A SNP locus associated with the number of spikelets per ear of wheat and its application

Abstract

The present invention discloses a SNP site related to the number of spikelets per ear of wheat and its application. The SNP site corresponds to the 723rd base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; for the phenotype of the number of spikelets per ear of wheat, wheat with homozygous genotype A is less than wheat with homozygous genotype B. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in both the theoretical and practical application levels of breeding high-yield wheat varieties.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, in particular to a SNP site related to the number of spikelets per ear of wheat and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L) is one of the important food crops in my country. With the increase of population, the frequent occurrence of biological and non-biological disasters threaten the yield of wheat. Therefore, it is particularly important to improve the high and stable yield of wheat. Among the three elements of crop yield, the number of grains per ear is an important trait that determines the yield of crops. Increasing the number of spikelets per ear can increase the number of grains per ear and ultimately increase yield.

[0003] In recent years, genes related to spikelet number have been cloned one after another, and some progress has been made in breeding by increasing spikelet number. Muqaddasi, Kuzay, and Voss-Fels et al. identified WAPO1 / TaAPO-A1 on chromosome 7AL through different methods, which positively regulates the number of spikelets per spike of wheat. Li et al. identified the spike structure of hundreds of wheat varieties grown in northern China, discovered a multi-spikelet local variety YM44, and cloned it into WFZP. Haplotype analysis of the gene showed that the single SNP difference of WFZP-A in the natural population of wheat led to different expression levels, which in turn affected the number of spikelets per spike and 1000-grain weight. This haplotype was selected in the breeding process. Zhang et al. compared MOC1 of rice and Arabidopsis thaliana and believed that TaMOC1 may be related to the development of wheat spikelets. Further studies showed that TaMOC1 was highly expressed in spikelets of 2, 3, and 6 cm in length. There was a significant correlation between the TaMOC1-7A haplotype and the number of spikelets per panicle. The aggregation of favorable alleles TaMOC1-7A and TaSnRK2.10 could simultaneously increase the number of spikelets per panicle and 1000-grain weight.

[0004] Among the three elements that constitute yield, increasing the number of effective spikelets is more conducive to increasing the grain weight per ear and thus achieving yield growth when the number of ears per plant or group remains unchanged.

[0005] Therefore, based on the existing technology, developing and designing a primer and related molecular markers for identifying the number of spikelets per ear of wheat is of great significance both in theory and practical application. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a SNP site related to the number of spikelets per ear of wheat and an application thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] The present invention includes a SNP site related to the number of spikelets per ear of wheat, corresponding to the 723rd base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; for the phenotype of the number of spikelets per ear of wheat, wheat with homozygous genotype A is less than wheat with homozygous genotype B.

[0009] The present invention also creates a molecular marker corresponding to the 568-742 bp from the 5' end of the sequence shown in SEQ ID NO.1; the genotype of the SNP site in claim 1 is distinguished by PCR amplification and enzyme digestion identification of the molecular marker.

[0010] The present invention also creates a primer combination, including primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used as the specific primer for PCR amplification described in claim 2.

[0011] The present invention also creates a kit for detecting the genotype of the SNP site described in claim 1, which at least includes the primer combination described in claim 3.

[0012] As a preferred technical solution of the present invention, the kit also includes necessary restriction endonuclease components.

[0013] As a preferred technical solution of the present invention, the restriction endonuclease is TaqI enzyme.

[0014] As a preferred technical solution of the present invention, the kit also includes a buffer, dNTPs and / or other necessary components required for PCR amplification.

[0015] The present invention also creates the use of the SNP site, or the molecular marker, or the primer combination, or the kit for identifying or assisting in identifying the trait of the number of spikelets per ear of wheat.

[0016] As a preferred technical solution of the present invention, in the early stage of molecular marker-assisted selection breeding (MAS), the genotype of the SNP site is identified to obtain wheat varieties with a higher or lower number of spikelets per ear, thereby conducting directed breeding or assisted directed breeding of wheat.

[0017] The present invention also creates a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment containing the SNP site described in claim 1 in the wheat genomic DNA to be tested is subjected to PCR amplification, and the PCR amplification product is subjected to enzyme digestion for identification; the PCR amplified DNA fragment is 568-742 bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 1F and 1R composed of SEQ ID NO.4 and SEQ ID NO. NO.5, a primer pair 2F and 2R; the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 10 times, using it as a template, and amplifying to obtain a PCR product with primers 2F and 2R as a primer pair; using restriction endonuclease TaqI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is T / T and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is B; for the phenotype of spikelet number per ear of wheat, wheat homozygous for genotype A is less than wheat homozygous for genotype B.

[0018] The beneficial effect of adopting the above technical scheme is that: based on the genetic variation analysis of the genes of the natural variation population of wheat, the research group of the present invention found that there is a major effect SNP, corresponding to the 723rd position from the 5' end of Sequence Table 1. By designing a dCAPS marker for the SNP site, it was found that the SNP has two genotypes: genotype A (T) and genotype B (C). Association analysis proved that in the homozygous types of these two genotypes, the number of spikelets per ear is: wheat homozygous for genotype A < wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of spikelets per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in both the theoretical and practical application levels of breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the electrophoresis detection result of the SNP development dCAPS labeling enzyme digestion product of the present invention; wherein, M is used as a molecular weight standard; lane T is a band that cannot be cut by TaqI, and lane C is a band that is cut by TaqI.

[0020] Figure 2 This is a schematic diagram of the results of the association analysis between the status of gene polymorphism sites in natural populations and the number of spikelets per ear. DETAILED DESCRIPTION

[0021] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0022] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or combinations thereof.

[0023] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0024] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0025] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0026] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm). Material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0028] Example 1: Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0029] One SNP was found on the wheat genome, corresponding to position 723 from the 5' end of sequence table 1. The present invention was created based on this scientific discovery.

[0030] Specifically, by designing dCAPS markers for the SNP site, it was found that there are two genotypes of this site in the natural variation population of wheat:

[0031] Genotype A: T

[0032] Genotype B: C

[0033] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0034] F1: CTCGAAGGATTTCTCTCTCATAGTCG (SEQ ID NO.2);

[0035] R1: TACAGGTTCTGTGGCAGATAGCCTGTGG (SEQ ID NO.3);

[0036] F2: TGACGACTGAGCCTGTTCC (SEQ ID NO.4);

[0037] R2: CAACCGCATACCAATTATC (SEQ ID NO. 5).

[0038] The target sequence amplified by PCR using F1 and R1 as primers is the 100-1710 sequence shown in sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 568-742 sequence shown in sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by TaqI respectively.

[0039] Example 2: Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0040] 1) Extracting genomic DNA of wheat to be tested;

[0041] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (20 μL) was: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL of template (50 ng / μL).

[0042] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 3) The PCR product of step 2) was diluted 10 times and used as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) was: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50 ng / μL).

[0044] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0045] 4) The PCR product obtained in step 3) is digested with TaqI to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the said site is determined and recorded according to the following method:

[0046] If the enzyme cleavage product is a larger fragment: 175 bp, then the wheat to be tested is T homozygous (expressed as T / T) at the site ( Figure 1 Lane T in the middle);

[0047] If the enzyme cleavage product is a smaller fragment: 156 bp, then the wheat to be tested is C homozygous (expressed as C / C) at the site ( Figure 1 Lane C in the figure).

[0048] 5) According to the result of step 4), the wheat is divided into two types, I and II, at the site:

[0049] I: T / T (i.e., homozygous for genotype A);

[0050] II: C / C (i.e., homozygous for genotype B);

[0051] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0052] Example 3: Typing of natural populations using dCAPS markers and association analysis with the number of spikelets per ear

[0053] Each wheat in the natural population consisting of 323 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0054] Table 1. The status of the polymorphic sites in natural wheat populations

[0055]

[0056]

[0057]

[0058]

[0059] Example 4: Association analysis between the status of gene polymorphism sites in natural populations and the number of spikelets per ear

[0060] The above natural population wheat was planted in hydrothermal land and water land of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing). The following year, the wheat was planted in hydrothermal land and water land of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing and Changping). The number of spikelets per ear of each wheat variety was investigated. The Tassel2.1 software was used to conduct association analysis between the number of spikelets per ear and the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and the attached Figure 2 shown.

[0061] Table 2 Results of association analysis between gene polymorphisms and the number of spikelets per ear in natural populations

[0062]

[0063] The results of association analysis in Table 2 show that the differences in the number of spikelets per ear of the two types formed by the natural population composed of 323 hexaploid wheats shown in Table 1 all reached a significant level (P<0.05 or P<0.01). Among them, the number of spikelets per ear of type II wheat is lower than that of type II wheat. In several environments, the number of spikelets per ear of type I wheat materials is 0.26, 0.22, 0.57, 0.35, 0.25, 0.38 and 0.26 less than that of II wheat, respectively. Studies on natural populations have shown that type II is an excellent genotype for increasing the number of spikelets per ear of wheat.

[0064] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0065] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0066] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. Molecular marker, corresponding to the 568-742bp from the 5' end of the sequence shown in SEQ ID NO.1; PCR amplification and enzyme digestion identification of this molecular marker to distinguish the genotype of the SNP site; The SNP site is a SNP site related to the number of spikelets per ear of wheat, corresponding to the 723rd base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for T / T, the corresponding genotype is A; when the site is homozygous for C / C, the corresponding genotype is B; for the phenotype of the number of spikelets per ear of wheat, wheat homozygous for genotype A is less than wheat homozygous for genotype B.

2. A primer combination, comprising a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used as a specific primer for the PCR amplification described in claim 1.

3. A kit for detecting the genotype of the SNP site according to claim 1, comprising the primer combination according to claim 2.

4. The kit according to claim 3, characterized in that: The kit also includes a restriction endonuclease component.

5. The kit according to claim 4, characterized in that: The restriction endonuclease is Taq I enzyme.

6. The kit according to claim 3, 4 or 5, characterized in that: The kit also includes a buffer and dNTPs required for PCR amplification.

7. A method for identifying or assisting in identifying wheat genotypes, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion; the DNA fragment amplified by PCR is 568-742 bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is a primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the enzyme digestion comprises the following steps: The PCR product was obtained by using wheat genomic DNA as template and primers 1F and 1R as primer pair; The PCR product was diluted 10 times and used as a template to amplify the PCR product using primers 2F and 2R as a primer pair; Use restriction enzyme Taq I digests the PCR product; If the PCR product can be cut, the SNP site is T / T and the genotype is A; if the PCR product cannot be cut, the SNP site is C / C and the genotype is B; for the phenotype of the number of spikelets per ear of wheat, wheat homozygous for genotype A is less than wheat homozygous for genotype B.

Images