Mutation Sites of SUV420H1 and Its Application in Regulating Tumor Cell Proliferation

By performing site-directed mutations at the K219 and R220 sites of SUV420H1 protein, its binding power with H2A.Z protein is reduced, and the problem of unspecific inhibition of tumor cell proliferation in the prior art is solved, and specific inhibition of tumor cell proliferation and reduced content of H4K20me2 is achieved, which has clinical application potential.

CN118304406BActive Publication Date: 2025-08-01INSTITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211722388.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2025-08-01
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

The prior art is difficult to specifically inhibit the effects of the mutation sites of H2A.Z and SUV420H1 on DNA replication and cell growth, resulting in an unspecific inhibition of tumor cell proliferation and affecting other biological functions of the cells.

Method used

Site-directed mutations at the K219 and R220 sites of SUV420H1 protein reduce their binding power with H2A.Z protein, thereby inhibiting tumor cell proliferation, including the use of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA, antisense DNA, low-molecular compounds and antibodies for intervention.

Benefits of technology

It has achieved specific inhibition of tumor cell proliferation, reduced the content of H4K20me2 and reduced the impact on other cell functions, and has potential clinical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004028741230000011
    Figure HDA0004028741230000011
  • Figure HDA0004028741230000012
    Figure HDA0004028741230000012
  • Figure HDA0004028741230000021
    Figure HDA0004028741230000021
Patent Text Reader

Abstract

The present invention discloses the mutation sites of SUV420H1 and its application in regulating the proliferation of tumor cells. The present invention provides the application of a substance capable of simultaneously site-directed mutating the K219 and R220 sites of the SUV420H1 protein in an organism or cell in any one of the following: inhibiting the proliferation of tumor cells; treating tumors, inhibiting DNA replication in tumor cells; reducing the binding of the SUV420H1 protein and the H2A.Z protein or its nucleosome. The experiments of the present invention prove that the K219R220 site on the SUV420H1 protein, which can affect the binding to H2A.Z, and mutating the K219R220 site on the SUV420H1 protein can inhibit the proliferation of tumor cells, indicating that the K219R220 site on the SUV420H1 protein can be used as a target to study specific drugs for inhibiting the proliferation of tumor cells and has potential clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the mutation sites of SUV420H1 and their application in regulating the proliferation of tumor cells. Background Art

[0002] The formation of tumors is affected by genetic modification and epigenetic modification. For a long time, it has been believed that gene mutations are involved in the formation of tumors. In recent years, more and more evidence has shown that epigenetic modification also plays a very important role in tumor progression. Epigenetic regulation can affect gene transcriptional activity without involving changes in DNA sequence. Epigenetic pathways have played an important role in the development of many anti-tumor drug targets.

[0003] Current research has found that histone variant H2A.Z can establish locally enriched H4K20me2 modification on chromatin by directly binding to methyltransferase SUV420H1, thereby further recruiting ORC1 to help select the replication origin site on chromatin.

[0004] In many cancer cells, both histone variant H2A.Z and SUV420H1 have point mutations. For example, in breast cancer and prostate cancer, H2A.Z shows high expression. However, not all mutation sites on H2A.Z and SUV420H1 affect the regulation of DNA replication and cell growth. Only some of the functional sites play a key role in regulating DNA replication and cell growth. Moreover, H2A.Z and SUV420H1 also have significant effects in other biological processes, such as transcriptional development and autism. Therefore, it is necessary to find the specific interaction sites of H2A.Z and SUV420H1 to specifically affect DNA replication and cell growth without affecting other biological functions of cells.

[0005] All in all, finding the important functional sites of H2A.Z and SUV420H1 in regulating cell growth has potential clinical application value in specifically inhibiting the proliferation of tumor cells. Summary of the Invention

[0006] The object of the present invention is to provide the mutation sites of SUV420H1 and their application in regulating the proliferation of tumor cells.

[0007] In a first aspect, the present invention provides the application of a substance capable of simultaneously causing site-directed mutations at the K219 and R220 sites of the SUV420H1 protein in an organism or cell in any of the following:

[0008] (A1) Preparing a product for inhibiting the proliferation of tumor cells, or inhibiting the proliferation of tumor cells;

[0009] (A2) Preparing a product for treating tumors, or treating tumors;

[0010] (A3) To prepare a product for inhibiting DNA replication in tumor cells, or to inhibit DNA replication in tumor cells;

[0011] (A4) To prepare a product for inhibiting the binding of SUV420H1 protein and H2A.Z protein or their nucleosomes, or to inhibit the binding of SUV420H1 protein and H2A.Z protein or their nucleosomes;

[0012] (A5) To prepare a product for reducing the intracellular content of H4K20me2, or to reduce the intracellular content of H4K20me2.

[0013] In the above application, the site-directed mutation at the K219 site is the mutation of the 219th K of the SUV420H1 protein to A or E or Q;

[0014] The site-directed mutation at the R220 site is the mutation of the 220th R of the SUV420H1 protein to A or E or Q.

[0015] None of the above site-directed mutations will cause frameshift mutations.

[0016] In the embodiment of the present invention, taking the mutation of the 219th K of the SUV420H1 protein to A and the 220th R to A as an example, the substance can cause the 219th K of the SUV420H1 protein in the organism or cell to mutate to A and the 220th R to A, and the other amino acid residues of the SUV420H1 protein remain unchanged.

[0017] The above application reduces the binding to the 98th D and 99th S of the H2A.Z protein by site-directed mutation of K219 and R220 of the SUV420H1 protein in the organism or cell.

[0018] The above substance can be at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular compounds, peptides and antibodies, but is not limited thereto.

[0019] In the embodiment of the present invention, the substance includes the following:

[0020] (a1) sgR219R220F: 5’-caccGACAAAATAGAATTACTGGT-3’ sgR219R220 R: 5’-aaacACCAGTAATTCTATTTTGTC-3’ annealed to form sgRNA;

[0021] (a2) Amplification primers for homologous arms (R219R220-HAF: F: 5’-TTAACTTTCTCAATGTGGCTGC

[0022] -3'; R219R220-HAR: AAGAAACTCACACCTGAAGC);

[0023] (a3) Site-directed mutagenesis primer (R219R220-mutF: 5'-tttaaatagGgcAgcAAATGACAAAATAGAATTACTGGTGGGTTGTATTG-3'; R219R220-mutR: 5'-

[0024] TTTGTCATTTgcTgcCctatttaaaatatgtgatgtgttaaaaattactagtaattaaatatagtaaggctt-3').

[0025] In a second aspect, the present invention provides the use of the K219 and R220 sites of the SUV420H1 protein in the body or cells as targets in the development of any one of the following products:

[0026] (A1) Preparing a product for inhibiting the proliferation of tumor cells;

[0027] (A2) Preparing a product for treating tumors;

[0028] (A3) Preparing a product for inhibiting DNA replication in tumor cells;

[0029] (A4) Preparing a product for reducing the binding of the SUV420H1 protein and the H2A.Z protein or its nucleosome;

[0030] (A5) Preparing a product for reducing the intracellular content of H4K20me2.

[0031] In the above-mentioned applications,

[0032] the tumor is a tumor with high expression of H2A.Z or a tumor with high expression of SUV420H1;

[0033] the tumor cells are tumor cells with high expression of H2A.Z or tumor cells with high expression of SUV420H1.

[0034] Furthermore, the tumor with high expression of H2A.Z may be breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, glioma, melanoma, etc. The tumor cells with high expression of H2A.Z may be breast cancer cells, lung cancer cells, prostate cancer cells, colon cancer cells, bladder cancer cells, glioma cells, melanoma cells, etc.

[0035] The cells mentioned above are tumor cells, and the body is a tumor patient.

[0036] In a third aspect, the present invention provides a method for inhibiting the proliferation of tumor cells, which includes the following: simultaneously introducing site-directed mutations at K219 and R220 of the SUV420H1 protein in tumor cells.

[0037] In the method described above, the site-directed mutation at the K219 site is the mutation of the 219th K of the SUV420H1 protein to A or E or Q;

[0038] The site-directed mutation at the R220 site is the mutation of the 220th R of the SUV420H1 protein to A or E or Q.

[0039] In the method described above, the tumor is a tumor with high expression of H2A.Z or a tumor with high expression of SUV420H1;

[0040] The tumor cells are tumor cells with high expression of H2A.Z or tumor cells with high expression of SUVJ420H1.

[0041] In a fourth aspect, the present invention provides a method for inhibiting the binding of the SUV420H1 protein and the H2A.Z protein or its nucleosome, which is to simultaneously introduce site-directed mutations at the K219 and R220 sites of the SUV420H1 protein in an organism or cells.

[0042] In the method described above, the site-directed mutation at the K219 site is the mutation of the 219th K of the SUV420H1 protein to A or E or Q;

[0043] The site-directed mutation at the R220 site is the mutation of the 220th R of the SUV420H1 protein to A or E or Q.

[0044] In the method described above, the cells are tumor cells;

[0045] Further, the tumor cells are tumor cells with high expression of H2A.Z or tumor cells with high expression of SUV420H1.

[0046] The above method can be either a disease diagnosis and treatment method or a non-disease diagnosis and treatment method. As a non-disease diagnosis and treatment method, it can be for simply studying the proliferation of tumor cells or as a positive control when screening drugs that can inhibit the proliferation of tumor cells.

[0047] In each of the above aspects, the tumor cells can be tumor cells with high expression of H2A.Z or tumor cells with high expression of SUV420H1. The tumor can be a tumor with high expression of H2A.Z or a tumor with high expression of SUV420H1.

[0048] Further, the tumor cells with high expression of H2A.Z can be breast cancer cells, lung cancer cells, prostate cancer cells, colon cancer cells, bladder cancer cells, glioma cells, melanoma cells, etc. Further, the tumors with high expression of H2A.Z can be breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, glioma, melanoma, etc.

[0049] In a specific embodiment of the present invention, the tumor cells are exemplified by HeLa cells.

[0050] As mentioned above, K219 represents K at the 219th position of the SUV420H1 protein; R220 represents R at the 220th position of the SUV420H1 protein.

[0051] The experiments of the present invention demonstrate that the K219R220 site on the SUV420H1 protein can affect its binding to H2A.Z. Mutating the K219R220 site on the SUV420H1 protein can inhibit the proliferation of tumor cells, indicating that the K219R220 site on the SUV420H1 protein can be used as a target to study drugs for specifically inhibiting the proliferation of tumor cells, and has potential clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 It is an overall diagram of the structure of the H2A.Z nucleosome and the methyltransferase SUV420H1 complex.

[0053] Figure 2 It is the experimental result of the in vitro interaction between the D98S99 site of the H2A.Z nucleosome and SUV20H1 K219R220.

[0054] Figure 3 It is the experimental result of the influence of the SUV420H1K219AR220A point mutation on cancer cell proliferation and DNA replication; a is the gene editing and mRNA detection result of the SUV420H1K219AR220A point mutation cell line, b is the detection of the distribution of H4K20me2 in wild-type Hela cells and two point mutation cell lines respectively, c is the cell proliferation experiment, and d is the detection of the signals of activated replication initiation sites in wild-type Hela cells and two point mutation cell lines respectively. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0055] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0056] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0057] The amino acid sequence of the SUV420H1 protein involved in the following examples is shown in SEQ ID No.1;

[0058] The coding gene sequence of the SUV420H1 protein is shown in SEQ ID No.2.

[0059] Example 1. Discovery of the complex structure and sites of histone variant H2A.Z and methyltransferase SUV420H1

[0060] The structure of the complex of the nucleosome containing histone variant H2A.Z and methyltransferase SUV420H1 was analyzed by cryo-electron microscopy ( Figure 1 ), clearly clarifying the specific interaction sites between the two, and further discovering that these sites can significantly affect DNA replication and cell proliferation. At the same time, it was also found that these important interaction sites have high-frequency mutations in some cancer cells, indicating that these sites can be used as potential drug targets for treating cancer cell proliferation.

[0061] Through structural analysis, it was found that there are three binding interfaces between the H2A.Z nucleosome and methyltransferase SUV420H1. One binding interface affects the catalytic center of the enzyme, one binding interface exists on the DNA of the nucleosome without obvious specificity, and the binding interface H2A.Z D98S99 and SUV20H1 K219R220, which neither destroys the core catalytic region of the enzyme nor is the region where methyltransferase SUV420H1 specifically binds to the H2A.Z nucleosome. It was found that H2A.Z can regulate replication by binding to SUV420H1. Therefore, designing small molecule drugs targeting the SUV20H1 K219R220 site will have stronger specificity, enabling it to specifically affect DNA replication and cell growth without affecting other biological functions of cells. The structure of this complex was also analyzed for the first time, and the structural results have strong novelty.

[0062] Example 2. In vitro interaction detection of the SUV20H1 K219R220 site and the H2A.Z nucleosome D98S99 site

[0063] I. Assembly of octamers into nucleosomes

[0064] In vitro, nucleosomes were assembled with DNA containing the 601 core assembly sequence labeled with biotin and octamers of H2A, H2A.Z, H2A.ZD98NS99K, and H2AN95DK96S respectively. The specific method is as follows:

[0065] 1. pET3a-H2A plasmid

[0066] The recombinant plasmid obtained by inserting the H2A gene sequence (Gene ID: 8338, December 4, 2022) into the NdeI / BamHI position of the pet3a plasmid (sigma, 69418) was named pET3a-H2A plasmid after being verified correct by sequencing.

[0067] 2. pET3a-H2B plasmid

[0068] The recombinant plasmid obtained by inserting the H2B gene sequence (Gene ID: 8349, December 8, 2022) into the BpmI / BlpI position of the pet3a plasmid was named pET3a-H2B plasmid after being verified correct by sequencing.

[0069] 3. pET3a-H3 plasmid

[0070] The recombinant plasmid obtained by inserting the H3 gene sequence (Gene ID: 126961, December 8, 2022) into the NcoI / BlpI position of the pet3a plasmid was named pET3a-H3 plasmid after being verified correct by sequencing.

[0071] 4. pET3a-H4 plasmid

[0072] The recombinant plasmid obtained by inserting the H4 gene sequence (Gene ID: 8370, December 8, 2022) into the NdeI / BlpI position of the pet3a plasmid was named pET3a-H4 plasmid after being verified correct by sequencing.

[0073] 5. pET3a-H2A.Z plasmid

[0074] The recombinant plasmid obtained by inserting the H2A.Z gene sequence (Gene ID: 3015, December 4, 2022) into the NdeI / BamHI position of the pet3a plasmid was named pET3a-H2A.Z plasmid after being verified correct by sequencing.

[0075] 6. pET3a-H2A.ZD98NS99K plasmid

[0076] First, mutation primers were designed near the target site; then the mutation site was incorporated into the target plasmid by PCR.

[0077] Site-directed mutagenesis primer:

[0078] F: 5’-GAAGAATTGAACAAGCTCATCAAGGCTAC-3’;

[0079] R: 5’-CTTGATGAGCTTGTTCAATTCTTCATCTCCAC-3’.

[0080] Using the pET3a-H2A.Z plasmid obtained in step 5 as a template, PCR amplification was performed with the above site-directed mutagenesis primer. Then the PCR amplification product was purified and digested with DpnI. Finally, the digested product was transformed into Escherichia coli, and monoclonal colonies were picked for first-generation sequencing identification. The recombinant plasmid after being verified correctly by sequencing was named pET3a-H2A.ZD98NS99K plasmid.

[0081] The only difference between the pET3a-H2A.ZD98NS99K plasmid and the pET3a-H2A.Z plasmid is that the codon for D at the 98th position of the amino acid sequence of the H2A.Z gene-encoded protein was mutated to the codon for N, and the codon for S at the 99th position was mutated to the codon for K.

[0082] 7. pET3a-H2AN95DK96S plasmid

[0083] First, mutation primers were designed near the target site; then the mutation site was incorporated into the target plasmid by PCR.

[0084] Site-directed mutagenesis primer:

[0085] F: 5’-GACGAGGAGCTAGATTCTTTGCTGGGTAAAGTC-3’;

[0086] R: 5’-GACTTTACCCAGCAAAGAATCTAGCTCCTCGTCGTT-3’.

[0087] Using the pet3a-H2A plasmid obtained in step 1 as a template, PCR amplification was performed with the above site-directed mutagenesis primer. Then the PCR amplification product was purified and digested with DpnI. Finally, the digested product was transformed into Escherichia coli, and monoclonal colonies were picked for first-generation sequencing identification. The recombinant plasmid after being verified correctly by sequencing was named pET3a-H2AN95DK96S plasmid.

[0088] The only difference between the pET3a-H2AN95DK96S plasmid and the pet3a-H2A plasmid is that the codon for N at the 95th position of the amino acid sequence of the H2A gene-encoded protein was mutated to the codon for D, and the codon for K at the 96th position was mutated to the codon for S.

[0089] 5. pGEX-6P-1-SUV420H1 plasmid

[0090] The recombinant plasmid obtained by inserting the SUV420H1 gene sequence (Gene ID: 51111, 2022-12-21) into the BamHI / XhoI position of the pGEX-6P-1 plasmid (cytiva, 27-1542-01) was named pGEX-6P-1-SUV420H1 plasmid after being verified correct by sequencing.

[0091] 6. pGEX-6P-1-SUV420H1K219AR220A plasmid

[0092] First, design mutagenic primers near the target site; then incorporate the mutation site into the target plasmid by PCR.

[0093] Site-directed mutagenesis primers:

[0094] F: 5’-CAAAAGAGTGGGCAGCAAATGACAAAATAGAATTAC-3’;

[0095] R: 5’-ATTTTGTCATTTGCTGCCCACTCTTTTGTTGCAAC-3’

[0096] Using the pGEX-6P-1-SUV420H1 plasmid obtained in step 5 as a template, PCR amplification was performed with the above site-directed mutagenesis primers. Then, the PCR amplification product was purified and digested with DpnI. Finally, the digested product was transformed into Escherichia coli, and monoclonal colonies were picked for first-generation sequencing identification. The recombinant plasmid verified correct by sequencing was named pGEX-6P-1-SUV420H1K219AR220A plasmid.

[0097] The only difference between the pGEX-6P-1-SUV420H1K219AR220A plasmid and the pGEX-6P-1-SUV420H1 plasmid is that the codon for K at position 219 and the codon for R at position 220 in the amino acid sequence of the protein encoded by the SUV420H1 gene are mutated to the codon for A.

[0098] 7. Expression of recombinant protein

[0099] The above-mentioned plasmids pET3a-H2A, pET3a-H2B, pET3a-H3, pET3a-H4, pET3a-H2A.Z, pET3a-H2A.ZD98NS99K, and pET3a-H2AN95DK96S were separately transformed into BL21 competent cells. Single colonies were picked and cultured in a shaker until the OD value reached 0.5 - 0.6. Then, 0.5 mM IPTG was added for induction at 37 °C for 4 hours. The bacteria were harvested and the supernatant was discarded. The bacterial pellet was resuspended in Wash Buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM β-ME), sonicated until the bacterial solution was no longer viscous, the supernatant was discarded, and the precipitate was washed 3 times with Histone Wash Buffer containing 1% Triton-100 until the supernatant was no longer significantly yellow, and then washed once with Wash Buffer to remove the residual Triton-100. The inclusion body precipitate was dissolved in 30 ml of Unfolding Buffer (20 mM Tris-HCl pH 8.0, 7 M GdnHCl, 5 mM β-ME), centrifuged, and the supernatant was collected. Finally, 13 KD of H2A or H2AN95DK96S, 13 KD of H2B protein, 12 KD of H2A.Z or H2A.ZD98NS99K protein, 14 KD of H3 protein, and 11 KD of H4 protein were obtained.

[0100] The above-mentioned pGEX-6P-1-SUV420H1 and pGEX-6P-1-SUV420H1K219AR220A plasmids were respectively transformed into BL21 competent cells. Single colonies were picked and cultured in a shaker until the OD value reached 0.8 - 1.0. Then, 0.2 mM IPTG was added and induced at 16 °C for 12 hours. The bacteria were harvested and the supernatant was discarded. The bacterial pellet was resuspended in lysis Buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% glycerol, 5 mM β-ME) and sonicated until the bacterial solution was no longer viscous. After high-speed centrifugation, the supernatant was taken and incubated with GST beads (thermo, 16101) at 4 °C for 6 h. The GST beads were washed three times with lysis Buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% glycerol, 5 mM β-ME). Finally, the protein bound to the GST beads was eluted with elution buffer (20 mM Tris-HCl pH 8.0, 50 mM reduced glutathione, 10% glycerol, 5 mM β-ME), obtaining 125 KD GST-SUV420H1 (a fusion protein with a GST tag linked to the N-terminus of the SUV420H1 protein) and 125 KD GST-SUV420H1K219AR220A protein (a fusion protein with a GST tag linked to the N-terminus of the SUV420H1K219AR220A protein).

[0101] 8. Assemble octamers

[0102] The four proteins in each group of H2A / H2B / H3 / H4, H2AN95DK96S / H2B / H3 / H4, H2A.Z / H2B / H3 / H4, and H2A.ZD98NS99K / H2B / H3 / H4 obtained above were mixed in equimolar ratio, and the mixed histone mixture was dialyzed into TE (10 mM Tris, pH 8.0, 1 mM EDTA) + 2 M NaCl (pH 8.0) solution. At this time, the histones spontaneously assembled into octamers during dialysis. Finally, the dialyzed mixture was further purified using a molecular sieve Superdex 200 to obtain pure octamers: H2A / H2B / H3 / H4 assembled into an octamer (denoted as H2A octamer), H2AN95DK96S / H2B / H3 / H4 assembled into an octamer (denoted as H2AN95DK96S octamer), H2A.Z / H2B / H3 / H4 assembled into an octamer (denoted as H2A.Z octamer), and H2A.ZD98NS99K / H2B / H3 / H4 assembled into an octamer (denoted as H2A.ZD98NS99K octamer).

[0103] 9. Octamer assembly into nucleosome

[0104] PCR was performed using a biotin-labeled primer to obtain the DNA for assembling nucleosomes with biotin labeling. This DNA was incubated with H2A octamer, H2A.Z octamer, H2A.ZD98NS99K octamer, and H2AN95DK96S octamer respectively, and nucleosomes were assembled by the salt dialysis method.

[0105] Synthesize biotin-labeled DNA, and the PCR primers are:

[0106] F: 5’-biotin-TACCGAACGTTCGAACGATGATGCCGGAT-3’

[0107] R: 5’-TACGCGAATTCCAAGCGACACCGGCACT-3’

[0108] The DNA sequence for assembly is SEQ ID No.3:

[0109] AACGGGGGGCTAGCATGTGGCGGCCGCTCTAGAGATATCCCCGAGGGTCGAACCATGATGCCGGATCCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCACATATATACATCCTGTTCCAGTGCCGGTGTCGCTTGGGTCC

[0110] Using the DNA molecule shown in SEQ ID No.3 as a template, PCR amplification was performed with the above PCR primers F and R to obtain the DNA for assembly.

[0111] Assembly of nucleosomes by salt dialysis method: The DNA for assembly obtained above (solvent: 10 mM Tris, 1 mM EDTA, pH 8.0) and each octamer obtained above (solvent: 10 mM Tris, 1 mM EDTA, pH 8.0, 2 M NaCl) were mixed at an equimolar ratio and placed in a dialysis tube (millipore, 71504-3). Then the dialysis tube was placed in a TE (10 mM Tris, pH 8.0, 1 mM EDTA) + 2 M NaCl solution for incubation (temperature 4 °C, time 10 min). Subsequently, TE solution (10 mM Tris, 1 mM EDTA, pH 8.0) was gradually added to the TE (10 mM Tris, pH 8.0, 1 mM EDTA) + 2 M NaCl solution to gradually reduce the 2 M NaCl concentration in the incubation solution to 0.6 M NaCl. The solution in the dialysis tube was collected to obtain various biotin-labeled H2A nucleosomes, H2A.Z nucleosomes, H2A.ZD98NS99K nucleosomes, and H2AN95DK96S nucleosomes.

[0112] II. Detection of the interaction between nucleosomes and SUV420H1, SUV420H1K219AR220A

[0113] From the above-assembled nucleosomes, 1 μg of biotin-labeled nucleosomes was taken and incubated with 20 μl of streptavidin beads (thermo, 88817) in a 1 ml BC100 (10 mM Tris, pH 8.0, 100 mM KCl, 10% (volume percentage) glycerol) buffer system (temperature 4 °C, time 4 hours). At this time, the nucleosomes would bind to the beads. Then, 10 μg of SUV420H1 or SUV420H1K219AR220A protein was added to the buffer system respectively to obtain an incubation system containing streptavidin beads, biotin-labeled nucleosomes, and SUV420H1 / SUV420H1K219AR220A protein.

[0114] The above incubation system containing streptavidin beads, biotin-labeled nucleosomes, and SUV420H1 / SUV420H1K219AR220A protein was incubated at 4 °C overnight. Finally, the amounts of SUV420H1 and SUV420H1K219AR220A proteins bound to the beads were detected by western blot to detect the binding of nucleosomes to SUV420H1 and SUV420H1K219AR220A.

[0115] The results are asFigure 2 As shown in the figure, it can be seen that compared with the H2A.Z nucleosome, the H2A.ZD98NS99K nucleosome significantly disrupts the binding to the SUV420H1 protein. After mutating the corresponding NK region of H2A to DS, compared with H2A.ZD98NS99K, the binding of H2AN95DK96S to the SUV420H1 protein is enhanced; when SUV420H1K219R220 is mutated to AA, at this time, compared with the SUV420H1 protein, the binding ability of the H2A.Z nucleosome to the SUV420H1K219AR220A protein becomes weaker. Compared with the H2A.Z nucleosome, H2A.ZD98NS99K does not significantly reduce the binding to the SUV420H1K219AR220A protein. At the same time, compared with H2A.ZD98NS99K, H2AN95DK96S also does not enhance the binding to the SUV420H1K219AR220A protein.

[0116] The above results indicate that there is an obvious interaction between the D98S99 site of the H2A.Z nucleosome and the K219R220 site of SUV20H1. The point mutation K219AR220A in SUV420H1 reduces its binding ability to the H2A.Z nucleosome.

[0117] Example 3. Effects of SUV420H1K219AR220A on cancer cell proliferation and DNA replication.

[0118] I. Preparation of the point mutant cell line of SUV420H1K219AR220A

[0119] (1) First, design the Cas9 target sequence (sgR219R220F: 5’-caccGACAAAATAGAATTACTGGT-3’

[0120] sgR219R220 R: 5’-aaacACCAGTAATTCTATTTTGTC-3’) near the target site through the online tool of the Zhang Feng laboratory (http: / / crispr.mit.edu / ), and ligate sgR219R220 (formed by annealing sgR219R220F and sgR219R22R) into the px330 plasmid (Addgene 42230) according to the construction strategy of the pX330 plasmid (http: / / www.genome-engineering.org / crispr / ). After the obtained recombinant plasmid was verified to be correct by sequencing, it was named px330-sgR219-R220.

[0121] According to the genomic sequence provided on UCSC (GRCh38, 2013-12-17), amplification primers for homologous arms were designed upstream and downstream of the target site (R219R220-HAF: F: 5’-TTAACTTTCTCAATGTGGCTGC-3’;

[0122] R219R220-HAR: AAGAAACTCACACCTGAAGC), and the homologous arms near the target site were amplified.

[0123] (2) The above homologous arms were ligated to the donor plasmid vector pEASY-T1 (Transgene CT101), and then the homologous arm plasmid was obtained;

[0124] Then, using the homologous arm plasmid as a template, site-directed mutagenesis primers capable of introducing 2 mutations were used (R219R220-mutF: 5’-tttaaatagGgcAgcAAATGACAAAATAGAATTACTGGTGGGTTGTATTG-3’; R219R220-mutR: 5’-

[0125] TTTGTCATTTgcTgcCctatttaaaatatgtgatgtgttaaaaattactagtaattaaatatagtaaggctt-3’) for PCR to introduce site-directed mutations at the target site on the homologous arm, and a donor plasmid with 2 site-directed mutations was obtained.

[0126] Then, the donor plasmid with 2 site-directed mutations and px330-sgR219-sgR220 constructed in step (1) were co-transfected into HeLa cells. Genome breaks induced by CRISPR-Cas9 can increase the recombination efficiency, thus promoting the integration of the site-directed mutation fragment into the genome.

[0127] (3) Cell monoclonal was screened by a drug (Hygromycin), and PCR identification (yielding 1204bp) and first-generation sequencing identification were performed on the monoclonal cells using identification primers (R219R220-SF: 5’-ggcagaggttgcagtgagct-3’; R219R220-CR: 5’-TCACACATGCTGTATCTCGACCA-3’). Finally, the positively identified clones were named 4G8 and 4G11 and preserved.

[0128] Two site-directed mutation cell lines of SUV420H1K219AR220A, 4G8 and 4G11, were obtained. After sequencing, compared with wild-type HeLa cells, the only different mutated sites of the SUV420H1K219AR220A site-directed mutation cell lines are as Figure 3As shown in the left figure, in the point mutant cell lines 4G8 and 4G11 of SUV420H1K219AR220A, the codon of K at the 219th position of the protein encoded by the SUV420H1 gene in wild-type HeLa cells was mutated to the codon of A, and the codon of R at the 220th position was mutated to the codon of A, while other sites of the gene remained unchanged.

[0129] Extract the RNA of 4G8 and 4G11, reverse transcribe to obtain cDNA, and use 5’-CTGGGTCCTGCTGCGTTTA-3’ 5’-CAGTGCCCCGTCTTTCG-3’ (SUV420H1), and 5’-GCTCACTGGCATGGCCTTCCG-3’ 5’-GTGGGCCATGAGGTCCACCAC-3 (GAPDH) as primers for amplification respectively.

[0130] The results are as Figure 3 shown in the right figure of a. It can be seen that compared with wild-type HeLa cells (WT), the relative ratio of the expression level of SUV420H1 to the expression level of GAPDH protein (control protein, reflecting the total cell amount) in 4G8 and 4G11 cells did not change significantly, indicating that the point mutation did not cause frameshift mutation and did not affect protein expression.

[0131] II. Influence of the point mutant cell line of SUV420H1K219AR220A on the content of dimethylation modification (H4K20me2) at the 20th position of intracellular H4 protein

[0132] Extract the proteins of 4G8 and 4G11 cells, and detect the contents of H4K20me2, H4K20me1, H4K20me3 and H4 in the cells by WB.

[0133] The results are as Figure 3 shown in b. It can be seen that compared with wild-type HeLa cells, the level of H4K20me2 in the point mutant cell lines 4G8 and 4G11 of SUV420H1K219AR220A decreased significantly, indicating that without destroying the enzyme active center of SUV420H1, mutating SUV420H1 to SUV420H1K219AR220A in cells will disrupt its interaction with H2A.Z nucleosomes in vivo, affect the establishment of H4K20me2 by SUV420H1 in vivo, and further participate in the regulation of replication.

[0134] II. Influence of the point mutant cell line of SUV420H1K219AR220A on cancer cell proliferation and DNA replication

[0135] 1. Regulation of cancer cell proliferation by SUV420H1K219AR220A

[0136] The point mutant cell lines 4G8 and 4G11 of SUV420H1K219AR220A prepared in Example 3 and wild-type HeLa cells were used as test cells.

[0137] Detection was performed using a CCK-8 kit (Beyotime, C0038) with reference to its standard operating procedure. Approximately 1000 cells / well were seeded in 96-well plates, with more than 6 replicates. Prepare 96-well plates for the corresponding number of days (5-6). After every 24 hours, take one 96-well plate, aspirate the culture medium, add 100 μl of culture medium containing 10% CCK-8 reagent, incubate in an incubator for 1 hour, and then measure the absorbance at 450 nm using a 96-well plate fluorescence spectrophotometer. After 4-5 consecutive days, collect the data for analysis.

[0138] The results are as Figure 3 shown in c. Compared with the wild-type HeLa cell line, the point mutant cell lines 4G8 and 4G11 of SUV420H1K219AR220A showed a phenotype of slow growth. It was shown that substances that cause the following point mutations K219A and R220A in SUV420H1 can inhibit the proliferation of HeLa cells.

[0139] 2. Effect of SUV420H1K219AR220A on DNA replication

[0140] The effect of SUV420H1K219AR220A on DNA replication was studied by detecting the signals of activated replication origins (Short nascent strand seq) in wild-type Hela cells and two point mutant cell lines. Genomic DNA of wild-type Hela cells and two point mutant cell lines 4G8 and 4G11 was extracted, and then Short nascent strand seq detection was performed. The specific experimental procedure was as follows: The genomic DNA was separated and purified by sucrose density gradient centrifugation, and DNA with a size of 800-2000 bp was collected. Then, lambda-exo enzyme was used to digest double-stranded DNA of the same size to further purify the newly synthesized single-stranded DNA. Finally, the newly synthesized single-stranded DNA was converted into double-stranded DNA for library expansion and high-throughput sequencing.

[0141] The experimental results are as Figure 3 shown in d. It was found that compared with WT, the signals of replication origins in the point mutant cell lines were significantly reduced, indicating that causing the following point mutations K219A and R220A in SUV420H1 can inhibit DNA replication in HeLa cells.

[0142] The above results indicate that SUV420H1 K219R220 can help the H2A.Z nucleosome recruit SUV420H1 by interacting with H2A.Z D98S99, establish the H4K20me2 modification, and further regulate cancer cell proliferation and DNA replication.

[0143] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. Use of a substance capable of simultaneously introducing site-directed mutations at positions K219 and R220 of SUV420H1 protein in tumor cells in the preparation of a product for inhibiting tumor cell proliferation; The tumor cells are cervical cancer cell lines; The site-directed mutation at position K219 is the mutation of K at the 219th position of SUV420H1 protein to A; The site-directed mutation at position R220 is the mutation of R at the 220th position of SUV420H1 protein to A; None of the site-directed mutations cause frameshift mutations; The substance includes the following: (a1) sgRNA formed by annealing sgR219R220F: 5’- caccGACAAAATAGAATTACTGGT-3’ and sgR219R220 R: 5’ -aaacACCAGTAATTCTATTTTGTC -3’; (a2) Amplification primers for homologous arms: R219R220-HAF: TTAACTTTCTCAATGTGGCTGC; R219R220-HAR: AAGAAACTCACACCTGAAGC; (a3) Point mutation primers: R219R220-mutF: 5’-tttaaatagGgcAgcAAATGACAAAATAGAATTACTGGTGGGTTGTATTG-3’; R219R220-mutR: TTTGTCATTTgcTgcCctatttaaaatatgtgatgtgttaaaaattactagtaattaaatatagtaaggctt.

2. The application according to claim 1, characterized in that: The substance can inhibit DNA replication in tumor cells.

3. The application according to claim 1, wherein: The substance can inhibit the binding of SUV420H1 protein and H2A.Z nucleosome in tumor cells.

4. The application according to claim 1, characterized in that: The substance can reduce the content of H4K20me2 in tumor cells.

5. A method for inhibiting the binding of SUV420H1 protein and H2A.Z nucleosome in tumor cells, the method being a non-diagnostic and non-therapeutic method, which is to simultaneously introduce site-directed mutations at positions K219 and R220 of SUV420H1 protein in tumor cells; The tumor cells are cervical cancer cell lines; The site-directed mutation at position K219 is the mutation of K at the 219th position of SUV420H1 protein to A; The site-directed mutation at position R220 is the mutation of R at the 220th position of SUV420H1 protein to A; None of the site-directed mutations cause frameshift mutations; The substance used to simultaneously introduce site-directed mutations at positions K219 and R220 of SUV420H1 protein in tumor cells includes the following: (a1) sgRNA formed by annealing sgR219R220F: 5’- caccGACAAAATAGAATTACTGGT-3’ and sgR219R220 R: 5’ -aaacACCAGTAATTCTATTTTGTC -3’; (a2) Amplification primers for homologous arms: R219R220-HAF: TTAACTTTCTCAATGTGGCTGC; R219R220-HAR: AAGAAACTCACACCTGAAGC; (a3) Point mutation primer: R219R220-mutF: 5’-tttaaatagGgcAgcAAATGACAAAATAGAATTACTGGTGGGTTGTATTG-3’; R219R220-mutR: TTTGTCATTTgcTgcCctatttaaaatatgtgatgtgttaaaaattactagtaattaaatatagtaaggctt.

Citation Information

Patent Citations

  • H2A.Z-SUV420H1-H4K20me2-ORC1 pathway for regulating and controlling tumor cell proliferation

    CN112083166A