Precursor mRNA Splicing Factor Gene RDM16 of Arabidopsis thaliana and Its Application in Plant High Temperature Regulation

Abstract

The present invention discloses an Arabidopsis thaliana precursor mRNA splicing factor gene RDM16 and its application in plant high temperature regulation, relating to the field of genetic engineering technology. The nucleotide sequence of the Arabidopsis thaliana mRNA splicing factor gene RDM16 is shown in SEQ ID NO.1. The present invention uses wild-type Arabidopsis thaliana Col-0 and its mutant rd-4 and transgenic plants complemented with the RDM16 gene (RDpro:RDM16-GFP / rd-4#3, 12) to identify that the functional loss of the Arabidopsis thaliana RDM16 gene reduces the high temperature tolerance of Arabidopsis thaliana, that the expression of the RDM16 gene improves the high temperature tolerance of Arabidopsis thaliana, and that the RDM16 gene is located in the cell nucleus. It is also verified that the RDM16 protein can interact with the high temperature response protein STA1 to form a protein complex, thereby improving the high temperature tolerance of Arabidopsis thaliana by promoting the splicing of the heat shock transcription factor HSFA3.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to an Arabidopsis thaliana precursor mRNA splicing factor gene RDM16 and an application thereof in plant high temperature regulation. Background Art

[0002] During their growth and development, plants are subject to stress from various abiotic factors (drought, salinity, high temperature, etc.) and biotic factors (pathogen infection, etc.). Various adverse stresses can severely affect plant growth and development, and plants can rapidly respond at the molecular, cellular, and organ levels to adapt to these adverse conditions. Temperature has a particularly severe impact on plant growth and development. To cope with high temperature stress, plants have evolved powerful defense systems and a series of sensors that enable them to sense changes in ambient temperature, allowing them to respond through temperature perception. The heat stress response network that has been relatively well studied so far is primarily the heat stress response (HSR) regulated by heat shock factors (HSFs) and heat shock proteins (HSPs).

[0003] The high temperature responsive protein STA1 is involved in the splicing of pre-mRNA of important genes including HSFA3 and its target gene HSA32, and is a necessary condition for establishing plant heat stress tolerance.

[0004] The RDM16 gene encodes a pre-mRNA splicing factor 3 (PrP3), a component of the U4 / U6 snRNP protein complex. It possesses a PRP3 domain and a DUF115 domain of unknown function. RDM16 is highly conserved across eukaryotes, with homologs found in rice, humans, and yeast. However, the function of RDM16 in regulating plant heat tolerance has not been reported. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an Arabidopsis thaliana pre-mRNA splicing factor gene RDM16 and its application in plant high temperature regulation.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] The present invention provides an Arabidopsis thaliana mRNA splicing factor gene RDM16, wherein the nucleotide sequence of the RDM16 gene is the sequence shown in SEQ ID NO.1, or a sequence complementary to the sequence shown in SEQ ID NO.1.

[0008] The present invention also provides an application of an Arabidopsis thaliana mRNA splicing factor gene RDM16 in regulating plant high temperature tolerance.

[0009] As a further optimization scheme of the present invention, the functional loss of the RDM16 gene will reduce the high temperature tolerance of Arabidopsis thaliana, and the expression of the RDM16 gene will increase the high temperature tolerance of Arabidopsis thaliana.

[0010] As a further optimization scheme of the present invention, the RDM16 gene interacts with the high temperature response protein STA1 to form a protein complex, thereby improving the high temperature tolerance of Arabidopsis thaliana by promoting the splicing of the heat shock transcription factor HSFA3.

[0011] The present invention also provides a protein encoded by the Arabidopsis thaliana mRNA splicing factor gene RDM16, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0012] The present invention also provides a plant expression vector, which is obtained by inserting the Arabidopsis thaliana mRNA splicing factor gene RDM16 into the PCMBIA1301 vector.

[0013] The present invention also provides a genetically engineered host cell, which is an Agrobacterium cell containing an expression vector of the RDM16 gene, or an Agrobacterium cell with the RDM16 gene integrated into its genome.

[0014] A method for obtaining the Arabidopsis thaliana mRNA splicing factor gene RDM16 comprises designing specific amplification primers using the nucleotide sequence of the RDM16 gene as a template, extracting RNA from the Columbia ecotype Arabidopsis thaliana (wild-type Arabidopsis thaliana Col-0) as material, reverse-transcribing the RNA into cDNA, and obtaining the Arabidopsis thaliana RDM16 gene through PCR amplification technology.

[0015] As a further optimization solution of the present invention, the specific amplification primers for PCR amplification are:

[0016] SEQ ID NO.3: RDM16 gene-F: 5'>ATGGATAAGGAGAGATATTCCAGGA<3';

[0017] SEQ ID NO.4: RDM16 gene-R: 5'>TTAGTCGTCTGAGTAATTGACAGCG<3".

[0018] The present invention has the following beneficial effects:

[0019] The RDM16 gene of the present invention encodes an Arabidopsis pre-mRNA splicing factor 3 (PrP3), which is one of the components of U4 / U6snRNP. The wild-type Arabidopsis Col-0 and its mutant rd-4 and transgenic plants complemented with the RDM16 gene (rdpro:RDM16-GFP / rd-4#3, 12) were used to identify that the functional loss of the Arabidopsis RDM16 gene would reduce the high temperature tolerance of Arabidopsis, and the expression of the RDM16 gene would improve the high temperature tolerance of Arabidopsis. The RDM16 gene was located in the cell nucleus, and it was verified that the RDM16 gene can interact with the high temperature response protein STA1 to form a protein complex, thereby improving the high temperature tolerance of Arabidopsis by promoting the splicing of the heat shock transcription factor HSFA3. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the electrophoresis diagram of the full-length amplification of the RDM16 gene (lanes 1-2: RDM16 gene fragment, M: Marker (Trans1000k));

[0021] Figure 2 The basic heat tolerance test diagram of wild-type Arabidopsis thaliana (Col-0, C24) and its mutant plants (rd-4, rd) ( Figure 2 A. Experimental conditions diagram; Figure 2 B) Phenotype of Arabidopsis plants;

[0022] Figure 3 Figure 2 shows the experimental results of acquired heat tolerance test of wild-type Arabidopsis thaliana (Col-0, C24) and its mutant plants (rd-4, rd) ( Figure 3 A. Experimental conditions diagram; Figure 3 B, E. Phenotype of Arabidopsis plants; Figure 3 C, F are statistical graphs of the survival rate of Arabidopsis plants; Figure 3 D, G Statistical graph of electrolyte permeability of Arabidopsis plants);

[0023] Figure 4 Figure 2 shows the experimental results of acquired heat tolerance test of wild-type Arabidopsis thaliana (Col-0), its mutant plant (rd-4), and transgenic lines complemented with RDM16 gene (RDpro:RDM16-GFP / rd-4#3, 12). Figure 4 A. Phenotype of Arabidopsis plants; Figure 4 B. Statistical graph of the expression level of gene RDM16; Figure 4 C. Statistical graph of the survival rate of Arabidopsis plants; Figure 4 D) Statistical graph of electrolyte permeability of Arabidopsis plants;

[0024] Figure 5This is the subcellular localization map of the RDM16 gene in the primary root of the transgenic line (RDpro:RDM16-GFP / rd-4#3) that complemented the RDM16 gene;

[0025] Figure 6 Schematic diagram of the splicing pattern of the heat shock transcription factor gene HSFA3 in the mutant plant (rd-4) and the statistical graph of the expression levels of total mRNA, pre-mRNA and mature mRNA of the HSFA3 gene in wild-type Arabidopsis thaliana (Col-0) and its mutant plant (rd-4) after heat treatment;

[0026] Figure 7 This is the experimental result of BiFC (Bimolecular Fluorescent Complimentary, BiFC) experiment verifying the interaction between RDM16 gene and high temperature response protein STA1. DETAILED DESCRIPTION

[0027] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0028] 1. Materials

[0029] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents used are commercially available products unless otherwise specified.

[0030] 2. Methods

[0031] 2.1 Cloning and identification of the Arabidopsis RDM16 gene

[0032] RNA was extracted from the Columbia ecotype Arabidopsis thaliana (wild-type Arabidopsis thaliana Col-0) and reverse transcribed to generate the first-strand cDNA, which was used as a template for PCR amplification.

[0033] The sequences of the specific primers are as follows:

[0034] SEQ ID NO.3: RDM16 gene-F: 5'>ATGGATAAGGAGAGATATTCCAGGA<3';

[0035] SEQ ID NO.4: RDM16 gene-R: 5'>TTAGTCGTCTGAGTAATTGACAGCG<3';

[0036] Amplification was performed to obtain a 2361 bp gene fragment, such as Figure 1 As shown, the obtained gene fragment was ligated into the cloning vector pEASY-T3 Cloning Kit to obtain the T3-RDM16 recombinant plasmid and transformed into Escherichia coli. Positive clones were picked and sequenced. The sequencing results were consistent with the sequence published by the National Center for Biotechnology Information (NCBI), that is, the nucleotide sequence of the RDM16 gene shown in SEQ ID NO.1 was obtained.

[0037] Bioinformatics analysis of the RDM16 gene (nucleotide sequence shown in SEQ ID NO.1) and its encoded protein (amino acid sequence shown in SEQ ID NO.2) amplified above revealed that the RDM16 gene is a gene involved in Arabidopsis pre-mRNA splicing, is one of the important components of U4 / U6 snRNP, and is involved in the splicing of Arabidopsis pre-mRNA.

[0038] 2.2 Identification of the function of the RDM16 gene using wild-type Arabidopsis thaliana, its mutants, and transgenic plants

[0039] 2.2.1. Heat tolerance test of wild-type Arabidopsis and its mutants

[0040] Based on the RDM16 gene sequence, an EMS-induced RDM16 mutant in Arabidopsis Col-0 background was obtained from the research group of Professor Ding Zhaojun of Shandong University (BINGSHENG LV, KONGQIN HU, TE TIAN, et al. The pre-mRNA splicing factor RDM16 regulates root stem cell maintenance in Arabidopsis [J]. Acta Botanica Sinica, 2021, 63(4): 662-675.), named rd-4. dCAPS primers were designed according to the dCAPS Finder 2.0 website, and then identification primers were synthesized:

[0041] SEQ ID NO.5: dCAPs-F:5'>GATACGGGAAGCTGATGAATGAAGCGAATAAA TC G<3';

[0042] SEQ ID NO.6: dCAPs-R:5'>CGGTTTCCCAATACTTCCTTGC<3'.

[0043] Through cloning, PCR product digestion (mutant rd-4, restriction endonuclease Taq1 digestion), and gel running, it was confirmed that it could be cut, that is, the band size of the mutant rd-4 was smaller than that of the wild type (Arabidopsis Col-0), proving that rd-4 was a mutant plant with loss of RDM16 gene function.

[0044] Basic heat tolerance refers to the ability to survive high temperatures, and acquired heat tolerance refers to the ability to cope with lethal high temperatures after a period of acclimation.

[0045] Basic heat resistance test: such as Figure 2 As shown in A, the EMS-induced RDM16 mutant (rd-4) and wild-type Arabidopsis Col-0 in the Arabidopsis Col-0 background were subjected to basic heat treatment (heat treatment at 45°C for 80 min) and a control group (growth maintained at 22°C) was set up. The phenotype of the mutant rd-4 plant was observed and photographed.

[0046] The experimental results are as follows Figure 2 As shown in B, through Figure 2 B shows that both (wild-type Arabidopsis Col-0 plants and mutant rd-4 plants) exhibit a phenotype of high temperature intolerance.

[0047] Acquired heat resistance test: such as Figure 3 As shown in A, the EMS-induced RDM16 mutant (rd-4) and wild-type Arabidopsis Col-0 plants were subjected to adaptive heat treatment (first heat treatment at 37°C for 30 min, then at 22°C for 30 min, and then heat treatment at 45°C for 120 min). A control group (grown at 22°C) was set up, and the phenotype of the mutant rd-4 plants was observed and photographed.

[0048] The experimental results are as follows Figure 3 As shown in BG, Figure 3 EG showed that the acquired heat tolerance of the mutant rd-4 plants was significantly worse than that of the wild-type Arabidopsis Col-0 plants.

[0049] In addition, the EMS-induced RDM16 mutant of Arabidopsis thaliana C24 background was obtained from the research group of Academician Zhu Jiankang (Huang, CF, Miki, D, Tang, K, et al. A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis[J]. PLOS Genetics. 2013; 9(9): e1003779) and named rd;

[0050] Both the wild-type Arabidopsis C24 plant and the mutant rd plant also showed a phenotype of high temperature intolerance (the same as the basic heat tolerance test experiment mentioned above), which is consistent with the phenotype of the wild-type Arabidopsis Col-0 and its mutant rd-4; the acquired heat tolerance of the mutant rd plant is also weaker than that of the wild-type Arabidopsis C24 plant, but the acquired heat tolerance of the mutant rd-4 is weaker than that of the mutant rd. Therefore, the wild-type Arabidopsis Col-0 and its mutant (rd-4) were selected for the heat tolerance test experiment of complementing the RDM16 gene.

[0051] 2.2.2 Heat tolerance testing of wild-type Arabidopsis thaliana, its mutants, and RDM16-complemented plants

[0052] Based on the CDS sequence of the Arabidopsis Col-0 RDM16 gene obtained in step 2.1 above, specific primers were designed to construct subcellular localization and complementation vectors (bold and horizontal lines indicate restriction sites, lowercase letters indicate overlapped sequences, and italic lowercase letters indicate mini-linkers):

[0053] SEQ ID NO.7: RDM16 gene-promoter F1: 5'>atcctctaga GTCGAC GGTGAAACACCGAACAGAGACT<3';

[0054] SEQ ID NO.8: RDM16 gene-promoter R1: 5'>GGCAGAATTTAGGGTTTATTCCT

[0055] <3'.

[0056] SEQ ID NO.9: RDM16 gene-gDNA F2: 5'>accctaaattctgccATGGATAAGGAGAGATATTCCAGGA<3';

[0057] SEQ ID NO.10: RDM16 gene-gDNA R2: 5'>CGGATGCGGCAGCAGAGTCGTCTGAGTAATTGACAGCG<3'.

[0058] SEQ ID NO.11: GFP-F:5'>tctgctgccgcatccgcggcagcttcagccAGCAAGGGCGAGGAGCTGTTCACC<3';

[0059] SEQ ID NO. 12: GFP-R:5'>TTACTTGTACAGCTCGTCCATGCCGAG<3'.

[0060] SEQ ID NO.13: RDM16 gene-UTR F3: 5'>gagctgtacaagtaaATCCTCTCTCCCTCATATCATCA<3';

[0061] SEQ ID NO.14: RDM16 gene-UTR R3:5'>atgcctgcag GTCGAC AAAACCCCACCTCAGCATCT<3'.

[0062] The RDM16 gene coding region and GFP fragment with restriction enzyme cutting sites were obtained.

[0063] The full-length RDM16 gene and GFP fragment with restriction enzyme cleavage sites were cloned into the construct vector pCMBIA1301. The fragments were digested with Sal I and the target fragments and vectors were recovered from the gel. Ligation was performed using In-Fusion HD Cloning Kits at 37°C for half an hour. Heat shock was used to transform competent E. coli DH5α cells and cultured overnight at 37°C. Positive colonies were selected by PCR and sequenced to construct the plant expression vector pCMBIA1301-RDM16 gene-GFP.

[0064] The pCMBI A1301-RDM16 gene-GFP plasmid was transformed into competent Agrobacterium GV3101, and the positive clones were identified by bacterial liquid PCR.

[0065] Select the positive bacterial liquid, add 5 mL of LB liquid culture medium containing kanamycin Kan, rifampicin Rif and tetracycline Tet resistance, culture at 28 ° C 200 rpm for two days, then inoculate it into 100 mL of LB liquid culture medium containing kanamycin Kan, rifampicin Rif and tetracycline Tet resistance at a volume ratio of 1:100, and culture at 28 ° C 200 rpm until the OD600 value is between 0.6 and 0.8.

[0066] The bacteria were collected and cleaned by centrifugation and transferred into the rd-4 mutant Arabidopsis thaliana using the pollen-mediated method. After the seeds matured (T0), the seeds were screened for hygromycin resistance, and the positive seedlings (T1 generation) were cultured in an artificial climate chamber until the seeds matured.

[0067] Screen T3 generation homozygous transgenic seeds and identify their phenotypes after sowing. Figure 4 shown.

[0068] Depend on Figure 4It can be seen that after high temperature treatment (acquired heat tolerance test: first heat treatment at 37°C for 30 minutes, then at 22°C for 30 minutes, and then heat treatment at 45°C for 120 minutes), there was no significant difference in the survival rate (4C) and electrolyte leakage rate (4D) between the transgenic lines complemented with the RDM16 gene (RDpro:RDM16-GFP / rd-4#3, 12) and the wild-type Arabidopsis Col-0, and the heat-intolerant phenotype of the mutant (rd-4) was complemented.

[0069] like Figure 5 As shown, subcellular localization observation was also performed on the main root of the three-day-old transgenic line (RDpro:RDM16-GFP / rd-4#3) with complemented RDM16 gene, and the results showed that the RDM16 gene was localized in the cell nucleus.

[0070] 2.3 RT-qPCR verification of splicing of heat shock transcription factor HSFA gene

[0071] Based on the sequence of the HSFA3 gene (AT5G03720) published on the TAIR website, specific primers were designed:

[0072] SEQ ID NO.15: HSFA3 f1:5'>CATCTTCTGGGGACTGACCG<3';

[0073] SEQ ID NO.16: HSFA3 r1:5'>TGTCTGACGAAGCTGGAGAA<3';

[0074] SEQ ID NO.17: HSFA3 r2:5'>ACAGAAACAGAGCAAGAGAGATG<3';

[0075] SEQ ID NO. 18: HSFA3 r3:5'>TTTCGAAATCCATAAGTGTTAAG<3'.

[0076] The expression of total mRNA (f1 and r1), heterogeneous nuclear RNA / pre-mRNA (f1 and r2), and mature mRNA (f1 and r3) of the transcript HSFA3 was specifically detected.

[0077] The results are as follows Figure 6As shown, before heat treatment, the expression levels of the HSFA3 gene in all mRNA types were low in wild-type Arabidopsis Col-0 and mutant rd-4. However, after heat treatment, the HSFA3 gene pre-mRNA (f1 / r2) accumulated to higher levels in mutant rd-4, but not in wild-type Arabidopsis Col-0. In contrast, after heat treatment, the expression levels of the HSFA3 gene mature mRNA (f1 / r3) were high in wild-type Arabidopsis Col-0, but not in mutant rd-4. However, the total mRNA level of the HSFA3 gene was significantly higher in mutant rd-4 than in wild-type Col-0 after heat treatment. These results suggest that under heat treatment, the rd16 gene affects not only the splicing of the HSFA3 gene but also its transcription.

[0078] Among them, RNA Seq analysis showed that 308 intron retention events were observed in RDM16 compared with wild-type plants (Huang, CF, Miki, D, Tang, K, et al. A Pre-mRNA-splicing factor

[0079] is required for RNA-directed DNA methylation in Arabidopsis[J].PLOSGenetics.20

[0080] 13;9(9):e1003779), which confirmed that RDM16 is required for pre-mRNA (heterogeneous nuclear RNA) splicing in plants. RDM16 mutants exhibit morphological defects and are sensitive to ABA signaling and salt stress (Huang, CF, Miki

[0081] ,D,Tang,K,et al.A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis[J].PLOS Genetics.2013;9(9):e1003779). The high temperature response protein STA 1 can interact with stress-induced U5 snRNP, and its cellular function is involved in the establishment of cold stress and ABA tolerance.

[0082] (Lee BH, Kapoor A, Zhu J, Zhu JK. STABILIZED1, a stress-upregulated nuclear protein, is required for pre-mRNA splicing, mRNA turnover, and stress tolerance in Arabidopsis [J]. Plant Cell. 2006; 18(7): 1736-1749.). In addition, the high temperature response protein STA1 also plays an important role in heat stress. In the recombinant DREB2A-dependent gene regulatory module, the splicing activity of the high temperature response protein STA1 is indispensable for the mature mRNA expression of HSFA3 and its downstream HSP (Kim GD, Cho YH, Lee BH, Yoo SD. STABILIZED1 Modulates Pre-mRNA Splicing for Thermotolerance. Plant Physiol. 2017; 173(4): 2370-2382.). Therefore, the following experiments were performed to verify the interaction between RDM16 and the high temperature response protein STA1.

[0083] 2.4 BiFC verification of the interaction between RDM16 and the high temperature responsive protein STA1

[0084] Based on the CDS sequence of the Arabidopsis thaliana Col-0 RDM16 gene obtained in step 2.1 above and the high temperature response gene STA1 (AT4G03430) published on the TAIR website, specific primers were designed:

[0085] SEQ ID NO.19: STA1-YNE SalⅠF:tccatcgatagtactgtcgacATGGTGTTTCTCTCGATTCCAAA;

[0086] The SalⅠ restriction site is gtcgac;

[0087] SEQ ID NO.20: STA1-YNE KpnⅠR:ctccatcccgggagcggtaccAGCAGAATTCTCTTCCTTGCTCA;

[0088] The KpnⅠ restriction site is ggtacc;

[0089] SEQ ID NO.21: RDM16 gene-F4: 5'>tctagaATGGATAAGGAGAGATATTCCAGGA<3';

[0090] SEQ ID NO. 22: RDM16 gene-R4: 5′>ggatccTTAGTCGTCTGAGTAATTGACAGCG<3′.

[0091] The XbaⅠ restriction site is tctaga; the BamHI restriction site is ggatcc.

[0092] The RDM16 gene fragment with restriction enzyme cutting sites was obtained.

[0093] The correctly sequenced RDM16 and STA1 gene coding regions with restriction sites, as well as the BiFC-constructed vectors pUC-SPYCE and pUC-SPYNE, were double-digested with XbaI and BamHI or SalI and KpnI, respectively. The target fragments and vectors were recovered and mixed with T4 ligase, incubated overnight at 22°C, and transformed into competent Escherichia coli DH5α cells using the heat shock method. Positive clones were screened by bacterial liquid PCR and sequenced. Ultimately, the BiFC experimental expression vectors YNE-high-temperature-responsive gene STA1 and YCE-RDM16 were constructed.

[0094] The correct construct was co-transformed into wild-type protoplasts using the PEG-mediated transformation method with the corresponding empty vector control and experimental plasmids. Figure 7 As shown, after incubation overnight in the dark, the protoplasts were imaged using a Zeiss confocal microscope for YFP fluorescence analysis, and the results showed that RDM16 could interact with the high temperature response protein STA1 in Arabidopsis protoplasts.

[0095] 3 Conclusion

[0096] The RDM16 gene encodes an Arabidopsis pre-mRNA splicing factor 3 (PrP3), which is a component of the U4 / U6 snRNP. It can interact with another high-temperature regulated gene in Arabidopsis, the high-temperature response protein STA1, to form a protein complex, thereby improving the high-temperature tolerance of Arabidopsis by promoting the splicing of the heat shock transcription factor HSFA3.

[0097] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. An application of an Arabidopsis thaliana mRNA splicing factor gene RDM16 in regulating plant high temperature tolerance, characterized in that: The nucleotide sequence of the gene RDM16 is shown in SEQ ID NO.

1. The gene RDM16 interacts with the high temperature response protein STA1 to form a protein complex, thereby improving the high temperature tolerance of Arabidopsis thaliana by promoting the splicing of the heat shock transcription factor HSFA3.

Images