Recombinant Meq gene-deficient Marek's disease virus strain expressing varIBDV VP2 gene and its construction method and application

Abstract

The invention discloses a recombinant vector for expressing varIBDV VP2 gene Meg Gene-deficient Marek's disease virus strain and its construction method and application. Meg The gene-deficient Marek's disease virus strain is obtained by using recombinant cloning technology to insert the gene fragment CMV-VP2 containing the CMV promoter sequence, varIBDV VP2 gene and terminator sequence into the Meg The gene-deleted Marek's disease virus strain rMSΔMeq US2 gene was obtained by replacing the nucleotide sequence between positions 156501-157116 of the rMSΔMeq genome, and was named rMDV-varVP2. Studies have shown that the recombinant obtained by the present invention Meg The gene-deficient Marek's disease virus rMDV-varVP2 has the same in vitro replication ability and good genetic stability as the parent virus rMSΔMeq strain, and rMDV-varVP2 can provide good protection against IBDV mutants after immunizing chickens. The present invention provides a technical means for the development of a recombinant MDV live vector vaccine.

Description

Technical Field

[0001] The present invention relates to a recombinant Marek's disease virus strain, and also relates to a construction method and application of the virus strain. The present invention belongs to the technical field of medicine or veterinary medicine. Background Art

[0002] Infectious bursal disease (IBD) is an acute, highly contagious, immunosuppressive, and fatal infectious disease caused by infectious bursal disease virus (IBDV) that mainly harms chicks. It is listed as a "socioeconomically important disease" by the International Office of Epizootics (OIE). It has always threatened the development of the poultry industry. In recent years, the emergence of new variants of IBDV (varIBDV) has further aggravated the harm of the disease. Infected chickens will fail to be immune to avian influenza, Newcastle disease, etc. IBDV belongs to the genus avian birnavirus of the family Birnaviridae. Its genome consists of two double-stranded RNA segments, of which the VP2 protein encoded by the A segment is the only capsid protein of IBDV and the main host protective antigen of IBDV. Vaccine immunity is the main means of preventing and controlling IBDV, but IBDV is highly pathogenic and not suitable for cell culture. Vaccine strains can only be obtained by attenuating wild IBDV by propagating it in chicken embryos or CEF cells. This traditional domestication method is time-consuming and labor-intensive, and the results are random. At the same time, there is currently no effective commercial vaccine against varIBDV, so there is an urgent need to develop new IBD vaccines that are safer and more effective.

[0003] Marek's Disease (MD) is a highly contagious, tumorous disease caused by Marek's Disease Virus (MDV) infection that seriously harms the development of the poultry industry. The disease can cause multiple lymphomas in chickens, leading to chicken failure and death, while damaging the immune organs of the chickens, causing severe immunosuppression, and is prone to complications of other diseases. The disease has a long course, and the occurrence of the disease often leads to the elimination of the entire flock. Once the disease occurs, the losses are often particularly huge. Vaccines are the main means of controlling the disease. MD vaccines are a must-use vaccine in breeder flocks and laying hens. The use of this vaccine in broiler flocks can significantly improve breeding efficiency.

[0004] Recombinant live vector vaccines are live vaccines that use genetic engineering technology to construct a virus or bacteria into a vector, and then insert foreign genes into it for expression. This type of vaccine induces a wide range of immunity in the body, including humoral immunity, cellular immunity, and even mucosal immunity; more importantly, live vector vaccines can express multiple antigens at the same time to make multivalent or multi-unit vaccines, which can prevent multiple diseases with one shot. It is one of the main directions of vaccine research and development today and in the future. Studies have shown that the herpes virus genome is large and has many replication-non-essential genes that can be inserted or replaced by foreign genes. It is an ideal viral vector for constructing recombinant live vector vaccines. At present, there have been a large number of research reports on herpes virus live vector vaccines. As a member of the herpesviridae family, MDV is also a good live vaccine vector. MDV is immunized at 1 day old in chickens, so immunity occurs early and exogenous proteins can be expressed continuously, thus producing lasting immunity in the body; MDV is a cell-bound virus, and after vaccination, the virus spreads between cells and is relatively less interfered by maternal antibodies; MDV exists in cells and is not easy to cause vector effects, so different types of MDV can be used for synergistic immunity or multiple vaccinations; MDV's natural host is only poultry, and it is safe for other livestock and humans. Compared with HVT vectors, MDV serotype I vaccine vectors can provide better immune protection against MD.

[0005] At present, the vaccines used for MD prevention are mainly serotype 1 vaccines, with representative strains being CVI988, 814 and rMSΔMeq, which have good protection against super-virulent MDV. Among them, the CVI988 strain was isolated and identified in the Netherlands in the 1970s, and the 814 strain was isolated and identified by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, and the serotype 1 MDV attenuated vaccine strain was successfully cultivated in 1981. The rMSΔMeq strain was isolated and identified by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences and is a new type of Marek's disease gene-deficient live vaccine successfully developed in 2021. The vaccine has good immunogenicity and can resist attacks of MDVs of different virulences. Since it was launched in 2022, it has good safety and no adverse reactions to chickens. The rMSΔMeq strain has the characteristics of the current MDV epidemic strains in my country, and its traits are stable. It is an ideal carrier for constructing a live vector vaccine for MDV.

[0006] In previous studies, the inventors successfully established the Marek's disease virus Meq The gene-deficient vaccine strain (rMSΔMeq strain) multi-segment rescue system was used to construct a recombinant expressing the varIBDV protective antigen VP2 gene. Meq The biological activity and immune efficacy of the recombinant Marek's disease virus (rMDV-varVP2) were evaluated. MeqSPF chickens vaccinated with gene-deficient Marek's disease virus rMDV-varVP2 can provide complete protection against the attack of IBDV variant strains. The immunized chickens survived the infection completely without any clinical symptoms. The bursa of Fabricius of the immunized chickens did not atrophy and had no obvious pathological changes. Summary of the invention

[0007] The object of the present invention is to provide a recombinant strain expressing the varIBDV VP2 gene Meq Gene-deficient Marek's disease virus vaccine strain, construction method and application thereof.

[0008] In order to achieve the above object, the present invention adopts the following technical means:

[0009] A recombinant strain expressing the VP2 gene of a novel variant of chicken infectious bursal disease virus (varIBDV) of the present invention Meq Gene-deficient Marek's disease virus strain, which is obtained by inserting a gene fragment CMV-VP2 containing a CMV promoter sequence, varIBDVVP2 gene and a terminator sequence into a Marek's disease virus using recombinant cloning technology Meq Recombinant expression of varIBDV VP2 gene obtained by deleting the gene inside the vaccine strain US2 Meq Gene-deleted Marek's disease virus strains.

[0010] Wherein, preferably, the Marek's disease virus Meq The gene-deficient vaccine strain is the rMSΔMeq strain, which is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, and its microbial deposit number is: CGMCC No.4612.

[0011] Preferably, the recombinant expressing the VP2 gene of the novel variant of chicken infectious bursal disease virus (varIBDV) Meq The gene-deficient Marek's disease virus strain is a gene fragment CMV-VP2 containing the CMV promoter sequence, varIBDV VP2 gene and terminator sequence inserted into the Marek's disease virus Meq The gene was deleted in the US2 gene of the vaccine strain rMSΔMeq strain, and the nucleotide sequence between positions 156501-157116 of the rMSΔMeq genome was replaced to obtain a recombinant expressing the varIBDVVP2 gene Meq Gene-deleted Marek's disease virus strains.

[0012] Among them, preferably, the varIBDV is the new variant strain of IBDV SHG19.

[0013] Among them, preferably, the nucleotide sequence of the gene fragment CMV-VP2 is shown in SEQ ID NO.12.

[0014] Furthermore, the present invention also proposes a method for constructing a recombinant expressing the varIBDV VP2 gene. Meq The method for producing a gene-deficient Marek's disease virus vaccine strain comprises the following steps:

[0015] (1) Marek's disease virus Meq Construction of a reverse genetics operating system for the gene-deleted vaccine strain rMSΔMeq

[0016] The reverse genetics operating system comprises the following: Meq The gene-deficient vaccine strain rMSΔMeq contains five cosmids with nucleotide sequences at positions 1-47178, 42801-87422, 87223-125265, 121752-159339 and 159189-177526 of the genome, each of which is a cosmid containing the corresponding Marek's disease virus Meq The gene fragments of the gene-deficient vaccine strain rMSΔMeq strain were cloned into pCC1Fos and named pMS-1, pMS-2, pMS-3, pMS-4 and pMS-5, wherein pMS-4 contains the US2 gene of the rMSΔMeq strain; the chicken Marek's disease virus Meq The GenBank accession number of the genome sequence of the gene-deleted vaccine strain rMSΔMeq is JQ314003.1;

[0017] (2) Construction and identification of recombinant cosmid expressing varIBDV VP2 gene

[0018] The pMS-4 cosmid was transfected into competent cells containing pRed E / T expression plasmid to prepare competent cells; the rpsl-neo expression cassette DNA was used as a template, and the primers US2-rpsl F / R were used to amplify the rpsl-neo gene fragment containing the homologous arms at both ends of the US2 insertion site by PCR, which was purified and transfected into competent cells containing pMS-4 to prepare competent cells; the expression plasmid containing the VP2 gene of the new variant of IBDV SHG19 strain was used as a template, and the primers US2-CMV F / R were used to amplify the CMV-VP2 gene fragment containing the homologous arms at both ends of the US2 insertion site, which was purified and electroporated into competent cells containing rpsl-neo, and the positive colonies were picked and expanded for culture to extract the cosmid, and the obtained cosmid was named pMS-varVP2; the primers required for construction are as follows:

[0019]

[0020] (3) Rescue of recombinant viruses

[0021] Extract the five cosmid DNAs of pMS-1, pMS-2, pMS-3, pMS-varVP2 and pMS-5; co-transfect the five cosmids into the secondary CEF by calcium phosphate transfection method, observe whether the transfected cells show MDV-specific plaque lesions after 4-5 days; harvest the virus after plaques appear, continuously passage and preserve in CEF cells, extract the genomic DNA of the recombinant virus by kit, and set the parental virus genomic DNA control at the same time, identify by PCR with primers varVP2F / R: 5'ATGACAAACCTGCAAGATCA 3' and 5'TTACCTTAGGGCCCGAATTA 3', and identify by sequencing, and the correct recombinant virus is the recombinant virus expressing varIBDV VP2 gene. Meq The gene-deficient Marek's disease virus vaccine strain was named rMDV-varVP2.

[0022] Among them, preferably, the expression plasmid containing the VP2 gene of IBDV SHG19 strain is obtained by amplifying the VP2 gene using the varIBDV SHG19 strain genome as a template and then cloning it into the CMV expression box of the vector pEGFP-N1, named pCMV-VP2, wherein the gene fragment CMV-VP2 comprises the CMV promoter sequence, varIBDV VP2 gene and terminator sequence.

[0023] Furthermore, the present invention also proposes the recombinant expression of the varIBDV VP2 gene Meq Use of gene-deficient Marek's disease virus strain in preparing medicine for preventing IBDV infection.

[0024] Among them, preferably, the IBDV is a new variant of IBDV.

[0025] Among them, preferably, the drug is a recombinant Marek's disease virus live vector vaccine expressing the varIBDV VP2 gene.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention utilizes recombinant cloning technology to insert the gene fragment CMV-VP2 containing the varIBDV (SHG19 strain) VP2 gene and the CMV promoter sequence into the Marek's disease virus Meq The US2 gene of the gene-deleted vaccine strain (rMSΔMeq strain) was inserted into the US2 gene, and the nucleotide sequence between positions 156501-157116 was replaced to construct a recombinant cosmid with the CMV-VP2 expression frame inserted into the US2 gene. The recombinant cosmid was co-transfected with the other four cosmids containing the rMSΔMeq genome into CEF cells to rescue the recombinant expressing the varIBDV VP2 gene.Meq Gene-deleted Marek's disease virus rMDV-varVP2. Studies have shown that the recombinant Meq The gene-deficient Marek's disease virus rMDV-varVP2 has the same in vitro replication ability and good genetic stability as the parent virus rMSΔMeq strain, and rMDV-varVP2 can provide good protection against IBDV variants after immunizing chickens. Meq The successful construction of gene-deficient Marek's disease virus rMDV-varVP2 provides a technical means for the development of recombinant MDV live vector vaccine expressing varIBDV VP2 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the result of PCR identification of the recombinant cosmid pMS-varVP2;

[0029] Figure 2 For reorganization Meq Cytopathic effect of gene-deficient Marek's disease virus rMDV-varVP2 on CEF;

[0030] Among them, A is rMDV-HA; B is Mock;

[0031] Figure 3 For reorganization Meq Figure 1 shows the PCR identification results of the gene-deficient Marek's disease virus rMDV-varVP2 genomic DNA;

[0032] Figure 4 Indirect immunofluorescence assay for detection of recombinant Meq Results of VP2 gene expression in CEF infected with gene-deficient Marek's disease virus (rMDV-varVP2) and parental virus (rMSΔMeq);

[0033] Figure 5 Western blot assay to detect recombination Meq Results of VP2 gene expression in CEF infected with gene-deficient Marek's disease virus (rMDV-varVP2) and parental virus (rMSΔMeq);

[0034] Figure 6 For reorganization Meq Replication kinetics of gene-deficient Marek's disease virus (rMDV-varVP2) and parental virus (rMSΔMeq) on CEF;

[0035] Figure 7 For reorganization MeqObservation of bursal atrophy in chickens immunized with gene-deficient Marek's disease virus (rMDV-varVP2) and parental virus (rMSΔMeq) after infection with the new variant of IBDV (SHG19 strain);

[0036] Figure 8 For reorganization Meq Statistical graph of bursal atrophy in chickens immunized with gene-deficient Marek's disease virus (rMDV-varVP2) and parental virus (rMSΔMeq) after infection with the new variant of IBDV (SHG19 strain). DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0038] Example 1 Construction of Marek's disease virus Meq gene-deficient vaccine strain rMSΔMeq

[0039] The Marek's disease virus Meq gene-deficient vaccine strain rMSΔMeq is described in the publication number CN102363769B, and the invention name is "Chicken Marek's disease virus Meq In the patent application for "Gene-deficient vaccine strain, construction method and application thereof", the specific construction method is as follows:

[0040] 1. Construction of recombinant virus transfer plasmid:

[0041] 1. Test methods

[0042] 1) Primer design and synthesis: Referring to the published gene sequence of MDV virulent GA strain (No.AF147806), primer pairs Primer A and Primer B were designed for Meq Fragments A and B on both sides of the gene are used as homologous sequences for constructing transfer vector plasmids. The upstream of primer pair LacZB is on the LacZ gene, and the downstream is on the recombination arm B, which is used to identify whether there is recombination; the upstream of primer pair ALB is on the recombination arm A, and the downstream is on the recombination arm B, which is used to identify the location and number of deletions. If the amplified size of primer ALB is 660 bp, it indicates Meq The gene is not deleted. If the amplified size is 4288 bp, it indicates that LacZ is inserted into the expected position. Meq The upstream and downstream are located at MeqThe two sides of the gene are used for PCR identification of the recombinant vector rMS-LacZΔMeq. For the detection of the parental virus MS strain, Meq The gene is intact, so the amplified fragment size is about 1.4Kb. For the recombinant strain rMSΔMeq, 468bp (shown in SEQ ID NO.1) is missing, and the amplified result is about 1kb. The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The primer names and sequences are shown in Table 1:

[0043]

[0044] 2) Preparation of DNA template: Chicken embryo fibroblasts (CEF) were prepared from 9-day-old SPF chicken embryos according to conventional methods. The MDV MS strain was inoculated into CEF and cultured in a 37°C 5 mL / L CO2 incubator. When the pathological rate reached 80%, the cells were digested and harvested, and total DNA was extracted according to conventional methods and dissolved with an appropriate volume of TE (pH7.4).

[0045] 3) Amplification and recovery of homologous fragments: The total viral genome DNA extracted above was used as a template for amplification. The reaction system was 25 μL: 17.5 μL of ultrapure water, 2.5 μL of 10×PCR reaction buffer, 1 μL of dNTP (10 mmol∙L-1), 1 μL of upstream and downstream primers (10 pmol∙L-1), 1 μL of rTaq enzyme (5 U∙μL-1), and 2 μL of DNA (0.5 μg∙μL-1). The two PCR reaction conditions were: denaturation at 94°C for 5 min, then denaturation at 94°C for 1 min, annealing at 57°C (annealing of B fragment at 58°C) for 1 min, extension at 72°C for 1 min, 30 cycles, and finally extension at 72°C for 10 min. The amplified products were identified by 1.0% agarose electrophoresis containing ethidium bromide (EB). The correctly identified products were recovered by fragment gel.

[0046] 4) Construction of transfer vector plasmid: Using genomic DNA of MDV MS strain as template, the transfer vector plasmid was obtained by PCR method. Meq The homology arm A of the upstream fragment of the gene was digested with SalⅠ and SphⅠ and connected to pUC19 to obtain plasmid pUCA; the B fragment obtained by PCR amplification was digested with SalⅠ and SacⅠ and connected to pUCA to obtain plasmid pUCAB. The LacZ expression gene cassette obtained by SalⅠ digestion was connected to the pUCAB plasmid to obtain plasmid pALacZB. The plasmid was extracted with Qiagen plasmid extraction kit, dissolved in TE with pH 7.4, and stored at -20℃ for later use.

[0047] II. Acquisition and identification of recombinant virus - rMSΔMeq

[0048] First recombination: 1) Co-transfection: MDV MS strain genomic total DNA and transfer vector plasmid pALacZB were co-transfected into CEF using calcium phosphate precipitation method. The specific method is as follows: chicken embryo fibroblasts were prepared. When CEFs grew into a monolayer within 24 hours, they were digested and subcultured into cell culture dishes with a diameter of 60 mm. The CEF inoculation amount was 9×10 6 First, add 388μL of nuclease-free deionized water to a clean and sterile 1.5mL centrifuge tube; then add 10~18µL of the prepared MS strain infected CEF genome total DNA (0.8 μg∙μL-1) and 2 μL of plasmid pALacZB (1 μg∙μL-1); add 30~36 μL TE (pH 7.4); slowly add 62μL 2mo1∙L-1 CaCl2 and mix slowly; use a 1mL pipette to slowly add 500μL of 2×HEPES from the bottom, use a 200μL micropipette to blow about 20 bubbles from the bottom to mix it, and place it in a 37℃ incubator for 30 minutes, during which it will be packaged into small precipitated particles; gently blow and resuspend the calcium phosphate DNA, evenly add it to the surface of the prepared CEF secondary cells, and gently shake the cell culture dish several times. At this time, the culture medium turns yellow-orange and is placed at 37℃5% CO2 incubator for 2-3 hours; discard the upper culture medium, rinse with serum-free culture medium or sterile PBS buffer 3 times, add 2mL of 15% glycerol shock solution to shock for 90 seconds, and then rinse with serum-free culture medium or sterile PBS buffer 3 times; add 3% fetal bovine serum culture medium to promote cell growth into a monolayer, and culture in a 37℃ 5% CO2 incubator. The whole process is operated under sterile conditions. After culturing for about 4-6 days, when typical Marek's plaques appear, proceed to the next step of cloning and purification.

[0049] 2) Plaque cloning and purification of recombinant virus: After plaques appear, place them under an inverted microscope for observation in order to prevent missed detection. Pour out the culture medium and add 2mL of 3% maintenance solution, add 20μL of X-Gal (20mg∙mL-1) to make the total concentration 0.2mg∙mL-1, and culture at 37°C, 5% CO2 for 2h. Select blue plaques for digestion, cloning and purification. Add 0.25% trypsin to the circled plaques, digest for several minutes, scratch with the tip of a gun a few times, suck up the digestion solution, add to the chicken embryo fibroblasts that have grown into a monolayer, suck out some of the maintenance solution from the plate with monolayer cells, wash the circled and digested plaques, add to the chicken embryo fibroblasts that have grown into a monolayer, continue to culture at 37°C, 5% CO2, and purify again after the plaques grow. After cloning, all plaques are blue.

[0050] 3) Identification of recombinant virus: The recombinant virus purified from plaques was inoculated on primary CEF. When the plaques grew to 70%, the cells were harvested and total DNA was extracted according to the molecular cloning method. LacZB primers and ALB primers were used for amplification respectively. The reaction system was 25μL: ultrapure water to 17 μL, 0×PCR reaction buffer 2.5μL, dNTP (10mmol∙L-1) 1 μL, upstream and downstream primers (10pmol) 1μL each, rTaq enzyme (5U∙μL-1) 1 μL, recombinant virus DNA 2μL (0.5μg∙μL-1). The reaction conditions for both PCR were: denaturation at 94℃ for 5min, then denaturation at 94℃ for 1min, annealing at 57℃ (annealing temperature of primer ALB is 58℃) ​​for 1min, extension at 72℃ (extension time of primer ALB is 4min) for 1min, 30 cycles, and finally extension at 72℃ for 10min. The PCR product was connected to the pMD-18T vector, and the bacterial solution was sent to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing and further identification. The purified virus was named: rMS-LacZΔMeq. The recombinant virus rMS-LacZΔMeq was detected by PCR using primer LacZB, and a band consistent with the expected size (1300bp) was obtained.

[0051] Meq The copy number of gene deletion was identified using primer ALB. The amplified size of the parental MS strain was about 656 bp, and the recombinant rMS-LacZΔMeq was about 4388 bp. The results showed that the size was consistent with expectations, indicating that the construction was correct. It also proved that both Meq genes of the recombinant virus rMS-LacZΔMeq were deleted.

[0052] Second recombination: The method is the same as the first recombination. The total genomic DNA of MDV rMS-LacZΔMeq strain and the transfer vector plasmid pUCAB are used for co-transfection to obtain the recombinant virus rMSΔMeq strain lacking Meq and LacZ.

[0053] Identification method of rMSΔMeq virus strain: The total DNA of rMSΔMeq infected CEF was extracted according to the conventional method. Meq The fragment size of the parental virus MS strain F5 was 1.4Kb, and the recombinant virus rMSΔMeq strain F25 was 1Kb, with no 1.4Kb band. The results were consistent with expectations, proving that the two recombinant viruses Meq The genes have been deleted. Sequencing results show Meq The first 468 bp of the gene ORF were deleted, which was consistent with the expected results of the experimental design.

[0054] Marek's disease virus MeqThe gene-deficient vaccine strain rMSΔMeq was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, and the microbial deposit number is: CGMCC No.4612.

[0055] Example 2 Recombination of varIBDV VP2 gene expression Meq Construction of gene-deficient Marek's disease virus vaccine strain and analysis of its biological activity and immune efficacy

[0056] 1. Materials and Methods

[0057] 1.1 Plasmids, strains and viruses

[0058] Marek's disease virus Meq Gene-deficient vaccine strain rMSΔMeq strain (recorded in publication number CN102363769B, invention name “Chicken Marek's Disease Virus Meq The invention relates to a novel IBDV variant SHG19 strain (described in the patent application with publication number CN117625689B and the invention name “A subtype B avian metapneumovirus vaccine strain expressing IBDV VP2 protein”) which is preserved in this laboratory; the plasmid pRed / ET expressing the recombinase and the plasmid containing the screening gene rpsl-neo are from the Counter-Selection BAC Modification Kit and are preserved in this laboratory; the EPI300-T1 strain and the DH10B strain are preserved in this laboratory;

[0059] 1.2 Main Reagents

[0060] Conventional PCR reaction enzymes, restriction endonucleases, and ligases were purchased from TaKaRa; calcium phosphate transfection kits and anti-mouse IgG-FITC were purchased from Invitrogen; plasmid extraction kits were purchased from QIAGEN; cell lysate was purchased from Bio-Time; cell culture medium and fetal bovine serum were purchased from Gibco; dimethyl sulfoxide (DMSO) was purchased from BioFroxx; DyLight-800-labeled anti-mouse secondary antibody was purchased from KPL; VP2 monoclonal antibody (MAb) was prepared and stored by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0061] 1.3 Marek's disease virus Meq Construction of a reverse genetics operating system for the gene-deleted vaccine strain rMSΔMeq

[0062] The reverse genetics operating system comprises the following: MeqFive cosmids containing nucleotide sequences at positions 1-47178, 42801-87422, 87223-125265, 121752-159339 and 159189-177526 of the genome of the gene-deficient vaccine strain rMSΔMeq were prepared by using the Copy Control Fosmidlibrary production kit to clone the corresponding Marek's disease virus. Meq The gene fragments of the gene-deficient vaccine strain rMSΔMeq strain were cloned into pCC1Fos and named pMS-1, pMS-2, pMS-3, pMS-4 and pMS-5, wherein pMS-4 contains the US2 gene of the rMSΔMeq strain; the chicken Marek's disease virus Meq The GenBank accession number of the genome sequence of the gene-deleted vaccine strain rMSΔMeq is JQ314003.1.

[0063] 1.4 Construction and identification of recombinant cosmids expressing target genes

[0064] The pMS-4 cosmid was transfected into competent cells containing pRed E / T expression plasmid to prepare competent cells; the rpsl-neo expression cassette DNA in the Counter-Selection BAC Modification Kit was used as a template, and the primers US2-rpsl F / R were used to amplify the rpsl-neo gene fragment containing the homologous arms at both ends of the US2 insertion site by PCR, which was purified and transfected into competent cells containing pMS-4 to prepare competent cells; the IBDV novel variant SHG19 strain VP2 (varVP2) gene expression plasmid was used as a template, and the primers US2-CMV F / R were used to amplify the CMV-VP2 gene fragment containing the homologous arms at both ends of the US2 insertion site, which was purified and electroporated into competent cells containing rpsl-neo, and the positive colonies were picked and expanded for culture, and the cosmids were extracted, and the obtained cosmids were named pMS-varVP2; wherein, the plasmid expressing the IBDV SHG19 strain VP2 gene was based on IBDV The VP2 gene was amplified using the genome of SHG19 strain as a template and then cloned into the CMV expression cassette of the commercial vector pEGFP-N1, named pCMV-VP2, wherein the nucleotide sequence of the gene fragment CMV-VP2 containing the CMV promoter sequence, varIBDV VP2 gene and terminator sequence is shown in SEQ ID NO. 12. The names and sequences of the primers required for the construction are shown in Table 2.

[0065]

[0066] 1.4 Reorganization MeqRescue of Gene-deleted Marek's Disease Virus rMDV-varVP2

[0067] The five cosmid DNAs of pMS-1, pMS-2, pMS-3, pMS-varVP2, and pMS-5 were extracted using QIAGEN's midi extraction kit. The five cosmids were co-transfected into the secondary CEF by calcium phosphate transfection method. After 4 to 5 days, the transfected cells were observed for MDV-specific plaque lesions. After plaques appeared, the virus was harvested and continuously passaged and stored in CEF cells. The genomic DNA of the recombinant virus was extracted using a kit, and the parental virus genomic DNA control was set up at the same time. The primers varVP2F / R (5' ATGACAAACCTGCAAGATCA 3' / 5' TTACCTTAGGGCCCGAATTA 3') were used for PCR identification and sequencing identification. The correctly identified recombinant virus was named rMDV-varVP2.

[0068] 1.5 Reorganization Meq Expression of target gene VP2 in gene-deleted Marek's disease virus rMDV-varVP2

[0069] The above rescued recombinant Meq Gene-deficient Marek's disease virus rMDV-varVP2 and parental virus rMSΔMeq strain were inoculated into CEF cells cultured in six-well plates. After 120 h of culture, the cells were collected and fixed with anhydrous ethanol. The expression of VP2 protein was identified by indirect immunofluorescence assay (IFA) using VP2 protein MAb (1:400) as the primary antibody and FITC-labeled anti-mouse IgG (1:200) as the secondary antibody. At the same time, protein blotting (Western blot) detection was performed: 500 μL of cell lysis buffer was added to each well, and lysis was performed at 4 ℃ for 30 min to release VP2 in the cells. The supernatant obtained by cell lysis was electrophoresed on 10% SDS-PAGE separation gel. The protein gel was transferred to NC membrane using a semi-dry transfer instrument. After the transfer was completed, the membrane was subjected to Western blot test using VP2 monoclonal antibody and DyLight-800-labeled anti-mouse secondary antibody. The above experiments used CEF infected with parental virus rMSΔMeq as negative control.

[0070] 1.6 Reorganization Meq Replication curve of gene-deficient Marek's disease virus rMDV-varVP2

[0071] Will reorganize MeqGene-deficient Marek's disease virus rMDV-varVP2 and parental virus rMSΔMeq strain were inoculated into secondary CEF cells cultured in 6-well plates, and the virus was collected every 24 h after infection until 144 h after infection. The titer of the virus collected at each time point was measured, and the growth curve was drawn to analyze the recombination Meq In vitro replication characteristics of gene-deficient Marek's disease virus rMDV-varVP2 and parental virus in CEF.

[0072] 1.7 Reorganization Meq Experimental study on the immune efficacy of gene-deleted Marek's disease virus rMDV-varVP2

[0073] Twenty-seven one-day-old SPF chicks were randomly divided into three groups, with nine chicks in each group. Group 1 was inoculated subcutaneously with 2000 PFU / chicken. Meq Gene-deficient Marek's disease virus rMDV-varVP2; Group 2 was inoculated with MDV parent virus rMSΔMeq as a negative control; Group 3 was not exempted as a blank control. Four weeks after immunization, the experimental chickens in Groups 1 and 2 were challenged with IBDV variant virus (SHG19 strain) at a dose of 10 BID50 / 100ul. After the challenge, the experimental chickens were observed for 7 consecutive days, and the incidence of the experimental chickens in each group was counted. After the observation period, the experimental chickens were dissected, the bursa of Fabricius was collected, and the bursa index (BBIX) was calculated, F / B = (bursa weight / body weight) × 1000; BBIX = bursa weight ratio of experimental group chickens / cyst ratio of blank control group chickens; when BBIX < 0.7, it was judged as bursa atrophy; when BBIX > 0.7, it was judged as normal bursa of Fabricius.

[0074] 2. Results

[0075] 2.1 Construction and identification of recombinant cosmids expressing target genes

[0076] The varIBDV VP2 gene and expression cassette were amplified and recombinant cosmids were constructed using the Red recombination method. The varIBDV VP2 gene expression cassette was cloned into the rMSΔMeq recombinant cosmid pMS-4 to construct the pMS-varVP2 cosmid. The recombinant cosmid was identified by PCR and sequencing using primers VP2F / R. The results showed that the length of the PCR product was 1359 bp ( Figure 1 ), sequencing results showed that the PCR product contained the VP2 gene, while the negative control sample had no VP2 gene insertion sequence, and the PCR identification result was negative, indicating that the recombinant cosmid pMS-varVP2 was successfully constructed.

[0077] 2.2 Reorganization Meq Rescue and PCR Identification of Gene-deleted Marek's Disease Virus rMDV-varVP2

[0078] The recombinant cosmid pMS-varVP2 was co-transfected into CEF with the other four recombinant cosmids pMS-1, pMS-2, pMS-3, and pMS-5 cloned with rMSΔMeq genome fragments. MDV plaque lesions appeared 4-5 days after transfection, and the recombinant cells were rescued. Meq Gene-deleted Marek's disease virus rMDV-varVP2 ( Figure 2 ). The recombinant viral genomic DNA was extracted for PCR identification and sequencing. The results showed that the length of the PCR product was consistent with the expected result ( Figure 3 ), sequencing results showed that the inserted sequence was consistent with the expected one. The parent virus DNA amplification result was negative. The above results indicate that the VP2 gene was correctly inserted into the rMSΔMeq genome and can exist stably, and the recombinant Meq The gene-deleted Marek's disease virus rMDV-varVP2 was constructed correctly.

[0079] 2.3 Reorganization Meq Expression of target gene VP2 in gene-deleted Marek's disease virus rMDV-varVP2

[0080] Will reorganize Meq Gene-deficient Marek's disease virus rMDV-varVP2 and parental virus rMSΔMeq strain were inoculated into CEF cells 120 hours later, and the cells were collected and the expression of the target gene VP2 was detected by IFA and Western blot. IFA results showed that cells infected with rMDV-varVP2 reacted with VP2 monoclonal antibody, and green fluorescence signals were visible, while parental virus rMSΔMeq and uninfected cells showed no fluorescence ( Figure 4 ). Western blot results showed that rMDV-varVP2 could detect VP2-specific bands ( Figure 5 The above results show that the recombinant Meq The gene-deficient Marek's disease virus rMDV-varVP2 can successfully express the target gene VP2.

[0081] 2.4 Reorganization Meq Replication curve of gene-deficient Marek's disease virus rMDV-varVP2

[0082] Will reorganize Meq Gene-deficient Marek's disease virus rMDV-varVP2 and parental virus rMSΔMeq strain parental virus were inoculated into CEF at 100 PFU, and cells were collected every 24 hours to titrate the virus replication curve. The results showed that the titer of rMDV-varVP2 at each time point was not significantly different from that of the parental virus rMSΔMeq (P>0.05) ( Figure 6 ). This indicates that the replication characteristics of rMDV-varVP2 in CEF are consistent with those of the parental virus.

[0083] 2.5 Reorganization Meq Experimental study on the immune protection efficacy of gene-deleted Marek's disease virus rMDV-varVP2 against IBDV variants

[0084] Will reorganize Meq The gene-deficient Marek's disease virus rMDV-varVP2 was inoculated into one-day-old SPF chickens at a dose of 2000 PFU / chicken. Four weeks after immunization, the new variant strain of IBDV SHG19 was challenged. The mortality rate and bursal atrophy were counted 7 days after the challenge. The results showed that the recombinant Meq Chickens immunized with gene-deficient Marek's disease virus rMDV-varVP2 survived completely after infection with SHG19, and no atrophy of the bursa of Fabricius was observed in the chickens after infection. Figure 7 , Figure 8 ); After the parental virus rMSΔMeq strain was challenged with SHG19, the bursa of Fabricius atrophy was observed in 9 out of 9 chickens. The above results show that the recombinant Meq The protection rate of chickens immunized with gene-deficient Marek's disease virus rMDV-varVP2 against attack by new variant strains of IBDV was 100%.

Claims

1. A recombinant strain expressing the VP2 gene of a novel variant of Infection Bursal Disease Virus (IBDV) (varIBDV) Meq A gene-deficient Marek's disease virus strain, characterized in that The invention uses a recombinant cloning technique to insert a gene fragment CMV-VP2 containing a CMV promoter sequence, a varIBDV VP2 gene and a terminator sequence into the US2 gene of a Marek's disease virus Meq gene-deficient vaccine strain rMSΔMeq strain, and replace the nucleotide sequence between positions 156501-157116 of the rMSΔMeq genome, thereby obtaining a recombinant Meq gene-deficient Marek's disease virus strain expressing the varIBDV VP2 gene, wherein the varIBDV is a new variant of IBDV, the SHG19 strain, and the nucleotide sequence of the gene fragment CMV-VP2 is shown in SEQ ID NO.12; Marek's disease virus Meq The gene-deficient vaccine strain is the rMSΔMeq strain, which is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration. Its microbiological deposit number is: CGMCC No.4612.

2. A recombinant construct expressing the varIBDV VP2 gene according to claim 1 Meq A method for producing a gene-deficient Marek's disease virus vaccine strain, characterized in that: The following steps are involved: (1) Marek's disease virus Meq Construction of a reverse genetics operating system for the gene-deleted vaccine strain rMSΔMeq The reverse genetics operating system comprises the following: Meq The gene-deficient vaccine strain rMSΔMeq contains five cosmids with nucleotide sequences at positions 1-47178, 42801-87422, 87223-125265, 121752-159339 and 159189-177526 of the genome, each of which is a cosmid containing the corresponding Marek's disease virus Meq The gene fragments of the gene-deficient vaccine strain rMSΔMeq strain were cloned into pCC1Fos and named pMS-1, pMS-2, pMS-3, pMS-4 and pMS-5, wherein pMS-4 contains the US2 gene of the rMSΔMeq strain; the chicken Marek's disease virus Meq The GenBank accession number of the genome sequence of the gene-deleted vaccine strain rMSΔMeq is JQ314003.1; (2) Construction and identification of recombinant cosmid expressing varIBDV VP2 gene The pMS-4 cosmid was transfected into competent cells containing pRed E / T expression plasmid to prepare competent cells; the rpsl-neo expression cassette DNA was used as a template, and the primers US2-rpsl F / R were used to amplify the rpsl-neo gene fragment containing the homologous arms at both ends of the US2 insertion site by PCR, which was purified and transfected into competent cells containing pMS-4 to prepare competent cells; the expression plasmid containing the VP2 (varVP2) gene of the new variant of IBDV SHG19 strain was used as a template, and the primers US2-CMV F / R were used to amplify the CMV-VP2 gene fragment containing the homologous arms at both ends of the US2 insertion site, which was purified and electroporated into competent cells containing rpsl-neo, and the positive colonies were picked and expanded for culture to extract the cosmid, and the obtained cosmid was named pMS-varVP2; the primers required for construction are as follows: ； (3) Rescue of recombinant viruses Extract five cosmid DNAs, pMS-1, pMS-2, pMS-3, pMS-varVP2, and pMS-5; co-transfect the five cosmids into the secondary CEF by calcium phosphate transfection method, and observe whether the transfected cells show MDV-specific plaque lesions after 4 to 5 days; harvest the virus after plaques appear, and continuously passage and preserve it in CEF cells, extract the genomic DNA of the recombinant virus using a kit, and set up the parental virus genomic DNA control at the same time, identify it by PCR using primers varVP2F / R: 5' ATGACAAACCTGCAAGATCA3' and 5' TTACCTTAGGGCCCGAATTA 3', and identify it by sequencing. The correct recombinant virus is the recombinant virus expressing the varIBDV VP2 gene. Meq The gene-deficient Marek's disease virus vaccine strain was named rMDV-varVP2.

3. The method according to claim 2, characterized in that The expression plasmid containing the VP2 gene of the new variant of IBDV SHG19 is obtained by amplifying the VP2 gene using the varIBDV SHG19 genome as a template and cloning it into the CMV expression box of the vector pEGFP-N1, and is named pCMV-VP2. The nucleotide sequence of the gene fragment CMV-VP2 containing the CMV promoter sequence, varIBDV VP2 gene and terminator sequence is shown in SEQ ID NO.

12.

4. The recombinant expressing varIBDV VP2 gene of claim 1 Meq Use of gene-deficient Marek's disease virus strain in preparing medicine for preventing IBDV infection.

5. The use according to claim 4, characterized in that The IBDV is a new variant of IBDV (varIBDV).

6. The use according to claim 4, characterized in that The medicine is a recombinant Marek's disease virus live vector vaccine expressing varIBDV VP2 gene.

Images