A GDP gene, a recombinant GDP gene and their application in plant disease resistance

Abstract

The present invention provides a GDP gene, a recombinant GDP gene and the application thereof in plant disease resistance, and belongs to the technical field of plant disease resistance. The present invention proposes the GDP gene and the recombinant GDP gene for the first time, and realizes the "cut-release-poly-pyroptosis" process in plants, which is a plant disease resistance strategy different from the traditional plant disease resistance body activation disease resistance. Specifically, plant disease resistance can be achieved by changing the sequence of the GDP-N and GDP-C connection sites using only the GDP gene. The present invention inserts a sequence that can be recognized and cut by a pathogen effector or a protease between the 828th and 829th nucleotides of the GDP gene, and then when the pathogen infects, the GDP gene can be cut into an N-terminus and a C-terminus, and the plant immune response is induced by the N-terminus.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease resistance, and in particular relates to a GDP gene, a recombinant GDP gene and applications thereof in plant disease resistance. Background Art

[0002] Plant cells have their own disease-resistant bodies, which can be divided into two types. One type binds to specific effectors to form polymers, opens holes in the cell membrane, triggers calcium ion flow, and causes plant disease resistance. After the other effector binds, it needs the help of helper genes to polymerize and open holes in the cell membrane, triggering calcium ion flow and causing plant disease resistance. However, at present, plant disease-resistant bodies are still very inconvenient in transformation and design, and they are often unsatisfactory in the face of invasion by various diseases such as fungi, bacteria, and viruses. At the same time, cloning and discovering more disease-resistant bodies from plants requires a lot of manpower, material resources, and financial resources. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a GDP gene and a recombinant GDP gene, which realize the "cleavage-release-polymerization-pyroptosis" process in plants, becoming a third disease resistance mechanism different from the original plant disease resistance body, which is called "plant inflammasome" in the present invention. The disease resistance mechanism provided by the present invention is more flexible, the designability is significantly enhanced, and it can be optimized and recombined for different plant pathogens, so that the recombinant GDP becomes a specific broad-spectrum resistance gene for multiple pathogens.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a GDP gene, the nucleotide sequence of the GDP gene is shown as SEQ ID NO.1.

[0006] The present invention also provides a recombinant GDP gene, wherein a linker is inserted between the 828th and 829th nucleotides of the GDP gene, and the linker is at least one pathogen effector or protease recognition cleavage sequence.

[0007] Preferably, when the linker is two or more pathogen effectors or protease recognition and cleavage sequences, the two or more pathogen effectors or protease recognition and cleavage sequences are connected in series.

[0008] Preferably, the pathogen effector recognition and cleavage sequence includes a RIN4 protease cleavage site, and the protease recognition and cleavage sequence includes a TuMV-NIa protease cleavage site; the nucleotide sequence of the RIN4 protease cleavage site is shown in SEQ ID NO.2 or SEQ ID NO.3, and the nucleotide sequence of the TuMV-NIa protease cleavage site is shown in SEQ ID NO.4.

[0009] Preferably, the recombinant GDP gene comprises the nucleotide sequence shown as SEQ ID NO.5 or SEQ ID NO.6.

[0010] The present invention also provides a recombinant expression vector containing the recombinant GDP gene.

[0011] Preferably, the empty vector of the recombinant expression vector includes pCAMBIA1300.

[0012] The present invention also provides the use of the GDP gene or the recombinant GDP gene or the recombinant expression vector in plant disease resistance.

[0013] The present invention also provides a method for improving plant disease resistance, comprising the following steps: transfecting the above recombinant GDP gene or the above recombinant expression vector into plants.

[0014] Preferably, the plant comprises tobacco or Arabidopsis thaliana.

[0015] Beneficial effects of the present invention:

[0016] At present, the mining of plant disease resistance genes in this field is limited, and the traditional disease resistance gene mining scheme consumes a lot of manpower and material resources. The present invention proposes for the first time a plant disease resistance strategy that integrates "cutting-release-polymerization-pyroptosis", which is a new strategy different from the traditional plant disease resistance body activation disease resistance. Specifically, only GDP can be used to achieve disease resistance by changing the sequence of the GDP-N and GDP-C connection sites, reducing mining time and saving manpower and material resources.

[0017] Traditional disease-resistant genes in this field can only fight against one or several physiological subspecies, and cannot achieve joint disease resistance against large categories such as fungi, bacteria, viruses, etc. The present invention can connect the cleavage sites of different pathogenic bacteria / virus proteases in series, and connect the pathogen effector recognition cleavage sequence as a linker in series between the N-terminus and the C-terminus of GDP to achieve specific broad-spectrum disease resistance. By transferring one gene, broad-spectrum disease resistance across categories can be achieved.

[0018] Traditional disease-resistant genes cannot be flexibly modified. However, the present invention modularizes the GDP-N and GDP-C connection regions, and can flexibly add or delete cutting sequences according to different pathogens of different plants, which has the advantages of flexibility and applicability to multiple crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of Example 1, wherein a is the plant hypersensitive (HR) reaction and DAB staining results, the left, middle and right figures in a are the plant hypersensitive reaction results under white light, the plant hypersensitive reaction results under ultraviolet light and the DAB staining results, respectively, b is the ROS measurement result, and c is the disease resistance-related gene detection result;

[0020] Figure 2 The protein structure prediction results;

[0021] Figure 3 The results of Example 3, wherein a is the co-expression of GDP-R1V and proteases avrRpt2, avrRpt2 C122A or TuMV-NIa to induce plant hypersensitivity (HR) response, b is the detection result of the protein expressed in a (※ is the GDP-N-terminal protein released after being cleaved by protease), c is the co-expression of GDP-R2V and protease avrRpt2, avrRpt2 C122A or TuMV-NIa induced plant HR response, d is the expression protein detection result in c (※ is the GDP-N-terminal protein released after protease cleavage), e is the expression of avrRpt2 and avrRpt2 alone C122A and the results of plant HR reactions with TuMV-NIa protease;

[0022] Figure 4 The results of the analysis of the resistance of the recombinant GDP transgenic tobacco plant to TuMV-GFP virus described in Example 4, wherein a is the result of the disease resistance immunity test, and b is the result of the expression of the TuMV coat protein CP gene in the leaves of different recombinant GDP transgenic tobacco systems;

[0023] Figure 5 These are the results of resistance analysis of recombinant GDP transgenic Arabidopsis to the bacterium PstDC3000 (avrRpt2), where a is the plant disease resistance immunity test result, b is the leaf disease resistance immunity test result, and c is the bacterial biomass statistics result. DETAILED DESCRIPTION

[0024] The present invention provides a GDP gene, the nucleotide sequence of the GDP gene is shown as SEQ ID NO.1.

[0025] In the present invention, the name GDP gene is the self-name of the applicant for the gene with the nucleotide sequence shown in SEQ ID NO.1. The GDP gene of the present invention consists of the N-terminus (nucleotide 1 to nucleotide 828) and the C-terminus (nucleotide 829 to nucleotide 1464), and the N-terminus is the main functional region. The N-terminus can polymerize on the cell membrane to form a pore-like structure, causing the outflow of intracellular inflammatory factors and inducing inflammatory responses in animals. The C-terminal domain mainly plays an inhibitory role. The C-terminus inhibits the function of the N-terminus in the cell, maintains a stable presence in the body, and does not induce any inflammatory response. The present invention expresses the GDP gene in plants, proving that the N-terminus of GDP can cause plant immune responses.

[0026] The present invention also provides a recombinant GDP gene, wherein a linker is inserted between the 828th and 829th nucleotides of the GDP gene, and the linker is a sequence that can be recognized and cut by at least one pathogen effector or protease.

[0027] In the present invention, when the linker is two or more pathogen effectors or protease recognition cleavage sequences, the two or more pathogen effectors or protease recognition cleavage sequences can be sequentially connected in series. The pathogen effector recognition cleavage sequence of the present invention includes a RIN4 protease cleavage site, and the protease recognition cleavage sequence includes a TuMV-NIa restriction site; the nucleotide sequence of the RIN4 protease cleavage site is shown in SEQ ID NO.2 (CGTTCGAATGTACCAAAATTTGGAAACTGGGAAGCT) or SEQ ID NO.3 (GTCACAGTGGTGCCTAAATTCGGTGACTGGGACGAG), and the nucleotide sequence of the TuMV-NIa restriction site is shown in SEQ ID NO.4 (GGTGGATGTTCACATCAGTCA). In the present invention, the recombinant GDP gene preferably includes a nucleotide sequence as shown in SEQ ID NO.5 or SEQ ID NO.6.

[0028] The present invention also provides a recombinant expression vector containing the recombinant GDP gene. In the present invention, the empty vector of the recombinant expression vector includes pCAMBIA1300, and the present invention has no special limitation on the specific source of the empty vector pCAMBIA1300.

[0029] The present invention also provides the use of the GDP gene or the recombinant GDP gene or the recombinant expression vector in plant disease resistance. In the present invention, the plant preferably includes tobacco or Arabidopsis thaliana.

[0030] The present invention also provides a method for improving plant disease resistance, comprising the following steps: transfecting the above recombinant GDP gene or the above recombinant expression vector into a plant. In the present invention, the plant preferably includes tobacco or Arabidopsis thaliana.

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0033] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0034] Example 1

[0035] The N-terminus of the GDP gene of the plant of the present invention (GDP-N, the specific sequence is the nucleotide from the 1st nucleotide to the 828th nucleotide in the nucleotide sequence of SEQ ID NO.1) can induce tobacco cell death and has the plant disease resistance gene immunity characteristics:

[0036] S1. Vector construction:

[0037] GDP-N, GDP-C (nucleotide 829 to nucleotide 1464 in SEQ ID NO.1), and the full-length GDP fragment (SEQ ID NO.1) were amplified and constructed into the pCAMBIA1300 vector by homologous recombination.

[0038] The primer sequences were designed as follows:

[0039] P1300-GDP-NF:

[0040] 5'-ACACCAAATCGACTCTAGAAATGCCATCCGCTTTCGA-3' (SEQ ID NO. 7);

[0041] P1300-GDP-NR:

[0042] 5'-TTGCTCACCATGGTCTCTCAGTCGCTGAGGAGGGAGAGTT-3' (SEQ ID NO. 8);

[0043] P1300-GDP-CF:

[0044] 5'-ACACCAAATCGACTCTAGAAGGCATTGACGAGGAGGAGC-3' (SEQ ID NO. 9);

[0045] P1300-GDP-CR: 5'-TTGCTCACCATGGTCTCTCAGCACGGCTTCTGGC-3' (SEQ ID NO. 10).

[0046] Amplification of GDP-N, GDP-C and GDP fragments: Primer pairing is: P1300-GDP-NF and P1300-GDP-NR (GDP-N fragment), P1300-GDP-CF and P1300-GDP-CR (GDP-C fragment), P1300-GDP-NF and P1300-GDP-CR (GDP fragment), PCR amplification is performed using the synthetic GDP fragment as a template. Reaction conditions are: 95℃ pre-denaturation for 5min; 95℃30sec, 58℃30sec, 72℃40sec, 34 cycles; 72℃ extension for 5min.

[0047] Homologous recombination ligation: The pCAMBIA1300 vector was digested with HindIII, and the digestion product and the corresponding fusion fragment were ligated to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain a vector containing GDP-N, GDP-C, and GDP proteins.

[0048] S2. Immune signature analysis:

[0049] (1) Transient expression of GDP-N in Nicotiana benthamiana to induce plant hypersensitivity (HR) response: The experiment was divided into 5 groups, GDP-N, GDP-C, GDP, pCAMBIAsuper1300 empty vector (EV) and positive control Xa23 that induces HR response. GDP-N, GDP-C, GDP and Xa23 were constructed into pCAMBIAsuper1300 vectors and transformed into Agrobacterium GV3101. After shaking for 16 hours, the bacteria were resuspended in infection solution (10mM MgCl2, 10mM MES and 100μM acetosyringone) and the OD of each component was adjusted. 600 to 1. GDP-N, GDP-C, GDP, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 24h after injection, the tobacco leaves were observed and photographed under white light and ultraviolet (UV) light. The results are shown in Figure 1 a As shown in the left and middle figures, GDP-N can induce HR response in tobacco cells like the positive control Xa23, while GDP-C and GDP are consistent with the empty vector (EV) and do not induce HR response in tobacco cells.

[0050] (2) GDP-N induced reactive oxygen species (ROS) burst in Nicotiana benthamiana - DAB staining: As described in (1), GDP-N, GDP-C, GDP, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 15 h after injection, the injected tobacco leaves were immersed in 20 ml of DAB dye solution, incubated horizontally in the dark for 8 h, then placed in 95% ethanol for decolorization, incubated horizontally for 48 h, and photographed under white light. The results are shown in Figure 2. Figure 1 As shown in the right figure in a, GDP-N and the positive control Xa23 can both stain ROS burst, while the control groups GDP-C and GDP and empty vector (EV) have no such phenomenon. This indicates that GDP-N expression in tobacco cells can induce ROS burst like the positive control Xa23.

[0051] (3) GDP-N induced ROS burst in Nicotiana benthamiana - ROS assay: This experiment was divided into eight groups, namely GDP / chitin group, GDP-C / chitin group, GDP-N / chitin group, EV / chitin group, GDP / mock group, GDP-C / mock group, GDP-N / mock group and EV / mock group. The GDP / chitin group, GDP-C / chitin group and GDP-N / chitin group were induced by mixed solution containing chitin (Chitin) to stimulate plant cell immunity. The Nicotiana benthamiana leaves were infected with DP, GDP-C, and GDP-N Agrobacterium; the EV / chitin group was used to induce the Nicotiana benthamiana leaves containing the empty vector EV Agrobacterium with a mixed solution containing chitin that stimulates plant cell immunity; the GDP / mock group, GDP-C / mock group, and GDP-N / mock group were used to treat the Nicotiana benthamiana leaves containing GDP, GDP-C, and GDP-N Agrobacterium with distilled water (control group 1); the EV / mock group was used to treat the Nicotiana benthamiana leaves containing the empty vector EV Agrobacterium with distilled water (control group 2), and each sample group had at least eight biological replicates.

[0052] Agrobacterium containing expression plasmids of GDP, GDP-C, GDP-N and empty vector EV was injected into 4-week-old Nicotiana benthamiana leaves, and Agrobacterium containing empty vector expression plasmid was used as EV control. After 7 hours, 3mm×3mm Nicotiana benthamiana leaf discs were collected and immersed in distilled water overnight in a 96-well plate. The distilled water was discarded, and 100μL of mixed solution (50μΜ luminol (Wako), 10μg / mL horseradish peroxidase and 6mM chitin (GLPBIO)) was added to each well. 100μL of distilled water was added to each well of the GDP / mock group, GDP-C / mock group, GDP-N / mock group and EV / mock group as a control. Chemiluminescence was measured at intervals of 500ms in a SPARK-10M microplate reader (TECAN) for 60 minutes.

[0053] The results are as follows Figure 1 As shown in b, after chitin induction, it was found that the reactive oxygen in tobacco expressing the GDP-N gene increased sharply, significantly higher than that of the material not expressing the GDP-N gene, indicating that GDP-N expression can induce the production of reactive oxygen, and the total amount of reactive oxygen is much higher than that of control group 1 and control group 2.

[0054] (4) Detection of disease resistance-related genes (PR1b, PR2b, PR4, ERF1 and LOX): Experimental method: The experiment was divided into four groups, namely, Agrobacterium injected with expression plasmids containing GDP, GDP-C, and GDP-N in Nicotiana benthamiana as the experimental group and Agrobacterium injected with empty vector expression plasmid in Nicotiana benthamiana as the EV control. Each sample was subjected to at least three biological replicates.

[0055] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves containing GDP, GDP-C, GDP-N, and control EVs were collected 15 hours after Agrobacterium injection and quickly frozen in liquid nitrogen. The leaves were ground in liquid nitrogen for RNA extraction. Total RNA was extracted from the samples using RNAprepPure PlantKit (TianGenBiotech; China). RNA was purified from total RNA using DNase I (ThermoScientific). Complementary DNA (cDNA) was synthesized using HiScript II First-Strand cDNA Synthesis Kit (Vazyme). qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad) using SYBR Green Mix (Vazyme). 2 -ΔΔCT The method was used to calculate the expression level of genes.

[0056] The results are as follows Figure 1As shown in Figure c, the expression levels of disease resistance genes such as PR1b, PR2b, PR4, ERF1 and LOX in tobacco samples injected with GDP-N were significantly increased, significantly higher than those in the GDP, GDP-C and control groups, indicating that the expression of GDP-N activated the expression of plant disease resistance genes and proved that the GDP-N gene has the immune characteristics of plant R genes.

[0057] The above results show that the N-terminus of the GDP gene of the present invention has plant disease resistance.

[0058] Example 2

[0059] GDPN-terminal and C-terminal linker sequence design method and protein structure prediction

[0060] Designing the GDP-N-terminal and GDP-C-terminal connecting sequences so that they can be recognized and cut by pathogen effectors, releasing the GDP-N-terminal to play a role, is the key to being applied in plant disease resistance. In plant research, the effectors secreted by the Arabidopsis bacterial pathogen Pseudomonas syringae have been studied in depth, such as: avrRpt2, avrPphB, etc. Among them, the sequence of the RIN4 gene in Arabidopsis thaliana recognized and cut by the effector avrRpt2 is more clear. In addition, the present invention also selected the relatively mature Turnip Mosaic Virus (TuMV) NIa protease cleavage site to explore whether the scheme of the present invention can resist multiple pathogens at the same time. Based on this, the present invention designed the following two schemes and performed protein structure prediction on them.

[0061] Solution 1

[0062] The first restriction site of RIN4 protein (RCS1: RSNVPKFG↓NWEA (the corresponding nucleotide sequence is SEQ ID NO.2), the arrow indicates the specific cutting position) and the TuMV-NIa restriction site (TCS: GGCSHQ↓S (the corresponding nucleotide sequence is SEQ ID NO.4), the arrow indicates the specific cutting position) are connected in series and added between the GDP N-terminus and the C-terminus in the SEQ ID NO.1 sequence to form a recombinant GDP gene with a nucleotide sequence as shown in SEQ ID NO.5, named GDP-R1V. The protein sequence encoded by the recombinant GDP gene with a nucleotide sequence as shown in SEQ ID NO.5 is shown in SEQ ID NO.11.

[0063] Solution 2

[0064] The second restriction site of RIN4 protein (RCS2: VTVVPKFG↓DWDE (the corresponding nucleotide sequence is SEQ ID NO.3), the arrow indicates the specific cutting position) and the TuMV-NIa restriction site (TCS: GGCSHQ↓S (the corresponding nucleotide sequence is SEQ ID NO.4), the arrow indicates the specific cutting position) are connected in series and added between the GDP N-terminus and the C-terminus in the SEQ ID NO.1 sequence to form a recombinant GDP gene with a nucleotide sequence as shown in SEQ ID NO.6, named GDP-R2V. The protein sequence encoded by the recombinant GDP gene with a nucleotide sequence as shown in SEQ ID NO.6 is shown in SEQ ID NO.12.

[0065] According to the above two design schemes, the present invention uses Alphafold to predict the protein structure. The results are as follows Figure 2 As shown, both recombinant proteins (GDP-R1V and GDP-R2V) maintain a structure consistent with the original GDP protein, and the added restriction sites do not produce complex structures such as α-helix or β-fold. The above two combinations are completely valid in structure.

[0066] Example 3

[0067] Verify whether the co-expression of the plant recombinant GDP obtained in Example 2 and the corresponding protease in Nicotiana benthamiana induces HR response

[0068] S1. Vector construction:

[0069] GDP-N and GDP-C fragments were amplified separately, and the restriction sites were connected between GDP-N and GDP-C through homologous recombination, and then constructed into the pCAMBIA1300 vector.

[0070] The primer sequences were designed as follows:

[0071] P1300-GDF: 5'-ACACCAAATCGACTCTAGAAATGCCATCCGCTTTCGA-3' (SEQ ID NO.13),

[0072] P1300-VR:

[0073] 5'-TGACTGATGTGAACATCCACCGTCGCTGAGGAGGGAGAG-3' (SEQ ID NO.14),

[0074] R1V-R:

[0075] 5’-AGCTTCCCAGTTTCCAAATTTTGGTACATTCGAACGTGACTGATGTG-3’(SEQ ID NO.15),

[0076] R2V-R:

[0077] 5’-CTCGTCCCAGTCACCGAATTTAGGCACCACTGTGACTGACTGATGTG-3’(SEQ ID NO.16),

[0078] P1300-R1-F:

[0079] 5’-AAAATTTGGAAACTGGGAAGCTGGCATTGACGAGGAGGAGC-3’

[0080] (SEQ ID NO.17),

[0081] P1300-R2-F:

[0082] 5’-AATTCGGTGACTGGGACGAGGGCATTGACGAGGAGGAGC-3’(SEQ ID NO.18),

[0083] P1300-GDR:5’-TTGCTCACCATGGTCTCGTCGCTGAGGAGGGAGAGTT-3’(SEQ ID NO.19)。

[0084] First, amplify the fragment with TCS added to the N-terminus of GDP-N (fragment 1): primer pairing is: P1300-GDF and P1300-VR, and PCR amplification is performed using the synthetic GDP fragment as a template. The reaction conditions are: 95℃ pre-denaturation for 5min; 95℃30sec, 58℃30sec, 72℃40sec, 34 cycles; 72℃ extension for 5min. Using fragment 1 as a template, PCR amplify the fragment with TCS and RCS1 added to the N-terminus of GDP-N (fragment 2). Primer pairing is: P1300-GDF and R1V-R, and the reaction conditions are: 95℃ pre-denaturation for 5min; 95℃30sec, 58℃30sec, 72℃40sec, 34 cycles; 72℃ extension for 5min. Using fragment 1 as a template, PCR amplify the fragment with TCS and RCS2 added to the N-terminus of GDP-N (fragment 3). The primer pairing is: P1300-GDF and R2V-R, and the reaction conditions are: 95℃ pre-denaturation for 5min; 95℃30sec, 58℃30sec, 72℃40sec, 34 cycles; 72℃ extension for 5min. Then amplify the fragment with part of RCS1 added to the C-terminus of GDP-C (fragment 4) or the fragment of RCS2 (fragment 5): the primer pairing is: P1300-R1-F or P1300-R2-F and P1300-GDR, and PCR amplification is performed using the synthetic GDP fragment as a template. The reaction conditions are: 95℃ pre-denaturation for 5min; 95℃30sec, 58℃30sec, 72℃40sec, 34 cycles; 72℃ extension for 5min.

[0085] Fusion PCR: The PCR products obtained by the above amplification were purified and then subjected to fusion PCR (a total of 4 μL (25-50 ng) of products, the pairing method was: fragment 2 and fragment 4 fusion (2 μL each), fragment 3 and fragment 5 fusion (2 μL each); 2×PhantaMaxBuffer25μL; dNTPMix (10mM each)1μL; PhantaMax Super-FidelityDNAPloymerase0.5μL, reaction conditions were: 95℃ pre-denaturation for 5min; 95℃30sec, 60℃40sec, 72℃60sec, 15 cycles; 72℃ extension for 5min; after the reaction, add P1300-GDF1.5μL; P1300-GDR1.5μL; Phanta Max Super-Fidelity DNAPloymerase to the PCR product. 0.5 μL. Reaction conditions: 95°C pre-denaturation for 5 min; 95°C for 30 sec, 58°C for 60 sec, 72°C for 60 sec, 34 cycles; 72°C extension for 5 min; purification of PCR products.

[0086] Homologous recombination ligation: The pCAMBIA1300 vector was digested with HindIII, and the digestion product and the corresponding fusion fragment were ligated to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain a protein vector containing GDP-R1V (Example 2) and GDP-R2V (Example 2).

[0087] (1) Co-expression of GDP-R1V and protease avrRpt2 or TuMV-NIa in Nicotiana benthamiana can induce plant hypersensitive (HR) response:

[0088] The trial was divided into 7 groups: GDP-R1V, GDP-R1V+TuMV-NIa, GDP-R1V+avrRpt2, GDP-R1V+avrRpt2 C122A (avrRpt2 inactive state), GDP-C, GDP-N, and pCAMBIAsuper1300 empty vector (EV). C122A (avrRpt2 inactivated state), GDP-C, and GDP-N were constructed into pCAMBIAsuper1300 vector and transformed into Agrobacterium GV3101. After 16 h of shaking culture, the bacteria were resuspended in infection solution (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone) and the GDP-R1V, GDP-C, GDP-N, and EV OD were adjusted. 600 To 0.5 for single injection. For mixed injection, adjust GDP-R1V, TuMV-NIa, avrRpt2 and avrRpt2 C122A (avrRpt2 inactive state) OD 600 to 1, GDP-R1V and TuMV-NIa, GDP-R1V and avrRpt2, GDP-R1V and avrRpt2 C122A Mix them in a volume ratio of 1:1. GDP-R1V, GDP-R1V+TuMV-NIa, GDP-R1V+avrRpt2, GDP-R1V+avrRpt2C122A (avrRpt2 inactivated state), GDP-C, GDP-N and empty vector control EV were injected into four-week-old Nicotiana benthamiana leaves. 24h after injection, the tobacco leaves were observed and photographed under white light. The results are shown in Figure 3 As shown in a, co-injection of GDP-R1V with the enzymatically active avrRpt2 or protease TuMV-NIa can produce a strong HR response at 24 h, just like GDP-N.

[0089] 20 hours after the injection of tobacco, the total protein of tobacco leaves in the above 7 groups of experiments was extracted and verified by Western blot using GDP-specific antibody. Figure 3 b The results showed that GDP-R1V could be cleaved by the enzymatically active avrRpt2 or protease TuMV-NIa, releasing the GDP-N-terminus ( Figure 3 b※shown in Figure 5), which induces a strong HR response in plants.

[0090] (2) Co-expression of GDP-R2V and protease avrRpt2 or TuMV-NIa in Nicotiana benthamiana can induce plant hypersensitive (HR) response:

[0091] The trial was divided into 7 groups: GDP-R2V, GDP-R2V+TuMV-NIa, GDP-R2V+avrRpt2, GDP-R2V+avrRpt2 C122A (avrRpt2 inactive state), GDP-C, GDP-N, and pCAMBIAsuper1300 empty vector (EV). C122A (avrRpt2 inactivated state), GDP-C, and GDP-N were constructed into pCAMBIAsuper1300 vectors and transformed into Agrobacterium GV3101. After 16 h of shaking culture, the bacteria were resuspended in infection solution (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone) and the GDP-R2V, GDP-C, GDP-N, and EV OD were adjusted. 600 To 0.5 for single injection. For mixed injection, adjust GDP-R2V, TuMV-NIa, avrRpt2 and avrRpt2 C122A (avrRpt2 inactive state) OD 600 to 1, GDP-R2V and TuMV-NIa, GDP-R2V and avrRpt2, GDP-R2V and avrRpt2 C122A Mix them in a volume ratio of 1:1. C122A (avrRpt2 inactive state), GDP-C, GDP-N and empty vector control EV were injected into four-week-old Nicotiana benthamiana leaves. 24h after injection, the tobacco leaves were observed and photographed under white light. Figure 3 As shown in c, co-injection of GDP-R2V with the enzymatically active avrRpt2 or protease TuMV-NIa can produce a strong HR response at 24 h, just like GDP-N.

[0092] 20 hours after the injection of tobacco, the total protein of tobacco leaves in the above 7 groups of experiments was extracted and verified by Western blot using GDP-specific antibody. Figure 3 d The results showed that GDP-R2V could be cleaved by the enzymatically active avrRpt2 or protease TuMV-NIa, releasing the GDP-N-terminus ( Figure 3 d※shown), causing a strong HR response in plants.

[0093] (3) Nicotiana benthamiana expressing avrRpt2 and avrRpt2 alone C122A (avrRpt2 inactive state) and TuMV-NIa protease cannot induce plant hypersensitive (HR) response:

[0094] The trial was divided into 6 groups: avrRpt2, avrRpt2 C122A (avrRpt2 inactive state), TuMV-NIa, GDP-N, GDP-C and pCAMBIA1300 empty vector (EV). C122A (avrRpt2 inactivated state), TuMV-NIa, GDP-N, and GDP-C were constructed into pCAMBIA1300 vector and transformed into Agrobacterium GV3101. After 16 h of shaking culture, the cells were resuspended in infection solution (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone) and avrRpt2, avrRpt2 C122A (avrRpt2 inactive state), TuMV-NIa, GDP-N, GDP-C and EV OD 600 to 0.5, and injected into four-week-old Nicotiana tabacum leaves. 24 hours after injection, the tobacco leaves were observed and photographed under white light. Figure 3 e As shown, avrRpt2 and avrRpt2 were expressed alone. C122A (avrRpt2 inactive state) and TuMV-NIa protease cannot induce plant hypersensitive (HR) response.

[0095] Example 4

[0096] Analysis of the resistance of recombinant GDP (GDP-R1V (obtained in Example 2), GDP-R2V (obtained in Example 2)) transgenic tobacco to TuMV-GFP virus

[0097] S1. Preparation of recombinant GDP-R1V, GDP-R2V and GDP (without restriction site inserted) transgenic tobacco materials

[0098] The GDP constructed into the pCAMBIA1300 vector in Example 1 and the GDP-R1V and GDP-R2V vectors constructed into the pCAMBIA1300 vector in Example 3 were used to prepare transgenic Nicotiana benthamiana. The transgenic method was as follows:

[0099] (1) Agrobacterium infection of tobacco: Cut Nicotiana benthamiana leaves into 2 cm pieces. 2 The leaves were cultured on co-culture medium (MS medium + NAA (0.1 mg / L) + 6-BA (1.5 mg / L)), and the cut leaves were placed in Agrobacterium liquid containing GDP or recombinant GDP protein vector with an OD value of 0.4-0.6 and soaked for 10 minutes. Then the bacterial liquid was poured out and the leaves were transferred to sterile filter paper, the bacterial liquid was discarded and dried.

[0100] (2) Differentiation and screening of transgenic tobacco: Leaves that have been co-cultured for 3 days are transferred to the culture medium. Culture is carried out under a light condition of 25 degrees. After culturing for two to three weeks, the tobacco shoots that have grown are cut off and transferred to the seedling medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin + 100 mg / L cephalosporin) for culture.

[0101] (3) Rooting of transgenic tobacco: Tobacco seedlings with roots were selected and transferred to rooting medium (MS + 30 mg / L hygromycin + 100 mg / L cephalexin) for culture and testing.

[0102] (4) Extract genomic DNA samples using the CTAB method.

[0103] (5) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 1500 bp. The PCR products were sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and GDP-R1V, GDP-R2V, and GDP transgenic tobacco were obtained and named NbR1V, NbR2V, and NbGD, respectively.

[0104] The PCR detection primers are as follows: SeqGDP-F: ATGCCATCCGCTTTCGA (SEQ ID NO. 20), SeqGDP-R: TCAGCACGGCTTCTGGC (SEQ ID NO. 21).

[0105] After culturing the NbR1V, NbR2V, and NbGD transgenic tobaccos obtained above for one month, disease resistance immunity tests were performed.

[0106] The TuMV infectious clone vector carrying GFP was transformed into Agrobacterium tumefaciens GV3101 strain and cultured at 28°C for 16 h. The bacteria were resuspended in infection solution (10 mM MgCl2, 10 mM MES and 100 μM acetosyringone) and the TuMV OD was adjusted. 600 To 0.5, two young leaves above transgenic tobacco and wild-type tobacco (WT) that had been cultured for one month were injected. NbR1V and NbR2V transgenic tobacco were used as the experimental group, and NbGD and WT tobacco were used as the control group. At 9 days after inoculation (dpi), photos were taken and counted under ultraviolet (UV) light. At the same time, the systemic leaves above the injected tobacco leaves were extracted and qPCR was performed to determine the expression of the TuMV virus capsid protein CP gene. In short, the systemic leaves were quickly placed in liquid nitrogen for freezing. Liquid nitrogen was ground and used for RNA extraction. Total RNA was extracted from the samples using RNAprep Pure Plant Kit (TianGen Biotech; China). RNA was purified from total RNA using DNase I (Thermo Scientific). Complementary DNA (cDNA) was synthesized using HiScript II First-Strand cDNA Synthesis Kit (Vazyme). qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System and C1000 Thermal Cycler (Bio-Rad) using SYBR Green Mix (Vazyme). The method was used to calculate the expression levels of genes. At least three biological replicates were performed for each group.

[0107] The results are as follows Figure 4 As shown by Figure 4 a It can be seen that the content of TuMV-GFP in leaves of NbR1V and NbR2V systems was significantly lower than that of the control group. Figure 4 b It can be seen that the expression level of TuMV coat protein CP gene is also significantly lower than that of the control group. In summary, NbR1V and NbR2V transgenic tobacco have significant resistance to TuMV virus.

[0108] Example 5

[0109] Analysis of the resistance of recombinant GDP (GDP-R1V, GDP-R2V) transgenic Arabidopsis to Pseudomonas syringae Pst DC3000 (avrRpt2)

[0110] S1. Connect GDP-R1V, GDP-R2V and GDP genes into pCAMBIA2300 vector for construction of Arabidopsis transgenic materials.

[0111] Primer design:

[0112] P2300-GDP-F: 5'-GATTACGAATTCGAGCTCATGCCATCCGCTTTCGA-3' (SEQ ID NO.22),

[0113] P2300-GDP-R: 5'-AGAGGATCCCCGGGTACCTCAGCACGGCTTCTGGC-3' (SEQ ID NO. 23).

[0114] Amplification of GDP-R1V, GDP-R2V, GDP gene fragments: Primer pairing is: P2300-GDP-F and P2300-GDP-R, and PCR amplification of GDP-R1V, GDP-R2V, GDP gene fragments is performed using the vector in Example 3 as a template. Reaction conditions are: 95°C pre-denaturation for 5 min; 95°C for 30 sec, 58°C for 40 sec, 72°C for 60 sec, 34 cycles; 72°C extension for 5 min.

[0115] Homologous recombination connection: pCAMBIA2300 vector was digested with KpnI, and the digestion product and the corresponding fragment were connected to construct an Arabidopsis expression vector, which was then transformed into Escherichia coli DH5α. Positive clones were screened by PCR to obtain the Arabidopsis expression vector.

[0116] S2. Transgenic method is as follows

[0117] (1) Robust Atrps2 deletion mutant Arabidopsis plants were grown under a long-day (16 h light, 8 h dark) environment (to verify the relationship between avrRpt2 and recombinant GDP, the Atrps2 deletion mutant was used as the background, and this mutant is susceptible to the Pseudomonas syringae strain PstDC3000 carrying avrRpt2).

[0118] (2) Cut off the first 1-5 cm long primary inflorescence (to promote the growth of more lateral inflorescences). Perform infiltration transformation within one week after pruning (usually 3-5 days). In addition, the plant should be fully watered 1 day before infiltration transformation so that the plant stomata can fully open during transformation.

[0119] (3) Prepare Agrobacterium liquid. First, use 1 ml of LB medium containing antibiotics to culture the Agrobacterium liquid that has been transformed with the target expression vector. Then, take 150 μl of the overnight culture liquid and add it to 150 ml of fresh liquid LB medium and culture it at 28°C with shaking for 24 hours.

[0120] (4) Centrifuge the bacterial solution at 4000 x g for 20 min, then resuspend the bacteria in 120 ml of infiltration solution (10% sucrose + 400 μl / L Silwet-77, mix thoroughly before dipping, OD 600=0.8-1.0). At the same time, cut off the fruit pods and fully opened flowers on the plants.

[0121] (5) Immerse the above-ground part of the plant in the bacterial solution for 1 min and shake it gently.

[0122] (6) Cover the infected plants with plastic wrap to maintain humidity, culture them in the dark for 1 day, and then place them under normal culture conditions. Remove the plastic wrap after 2 to 3 days. Water them about 1 week after transformation and continue to infect them several times at regular intervals.

[0123] (7) Continue culturing until the plants mature, collect the seeds and place them in a dry environment for about a week, then select the transformants.

[0124] S3. After culturing the AtR1V, AtR2V, AtGD transgenic Arabidopsis and Atrps2 Arabidopsis obtained above for one month, a disease resistance test was performed, with AtR1V and AtR2V as the test group and AtGD and Atrps2 as the control group.

[0125] The avrRpt2-carrying Pseudomonas syringae strain PstDC3000 (avrRpt2) was inoculated into 2 mL of KB liquid medium containing kanamycin and cultured overnight at 28 °C on a shaker. The cells were collected by centrifugation at 4000 rpm for 5 min, the supernatant was discarded, and the cells were washed twice with ddH2O, and the liquid was drained with a vacuum pump. 500 μL of 10 mM MgCl2 was added to resuspend the cells, and then diluted 10 times (100 μL of bacterial solution + 900 μL ddH2O) and the bacterial OD was measured with a spectrophotometer. 600 Then dilute with 10 mM MgCl2 to OD 600 =5×10 -4 . Hold the leaf gently with your fingers, use a 1mL needleless syringe to take 100μL of bacterial solution and gently inject it into the lower epidermis of the marked leaf. You can clearly see the liquid entering the leaf to moisten the leaf. Use absorbent paper to wipe off the residual water on the leaf surface. 3 days after inoculation (dpi), collect 8 leaf discs and arrange them according to the severity of the disease. The most serious and the lightest diseased are combined in pairs. Then use a hole puncher to punch the leaves into leaf discs and put them into 4 1.5mL centrifuge tubes containing 100μLddH2O, 2 discs in each tube. Use an electric grinder to grind the leaf discs and add 900μL H2O to mix. Continuously dilute the gradient and count the bacterial biomass.

[0126] The results are as follows Figure 5 As shown. Figure 5 As can be seen from a and 5b, the disease severity of AtR1V and AtR2V transgenic Arabidopsis in the experimental group was significantly lower than that in the experimental group. Figure 5c It can be seen that the bacterial biomass in the experimental group AtR1V and AtR2V transgenic Arabidopsis was significantly lower than that in the control group Atrps2 and AtGD. In summary, AtR1V and AtR2V transgenic tobacco have significant resistance to Pseudomonas syringae strain PstDC3000 (avrRpt2).

[0127] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A recombinant GDP gene, characterized in that: The recombinant GDP gene has a linker inserted between the 828th and 829th nucleotides of the GDP gene shown in the nucleotide sequence of SEQ ID NO.1, wherein the linker is a series connection of a pathogen effector and a protease recognition cleavage sequence; The pathogen effector recognition cleavage sequence is the RIN4 protease cleavage site, and the protease recognition cleavage sequence is the TuMV-NIa enzyme cleavage site; the nucleotide sequence of the RIN4 protease cleavage site is shown in SEQ ID NO.2 or SEQ ID NO.3, and the nucleotide sequence of the TuMV-NIa enzyme cleavage site is shown in SEQ ID NO.4; The nucleotide sequence of the recombinant GDP gene is shown in SEQ ID NO.5 or SEQ ID NO.

6.

2. A recombinant expression vector containing the recombinant GDP gene according to claim 1.

3. The recombinant expression vector according to claim 2, characterized in that The empty vector of the recombinant expression vector is pCAMBIA1300.

4. Use of the recombinant GDP gene according to claim 1 or the recombinant expression vector according to any one of claims 2 to 3 in tobacco against Turnip mosaic virus or in Arabidopsis thaliana against Pseudomonas syringae Pst DC3000 (avrRpt2).

5. A method for improving tobacco resistance to Turnip Mosaic Virus, characterized in that: The method comprises the following steps: transfecting the recombinant GDP gene according to claim 1 or the recombinant expression vector according to any one of claims 2 to 3 into tobacco.

6. A method for improving the resistance of Arabidopsis thaliana to Pseudomonas syringae Pst DC3000 (avrRpt2), characterized in that: The method comprises the following steps: transfecting the recombinant GDP gene according to claim 1 or the recombinant expression vector according to any one of claims 2 to 3 into Arabidopsis thaliana.

Images