Discontinuous target activation mode and application of CRISPR-Cas13a system

Abstract

The present invention relates to the field of nucleic acid detection, and in particular to a non-continuous target activation mode and application of a CRISPR-Cas13a system. The present invention provides a crRNA, comprising: a repeat region and a guide region; the guide region is divided into a guide region 1 and a guide region 2 by a break site; the break site is located at any one of the 5th to 15th bases at the 5' end of the guide region; the guide region 1 and the guide region 2 are complementary to the target RNA, respectively. The CRISPR-Cas13a twin system provided by the present invention can detect two nucleic acid molecules simultaneously in one system, and can also perform dual gene editing simultaneously, and can further design a triangular or polygonal structure to achieve multi-nucleic acid detection and gene editing.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection, and in particular to a discontinuous target activation mode and application of a CRISPR-Cas13a system. Background Art

[0002] Most archaea and bacteria contain CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR; CRISPR-associated protein, Cas), an adaptive immune system composed of Cas proteins with endonuclease activity and CRISPR RNA (crRNA). Under the guidance of crRNA, Cas proteins specifically target and cut exogenous nucleic acids to resist infection and nucleic acid transfer by external bacteriophages. According to the difference in effector proteins, CRISPR-Cas systems are divided into two categories. The second type VI CRISPR-Cas13 system is currently the only CRISPR-Cas system that only targets single-stranded RNA (ssRNA). Cas13a protein is the first effector protein of CRISPR-Cas13 system discovered. It has two kinds of RNA enzyme (RNA nuclease, RNase) activity, one is used to process the precursor crRNA to produce mature crRNA, and the other is the ssRNA cleavage activity activated by the target RNA guided by crRNA, including the specific cleavage of the target RNA, i.e. "cis cleavage", and the non-specific cleavage of any surrounding ssRNA, i.e. "trans cleavage". Cas13a protein contains two conserved higher eukaryotes and prokaryotes nucleotide-binding (HEPN) domains responsible for its ssRNA cleavage activity. Nowadays, the origin, classification, target length requirements, mismatches, and the structure and molecular mechanism of RNase activity of CRISPR-Cas13a system have been deeply understood. However, we found that the activation mode of CRISPR-Cas13a system is very single, and various studies are based on continuous targets. In addition, the CRISPR diagnostic technology developed in recent years is hailed as the "next generation of molecular diagnostic technology". The programmability, specific activation and excellent trans-cleavage activity of the CRISPR-Cas13a system make it a signal amplification and readout system for use in nucleic acid detection and biosensing. However, due to the disordered and non-specific trans-ssRNA cleavage of the Cas13a protein, it is impossible to distinguish multiple targets, so the CRISPR-Cas13a system still faces huge challenges in multiple nucleic acid detection. Summary of the invention

[0003] In view of this, the present invention provides a non-continuous target activation mode and application of the CRISPR-Cas13a system. The CRISPR-Cas13a twin system provided by the present invention can detect two nucleic acid molecules simultaneously in one system, and can also perform dual gene editing simultaneously, and can further design a triangular or polygonal structure to achieve multiple nucleic acid detection and gene editing.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides crRNA, comprising: a repeat region and a guide region;

[0006] The guide region is divided into guide region 1 and guide region 2 by the break site;

[0007] The break site is located at any one of the 5th to 15th bases at the 5' end of the guide region;

[0008] The guide region 1 and the guide region 2 are complementary to the target RNA, respectively.

[0009] In some embodiments of the present invention, the length of the repeat region in the above-mentioned crRNA is not less than 30 bp; the length of the guide region is 20 to 28 bp.

[0010] The present invention also provides a CRISPR-Cas13a system, comprising: a Cas13a:crRNA complex, a fluorescent reporter probe, and a target RNA;

[0011] The Cas13a:crRNA complex comprises: Cas13 protein and the above-mentioned crRNA;

[0012] The target RNA includes: an RNA activator;

[0013] The RNA activator includes: RNA activator 1 and RNA activator 2, and may or may not include a bridge chain;

[0014] The RNA activator 1 is complementary to the guide region 1, and the RNA activator 2 is complementary to the guide region 2.

[0015] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the RNA activator includes: RNA activator 1, RNA activator 2 and a bridge chain.

[0016] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the length of the bridge chain is not less than 20 bp.

[0017] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the bridge chain is a single-stranded DNA or a single-stranded RNA.

[0018] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the RNA activator includes: a crRNA binding site domain and a buffer domain, and may or may not include a bridge binding site domain.

[0019] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the RNA activator includes: a crRNA binding site domain, a buffer domain and a bridge chain binding site domain.

[0020] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the bridge chain is hybridized and connected to the bridge chain binding site domain.

[0021] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the length of the RNA activator is not less than 21 bp.

[0022] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the length of the buffer domain is not less than 1 bp.

[0023] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the Cas13 protein includes: one or more of LbaCas13a, LbuCas13a, LwaCas13a and PsmCas13b.

[0024] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the target RNA includes: one or more of microRNA, mRNA and small RNA.

[0025] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the length of the target RNA is not less than 21 bp.

[0026] In some embodiments of the present invention, in the above-mentioned CRISPR-Cas13a system, the fluorescent reporter probe includes: a fluorescent group and a quenching group.

[0027] The present invention also provides the use of the above-mentioned crRNA and / or the above-mentioned CRISPR-Cas13a system in nucleic acid detection or gene editing.

[0028] In some embodiments of the present invention, in the above application, the gene editing includes: knockdown of two genes.

[0029] In some embodiments of the present invention, in the above application, the double gene includes: an exogenous transfected gene and an endogenous gene.

[0030] In some embodiments of the present invention, in the above application, the exogenous transfection gene includes: EGFP and / or mCherry.

[0031] The present invention provides crRNA, comprising: a repeat region and a guide region;

[0032] The guide region is divided into guide region 1 and guide region 2 by the break site;

[0033] The break site is located at any one of the 5th to 15th bases at the 5' end of the guide region;

[0034] The guide region 1 and the guide region 2 are complementary to the target RNA, respectively.

[0035] The beneficial effects of the present invention include:

[0036] (1) The CRISPR-Cas13a dual system provided by the present invention can detect two nucleic acid molecules simultaneously in one system;

[0037] (2) The CRISPR-Cas13a dual subsystem provided by the present invention can perform dual gene editing simultaneously in one system;

[0038] (3) The CRISPR-Cas13a binary system provided by the present invention can be further designed into a triangular or polygonal structure to achieve multiplex nucleic acid detection and gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0040] Figure 1 Schematic diagram showing two strategies for non-continuous target activation of Cas13a of the present invention;

[0041] Figure 2 Schematic diagram showing the break sites and 11 groups of non-continuous target RNAs;

[0042] Figure 3 Shows the sequence diagram of G5-15 and G15-5;

[0043] Figure 4 The figure shows the apparent cleavage rate of the reporter probe after 20 minutes of activation of Cas13a by non-continuous and continuous target RNA;

[0044] Figure 5 Schematic diagram of short target RNA is shown;

[0045] Figure 6 A real-time fluorescence signal diagram showing the activation of Cas13a by target RNA of 10 to 15 nucleotides;

[0046] Figure 7 Schematic diagram showing two RNA activators co-activating the same Cas13a with the assistance of an auxiliary nucleic acid strand;

[0047] Figure 8 The figure shows that 21 / 23 / 25 nucleotide RNA activators co-activate the trans-cleavage activity of Cas13a with the assistance of auxiliary nucleic acid chains;

[0048] Fig. 9 Schematic diagram of the CRISPR-Cas13a dual system;

[0049] Fig.10 2D and 3D atomic force microscopy images of the Cas13a:crRNA:RNA activator 1:RNA activator 2:Cas13a:crRNA' hexamer complex are shown;

[0050] Fig.11 The quantitative statistical graph of the two biomarkers miR-155 and miR-375 in serum samples of breast cancer patients by the CRISPR-Cas13a twin system is shown;

[0051] Fig.12 The quantitative statistical graph of the two biomarkers EBER-1 and EBER-2 in Epstein-Barr virus-infected human serum samples by the CRISPR-Cas13a twin system is shown;

[0052] Fig.13 Shown is the knockout analysis of mCherry and EGFP RNA in HEK293T cells using the CRISPR-Cas13a dual system. DETAILED DESCRIPTION

[0053] The present invention discloses a discontinuous target activation mode and application of a CRISPR-Cas13a system.

[0054] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0055] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0056] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0057] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0058] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0059] In the present invention, according to the CRISPR-Cas13a system, Cas13a binds to mature crRNA to form an inactive binary complex, 11 target RNA breakage sites are designed, 2 sequence binding strategies for target RNA and crRNA are developed, and 11 groups of non-continuous target RNAs are designed based on the breakage sites and binding strategies to target this binary complex. Finally, by detecting the fluorescent signal generated by the Cas13a trans-cleavage reporter probe in the binary complex, it is determined whether the Cas13a HEPN-RNase activity is activated and the degree of activation.

[0060] Preferably, the CRISPR-Cas13a system includes Cas13a, crRNA and a fluorescent reporter probe.

[0061] Preferably, the Cas13a includes LbaCas13a, LbuCas13a, LwaCas13a, and PsmCas13b.

[0062] Preferably, the crRNA includes a repeat region and a guide region, the length of the repeat region is not less than 30 nucleotides, and the length of the guide region is 20 to 28 nucleotides.

[0063] Preferably, the target RNA includes microRNA, mRNA, small RNA, etc., and has a length of not less than 21 nucleotides.

[0064] Preferably, the fluorescent reporter probe is a short RNA chain with a length of 5 to 10 nucleotides, wherein the 5' or 3' end of the reporter probe is labeled with a fluorescent group, and the 3' or 5' end is labeled with a quenching group.

[0065] Preferably, the 11 target RNA breakage sites are 11 breakage sites established at the 5th to 15th bases from the 5' end on the crRNA guide region, or 11 breakage sites are established at the 5th to 15th bases from the 3' end on the target RNA.

[0066] Preferably, the two sequence binding strategies of the target RNA and crRNA include: Strategy I is composed of two short RNA sequences, which are completely complementary to the guide region of crRNA together; Strategy II is a long RNA sequence, and the partial sequences at its 5' and 3' ends are completely complementary to the guide region of crRNA together to form a ring structure. Whether it is strategy I or strategy II, the target RNA is perfectly complementary to the guide region of crRNA, theoretically without mismatch and mismatch, and eventually forms a Cas13a-crRNA-target RNA quaternary (strategy I) or ternary (strategy II) complex.

[0067] Preferably, the 11 groups of non-continuous target RNAs: the 11 groups of non-continuous target RNAs correspond to 11 target RNA breakage sites; each group comprises strategy I and strategy II having the same breakage site.

[0068] The second technical problem to be solved by the present invention is to provide a CRISPR-Cas13a twin system. In the present invention, first two RNA activators (RNA activator 1, RNA activator 2) are connected by an auxiliary nucleic acid chain as a bridge chain (Bridge) to form a long ternary composite target chain, and the fracture of the ternary composite target chain and the crRNA binding part still exists, and then Cas13a is activated by this ternary composite target chain. On this basis, Cas13a:crRNA binary complex is used to replace Bridge, that is, the two ends of two RNA activators are respectively connected to two different Cas13a:crRNA binary complexes, i.e., Cas13a:crRNA:RNA activator 1:RNA activator2:Cas13a:crRNA' collaboration system, forming a fist to fist structure, so that the trans-cleavage activity of two Cas13a proteins can be activated simultaneously. When there is only one RNA activator, Cas13a cannot be activated.

[0069] Preferably, the two RNA activators, the two chains formed by the two short targeted extensions, are not less than 21 nucleotides in length. They are composed of three functional domains: a crRNA binding site domain, a bumper domain, a bridge binding site domain or a crRNA' binding site domain. The length of the buffer domain is not less than 1 nucleotide.

[0070] Preferably, the auxiliary nucleic acid chain is a single strand of DNA or RNA, which is hybridized and connected to the bridge binding sites of the two RNA activators, respectively. The length of the auxiliary nucleic acid chain is not less than 20 nucleotides.

[0071] Preferably, the Cas13a protein trans-cleavage activity, the RNA activator binds to the crRNA to activate the Cas13a HEPN-RNase activity, performs trans-ssRNA cleavage, cleaves the fluorescent reporter probe, and generates a fluorescent signal.

[0072] In Examples 1 to 9 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0073] The present invention will be further described below in conjunction with embodiments:

[0074] Example 1 Strategy for activating Cas13a HEPN-RNase activity by non-continuous target RNA

[0075] like Figure 1 As shown, Example 1 describes two strategies for non-continuous target activation of Cas13a. In Strategy I (Strategy I), non-continuous target RNA is composed of two short RNA sequences, which are fully complementary to the guide region of crRNA together; and the non-continuous target RNA in Strategy II (Strategy II) is a long RNA sequence, and its 5' and 3' end partial sequences are fully complementary to the guide region of crRNA together to form a ring structure. Whether it is Strategy I or Strategy II, target RNA is perfectly complementary to the spacer region of crRNA, theoretically without mismatch and mismatch, and eventually Cas13a-crRNA-target RNA quaternary or ternary complexes will be formed. Finally, we determine whether Cas13a HEPN-RNase activity is activated and the degree of activation by detecting the presence and strength of the fluorescent signal generated by the trans-cutting fluorescently labeled reporter probe (FQ5U) of Cas13a protein.

[0076] Example 2 Sequence design of non-continuous target RNA

[0077] In this embodiment, Figure 2The figure shows a 50-nucleotide crRNA sequence, which consists of a 30-nucleotide repeat region and a 20-nucleotide guide region. Based on the thermodynamic stability of Watson-Crick base pairing, we preset 11 break sites on the target RNA based on the positions of nucleotides 5 to 15 in the crRNA guide region. Figure 2 The vertical lines in the figure represent Site 1 to Site 11. Eleven groups of non-continuous target RNAs were developed based on these 11 break sites, namely Group 5-15 (G5-15) to Group 15-5 (G15-5). Each group contains two non-continuous targets with the same break site, corresponding to Figure 1 Strategy I and Strategy II. And each non-continuous target RNA has only one break, that is, 11 break sites. The sequence of 5 to 15 bases from the 3' end of the target RNA is named Target5 (T5) to Target 15 (T15), and the sequence of 5 to 15 bases from the 5' end is named Target 5' (T5') to Target 15' (T15').

[0078] Taking two groups of non-contiguous targets at Site 1 and Site 11 as an example, our experimental design is described in detail. Figure 3 We can see that G5-15 includes two groups of non-continuous target RNAs, two short targets T5 and T15' corresponding to strategy I, and one long target T5+15' corresponding to strategy II. The design principles of the remaining non-continuous target RNAs are the same as these two groups of targets.

[0079] Example 3 Rules for non-continuous target activation of CRISPR-Cas13a

[0080] In this example, the effects of 11 groups of non-continuous target RNAs on the activity of Cas13a HEPN-RNase were systematically explored. Figure 4The apparent cleavage rate of the Cas13a protein trans-cutting reporter probe at the 20-minute time point is shown by the non-continuous target RNA activating the Cas13a-crRNA complex relative to the continuous target RNA (T20). Comparative analysis shows that the activation of the CRISPR-Cas13a system with a non-continuous target RNA with a ring structure corresponding to Strategy II produces sufficient, detectable fluorescent signals, and these signals present an "M"-shaped wavy trend. However, the 11 non-continuous target RNAs of Strategy I have weaker abilities to activate the activity of Cas13a HEPN-RNase, and even cannot activate Cas13a. Among all non-continuous target RNAs, the efficiency of T9+11' in activating Cas13a is comparable to that of T20, and the Cas13a protein activated by it exhibits the strongest nuclease activity. The ability of T7+13', T8+12', T11+9', T12+8' and T13+7' to activate the Cas13a protein nuclease is slightly inferior to that of T9+11'. T10+10' cannot effectively trigger the activity of Cas13aHEPN-RNase.

[0081] Example 4 Fluorescence analysis of short target activated Cas13a HEPN-RNase activity

[0082] In this example, the efficiency of trans-ssRNA cleavage of Cas13a protein in the presence of crRNA and complementary target RNA of 10 to 15 nucleotides in length was detected (eg Figure 5 Target RNAs with 15 or even 14 nucleotides complementary to the crRNA guide region starting from the 3' end (T15 or T14) can still promote the HEPN-RNase activity of Cas13a, corresponding to Figure 6 T15 and T14 in the target RNA can detect obvious fluorescence growth signals, while target RNA shorter than 14 nucleotides (T13-T10) cannot activate Cas13a. Target RNA shortened by 5 or more nucleotides from the 3' end (T15'-T10') cannot activate Cas13a for trans-ssRNA cleavage, and no fluorescence signal can be detected.

[0083] Example 5 Two RNA activators activate the same Cas13a protein

[0084] In this embodiment, two RNA activators (RNA activator 1, RNA activator 2) are connected by an auxiliary nucleic acid chain as a bridge to form a long ternary composite target chain. The breakage of the crRNA-binding part in the ternary composite target chain still exists, and Cas13a is activated by this ternary composite target chain (such as Figure 7The three RNA activators of different lengths have the same crRNA binding site domain and bridge binding site domain, but contain buffer domains of different lengths, namely 1, 3, and 5 nucleotides. Figure 8 It shows that RNA activators of different lengths have different abilities to activate Cas13a trans-ssRNA cleavage, and as the length of the RNA activator increases, the activation of Cas13a HEPN-RNase activity gradually increases. (Note: Due to the enhanced activity of Cas13a HEPN-RNase under 23-nt and 25-nt RNA activators, except for the T20 and R1+R2+Bridge groups, which can see obvious signal differences in the figure, the other control groups are overlapped at the bottom.)

[0085] Three RNA activator sequences of different lengths: (the underlined part is the crRNA binding site domain, the bold part is the bridge binding site domain, and the rest is the buffer domain)

[0086] 21-nt RNA activator 1: (as shown in SEQ ID NO: 1);

[0087] 21-nt RNA activator 2: (as shown in SEQ ID NO:2);

[0088] 23-nt RNA activator 1: (as shown in SEQ ID NO:3);

[0089] 23-nt RNA activator 2: (as shown in SEQ ID NO:4);

[0090] 25-nt RNA activator 1: (as shown in SEQ ID NO:5);

[0091] 25-nt RNA activator 2: (as shown in SEQ ID NO:6);

[0092] crRNA:5'-GACCACCCAAAAUGAAGGGGACUAAAACCUCCAAC CACCACCAAGCAC-3' (as shown in SEQID NO:7);

[0093] Bridge: 5'-TCAACTCACACTCTCCATCC-3' (as shown in SEQ ID NO: 8).

[0094] Example 6 Construction and sensitivity determination of CRISPR-Cas13a twin system

[0095] In this embodiment, two different Cas13a:crRNA binary complexes are connected at both ends of two RNA activators (RNA activator 1, RNA activator 2) to form a fist-to-fist structure, so that two Cas13a proteins can be activated simultaneously for trans-ssRNA cleavage (such as Fig. 9 shown). Fig.10 The atomic force microscopy images showed that many particles contained two Cas13a molecules, adjacent to each other, in a fist-to-fist structure, demonstrating the formation of a hexameric complex of Cas13a:crRNA:RNAactivator 1:RNA activator2:Cas13a:crRNA.

[0096] The sequence used in the construction of the CRISPR-Cas13a binary system: (the underlined part is the crRNA binding site domain, the bold part is the crRNA' binding site domain, and the rest is the buffer domain)

[0097] crRNA:5'-GACCACCCAAAAUGAAGGGGACUAAAACCUCCAAC CACCACCAAGCAC-3' (as shown in SEQ ID NO: 9);

[0098] crRNA':5'-GACCACCCCAAAAAUGAAGGGGACUAAAACUCAACU CACACUCACCAUCC-3' (as shown in SEQ ID NO: 10);

[0099] RNA activator 1: (as shown in SEQ ID NO: 11);

[0100] RNA activator 2: (as shown in SEQ ID NO:12).

[0101] Example 7 Application of CRISPR-Cas13a twin system in early diagnosis of breast cancer

[0102] In this embodiment, the CRISPR-Cas13a dual system can simultaneously detect two biomarkers, miR-155 and miR-375, in serum samples of breast cancer patients in the same system (e.g. Fig.11 As shown in Figure 2, it can effectively distinguish patients with breast cancer stages I-II and III-IV from healthy people.

[0103] Sequence used for breast cancer diagnosis: (The underlined part is the crRNA binding site domain, the bold part is the crRNA' binding site domain, and the rest is the buffer domain)

[0104] crRNA (5'-3'): GACCACCCCAAAAAUGAAGGGGACUAAAACACGAAC AAAAACCCCUAUCA (as shown in SEQ ID NO: 13);

[0105] crRNA'(5'-3'):GACCACCCCAAAAAUGAAGGGGACUAAAACUAGCA UUAAUCACGCGAGCC (as shown in SEQ ID NO: 14);

[0106] miR-375(5'-3'): (as shown in SEQ ID NO: 15);

[0107] miR-155(5'-3'): (as shown in SEQ ID NO:16).

[0108] Example 8 Application of CRISPR-Cas13a Gemini System in EB Virus Diagnosis

[0109] In this embodiment, the CRISPR-Cas13a twin system can simultaneously detect two biomarkers, EBER-1 and EBER-2, in Epstein-Barr virus-infected human serum samples in the same system (e.g. Fig.12 EBV-infected patients were effectively distinguished from healthy people.

[0110] Sequence used for EB virus diagnosis: (the underlined part is the crRNA binding site domain, the bold part is the crRNA' binding site domain, and the rest is the buffer domain)

[0111] crRNA (5'-3'): GACCACCCCAAAAAUGAAGGGGACUAAAACGUAGG UCCUAUAGCGGACAA (as shown in SEQ ID NO: 17);

[0112] crRNA'(5'-3'):GACCACCCCAAAAAUGAAGGGGACUAAAACGGCUG UCCUCAUGCGGACCA (as shown in SEQ ID NO:18);

[0113] EBER-1(5'-3'):

[0114] (as shown in SEQ ID NO: 19);

[0115] EBER-2(5'-3'):

[0116] (as shown in SEQ ID NO:20).

[0117] Example 9 Application of CRISPR-Cas13a twin system to in vivo gene editing

[0118] In this example, the CBh-Cas13a-U6-crRNA1-U6-crRNA2-SV40-E GFP-SV40-mCherry plasmid was first constructed, and HEK293T cells were fully cultured in a 37°C, 5% CO2 incubator using DM EM medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. After 12 hours, 0.5 μg of the plasmid was transfected into cells containing 1.5 μg of polyethyleneimine (PEI) (DNA / PEI mass ratio was 1:3). 48 hours after transfection, EGFP and m Cherry fluorescence were analyzed by confocal laser scanning microscopy. Fig.13 As shown, the CRISPR-Cas13a twin system can achieve simultaneous knockout of double-transfected genes.

[0119] Sequence used for in vivo gene editing: (the underlined part is the crRNA binding site domain, the bold part is the crRNA' binding site domain, and the rest is the buffer domain)

[0120] crRNA (5'-3'): GACCACCCCAAAAAUGAAGGGGACUAAAACGCUCACCAUGAGAGUGAUCC (as shown in SEQ ID NO: 21);

[0121] crRNA'(5'-3'):GACCACCCCAAAAAUGAAGGGGACUAAAACGUGAA CAGCGCCGGUGGAGU (as shown in SEQ ID NO:22);

[0122] mCherry(5'-3'):

[0123] (as shown in SEQ ID NO:23);

[0124] EGFP(5'-3'):

[0125]

[0126] (as shown in SEQ ID NO:24).

[0127] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. CRISPR-Cas13a system, characterized in that include: Cas13a:crRNA complex, Cas13a:crRNA' complex, fluorescent reporter probe and target RNA; The Cas13a:crRNA complex includes: Cas13 protein and crRNA; The crRNA comprises: a repeat region A and a guide region A; The guide region A is divided into guide region 1 and guide region 2 by the break site; The guide region 1 and the guide region 2 are complementary to the target RNA respectively; The Cas13a:crRNA' complex includes: Cas13 protein and crRNA'; The crRNA' comprises: a repeat region A and a guide region B; The guide region B is divided into guide region 3 and guide region 4 by the break site; The guide region 3 and the guide region 4 are complementary to the target RNA respectively; The target RNA includes: an RNA activator; The RNA activator includes: RNA activator 1 and RNA activator 2, and may or may not include a bridge chain; The RNA activator 1 is complementary to the guide region 1, and the RNA activator 2 is complementary to the guide region 2; The RNA activator 1 is complementary to the guide region 3, and the RNA activator 2 is complementary to the guide region 4; The RNA activator comprises: a crRNA binding site domain and a buffer domain, and may or may not comprise a bridge binding site domain; The length of the RNA activator is no less than 21 bp; The length of the buffer domain is not less than 1 bp.

2. The CRISPR-Cas13a system as claimed in claim 1, characterized in that The length of the repeat region is not less than 30 bp; the length of the guide region is 20-28 bp.

3. The CRISPR-Cas13a system of claim 1 or 2, wherein The Cas13 protein includes one or more of LbaCas13a, LbuCas13a, LwaCas13a and PsmCas13b.

4. The CRISPR-Cas13a system as claimed in claim 3, characterized in that The target RNA includes one or more of microRNA, mRNA and small RNA.

5. The CRISPR-Cas13a system as claimed in claim 4, characterized in that The length of the target RNA is not less than 21 bp.

6. The CRISPR-Cas13a system of claim 5, wherein The fluorescent reporter probe includes a fluorescent group and a quenching group.

7. The use of the CRISPR-Cas13a system as described in any one of claims 1 to 6 in nucleic acid detection or gene editing; the application is for non-diagnostic and therapeutic purposes.

Images