transfer solution, place it on ice and start transferring, set the program to a constant current of 200mA, and pay attention to the voltage of about 70-90mV, and the transfer time of 90min.

[0068] 6. Milk or BSA blocking

[0069] (1) Prepare 5% skim milk or BSA. Add 2.5 g milk powder / BSA to 50 ml PBST or TBST and mix thoroughly on a shaker to completely dissolve the milk or BSA.

[0070] (2) Immerse the PVDF membrane completely in the blocking solution and block it at room temperature for 1 hour.

[0071] 7. Antibody incubation

[0072] (1) Use antibody diluent to prepare primary and secondary antibodies of appropriate concentrations: primary antibody: TOX (1:200, rabbit anti-human, molecular weight: 68KDa), GAPDH (1:10000, mouse anti-human, molecular weight: 37KDa), secondary antibody: HRP-conjugated goat anti-mouse IgG and goat anti-rabbit IgG (1:2500). Store the prepared primary and secondary antibodies in a -20℃ refrigerator for later use.

[0073] (2) Take out the blocked PVDF membrane, cut the appropriate PVDF membrane according to the marker staining band and the molecular weight of the target protein, pay attention to distinguish the front and back sides, and then put it into the antibody incubation box containing the corresponding primary antibody, and incubate it on a shaker at 4°C overnight for 10-12 hours.

[0074] (3) The next day, remove the antibody incubation box, warm it up at room temperature for 30 minutes, and then place it in a container containing an appropriate amount of PBST and wash it 4 times, 15 minutes each time. Then incubate with secondary antibodies for 1 hour, and then wash it 3-5 times with PBST.

[0075] 8. Chemiluminescence

[0076] (1) Prepare an appropriate amount of luminescent working solution in a ratio of 1:1 between solution A and solution B and mix well;

[0077] (2) Use tweezers to pick up the washed PVDF membrane, use filter paper to absorb the liquid on the membrane, place it on the luminescent plate of the luminescence instrument, and drip the luminescent working solution on the surface of the membrane to evenly cover it; set the instrument parameters to expose it for imaging, and after imaging, select the required picture to save and copy.

[0078] Tissue specimens from patients with head and neck squamous cell carcinoma were selected and made into paraffin sections. Immunohistochemistry experiments were performed to detect the expression and distribution of TOX in the specimens of patients with head and neck squamous cell carcinoma. Figure 2 The expression and distribution of TOX in tissue specimens of head and neck squamous cell carcinoma patients. The specific experimental operation steps are as follows: Material preparation: goat serum working solution, hematoxylin staining solution, DAB color developing solution, ddH2O, TOX primary antibody, universal two-step kit, 75% ethanol, 90% ethanol, anhydrous ethanol, xylene, 1X citrate buffer, 1XPBST, 1X PBS neutral resin, cover glass, wet box, enzyme-free Tip head and corresponding pipette.

[0079] Specific steps:

[0080] (1) Place the paraffin sections in a 60°C constant temperature oven and bake overnight;

[0081] (2) Soak the slices and the slice grill in xylene I for 20 min, remove and drain, transfer to xylene II and soak again for 20 min, remove and drain;

[0082] (3) Rehydrate in a gradient of anhydrous ethanol, 90% ethanol, and 75% ethanol, remove and drain, add 1X PBS, place on a shaker and wash for 5 min, repeat washing three times;

[0083] (4) Place the slices and the baking rack in citrate buffer and keep boiling in a microwave for 12 minutes. Take them out and let them cool at room temperature. After cooling to room temperature, add 1X PBS and wash the slices three times on a shaker.

[0084] (5) Spread the slices flat in a humidified chamber, drop endogenous peroxidase blocker on the slices to completely cover the tissue, incubate at room temperature in the dark for 20 min, discard excess liquid, add 1X PBS, place on a shaker, and wash three times;

[0085] (6) Add goat serum working solution until the tissue is covered, incubate at 25°C in the dark for 25 min, discard the excess liquid, add 1X PBS, place on a shaker and wash the slides for 5 min, repeat the washing three times;

[0086] (7) Drop the primary antibody diluted 1:200 on the slice and completely cover the tissue. Place it in a cold room at 4°C and incubate it in the dark overnight. The next day, warm it up at room temperature for 1 hour. Discard the excess liquid, add 1X PBS, place it on a shaker, and wash it three times.

[0087] (8) Add the enhanced enzyme-labeled goat anti-mouse / rabbit IgG polymer dropwise onto the tissue, incubate at room temperature in the dark for 20 min, discard the excess liquid, add 1X PBS, wash the slides on a shaker for 5 min, and repeat the washing three times;

[0088] (9) Add DAB color developing solution to the tissue. After color development is complete, add ddH2O to rinse until the reaction is terminated.

[0089] (10) Fix the slices on a baking rack and dehydrate them in a gradient of 75% ethanol, 95% ethanol, and anhydrous ethanol. Then, soak the slices and the baking rack in xylene II and xylene I for 4 min respectively, take them out, drain them, and dry them at 60°C for 8 min.

[0090] (11) Add an appropriate amount of neutral resin to the slice and place a coverslip on it. Be careful to avoid bubbles during the operation. Allow it to dry naturally and observe and record the results under a microscope.

[0091] Example 2

[0092] TOX gene knockdown and differential expression of key cell adhesion molecules in CAL27 head and neck squamous cell carcinoma cells.

[0093] The 293T cells were revived and cultured in a 6 cm dish in a complete medium of DMEM + 10% fetal bovine serum (FBS). After the cell density in each 6 cm dish reached 80%-90%, it was replaced with 3 ml of low serum medium of DMEM + 5% fetal bovine serum (FBS). The TOX plasmid lentivirus was infected. The TOX sgRNA gene sequences used for infection were: SEQ ID NO: 1 (GCAGGGAGAAGGTCCCAGAC), SEQ ID NO: 2 (TCACCTTGTTGCAATAGTAG), SEQ ID NO: 3 (GGCTGGCTGGCACATAGTCC). The cell medium was changed before transfection. Figure 3The vector map of sgRNA and the target position of sgRNA. The infection system is: 500ul opti-MEM+5ug sgRNA+4ugPXPAX2+3ug PMD2G+1.5*(5+4+3)PEI. The above infection system is slowly mixed, allowed to stand at room temperature for 15 minutes, and then added dropwise to the above 293T cells; the medium is replaced after 12-16 hours with 4ml of fresh DMEM+5% fetal bovine serum (FBS) low serum medium, the cell supernatant is collected after infection for 48 hours, centrifuged at room temperature for 10 minutes at 2000g, and stored at -80℃ after aliquoting. CAL27 cells were revived and cultured in a 6 cm dish with 4 ml DMEM + 10% fetal bovine serum (FBS) complete medium. After the cell confluence reached 80%-90%, they were digested with 0.125% trypsin and subcultured to a 6-well plate. When the cell confluence reached about 70%, the infection system was: 1 ml DMEM + 5% fetal bovine serum (FBS) low serum medium + 2 ml sgRNA plasmid virus liquid + 3ul polybrene catalyzing transfection reagent. The transfection time was 12 hours and then replaced with complete medium. The transfection reagent was prepared according to the above system, and after gently mixing, the transfection reagent was added to the 6-well plate. After mixing, it was placed in an incubator (37°C; 5% CO2) and cultured for 24 hours before changing to complete medium. After another 24 hours of culture, complete medium containing 2ug / ml puromycin was added. After the parental cells were completely killed, the cells that survived the transfection of the corresponding plasmid were digested with 0.125% trypsin and expanded.

[0094] Western blot was used to detect the TOX gene expression in the above-mentioned non-transfected normal CAL27 and TOX gene knockdown CAL27 transfected with TOX sgRNA gene. Compared with the parental CAL27, the TOX gene expression in the CAL27 cells after TOX gene knockdown was significantly reduced, with a significant difference; compared with the parental CAL27 control (TOX-vector), the E-cadherin gene expression in the TOX gene knockdown cells was significantly reduced, with a significant difference.

[0095] Example 3

[0096] Differential expression of transforming growth factor-β in wild-type and TOX gene knockdown tumor cells.

[0097] The cells from the parent group and transfection group of Example 2 above were collected, the supernatant was discarded, and the cells were washed twice with pre-cooled PBS, the washing solution was aspirated, and the cells were lysed with 100ul cell lysis solution, and the lysis was performed on a shaker on ice for 10 minutes to extract total protein. Western blot was performed to detect the expression difference of transforming growth factor β (TGF-β). Figure 5The protein expression level of transforming growth factor TGF-β in wild-type and TOX gene knockdown tumor cells. The specific experimental operation steps are as in Example 1, primary antibody: TGF-β (1:1000, rabbit anti-human, molecular weight: 58KDa).

[0098] Example 4

[0099] Altered proliferation ability of tumor cells with TOX gene knockdown.

[0100] The cells of the wild-type group and the TOX sgRNA transfection group in Example 2 above were revived and cultured in a 6 cm dish in a complete medium of DMEM + 10% fetal bovine serum (FBS). After the cell density in each 6 cm dish reached 80%-90%, the cells were digested with 0.125% trypsin, and the required number of cells were evenly seeded in a 96-well plate or a 6-well plate after counting. CCK8 cell proliferation assay and clone formation assay were performed to detect the proliferation ability of tumor cells after TOX gene knockdown. The specific operation steps are as follows:

[0101] 1. CCK8 cell proliferation assay

[0102] (1) Take cells with good growth status, digest them, count them and dilute them into 1×10 4 / ml single cell suspension. Add 100 μl to each well of a 96-well plate, with 5 replicates per group, and detect cell proliferation for 1 to 6 days;

[0103] (2) After the cells were plated, the 96-well plates of each group were taken out at various time points such as 24 h, 48 h, and 72 h, and CCK8 working solution was added to react for 2 h; then the plates were placed in a multifunctional microplate reader to detect the OD value at an absorption wavelength of 450 nm;

[0104] (3) Graphpad Prism 9 software was used to draw cell proliferation curves and perform statistical analysis to compare whether there were any differences in cell proliferation between the experimental groups and the control group.

[0105] 2. (1) Digest the target cells and dilute to 2×10 3 / ml single cell suspension;

[0106] (2) Take a new six-well plate and add 2 ml of culture medium containing 10% FBS to each well; set up three replicate wells for each group, and evenly add the diluted single-cell suspension to the six-well plate at a volume of 100 μl / well (i.e., 200 cells per well), shake well using the figure-8 method, and place in an incubator for culture;

[0107] (3) When cell colonies were visible to the naked eye in the six-well plate, the culture was stopped, 4% paraformaldehyde solution was added to each well for fixation for 20 min, and the wells were washed 2 to 3 times with PBS and dried;

[0108] (4) Add 0.1% crystal violet staining solution and stain for 20 min, then wash off the staining solution and let stand to dry;

[0109] (5) Place the six-well plate on a film viewing light and take a photo. Count the cell colonies and perform statistical analysis and drawing.

[0110] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions and substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. Application of TOX gene inhibitors in the preparation of drugs for inhibiting the adhesion and proliferation ability of head and neck squamous cell carcinoma cells.

2. The use according to claim 1, characterized in that: TOX gene regulates tumor cell adhesion through TGF-β signaling pathway.

3. The use according to claim 2, characterized in that: By knocking down the TOX gene, the expression of the key adhesion molecule E-cadherin was significantly downregulated and the expression of the cytokine - transforming growth factor TGF-β was significantly upregulated, thereby inhibiting the adhesion and proliferation ability of head and neck squamous cell carcinoma cells.

4. The use according to claim 1, characterized in that: The TOX gene inhibitor includes siRNA, dsRNA, shRNA, miRNA, sgRNA and antisense nucleotides that can reduce the expression amount of TOX, and constructs that can express or form the siRNA, dsRNA, shRNA, miRNA and antisense nucleotides that can reduce the expression amount of TOX gene.

Images