Molecular markers of Cordyceps javanica JS001 and their acquisition methods and applications

Abstract

The invention discloses a molecular marker of a Javanese Cordyceps sinensis JS001 strain, and an acquisition method and application thereof. Based on comparison of multiple strains, it is screened that the Javanese Cordyceps sinensis JS001 specific SSR site is 9570, the PCR amplification primer sequences are 5'-TGCTTCCCTTGAACCACTCC-3' and 5'-AGTCATTTGGCGAGGAGAGG-3', and the amplified sequence is ATTGCCGTCGAGCGAACGCTGCTTGCACCTTCCATTGCTCTTGTCCCCGTCACTACATGTTCTTCCCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCCTCACTCTCAATCCTCTCCTCGCCAAATGACTGTGTCTCATCGTAGTAACTG.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a molecular marker of Cordyceps javanica JS001 and an acquisition method and application thereof. Background Art

[0002] Javanese Cordyceps Cordyceps javanica ), formerly known as Javan Corymbia ( Isaria javanica ), belonging to the phylum Ascomycota, class Sordariomycetes, order Hypocreales, family Cordycipitaceae, genus Cordyceps, is a widely-hosted insect pathogenic fungus that can infect a variety of important pests such as Hemiptera, Lepidoptera, and Galloptera. At present, Javanese Cordyceps has been developed as a fungal insecticide for the control of pests such as tomato whitefly and cabbage armyworm. The Institute of Plant Protection of Jiangsu Academy of Agricultural Sciences has officially registered JS001 Javanese Cordyceps dispersible oil suspension with 5 billion spores / ml for the control of important piercing-sucking pests such as whitefly and rice planthopper.

[0003] Javanese Cordyceps is widely present in nature, and its strains are abundant. For specific commercialized Javanese Cordyceps strains, it is difficult to identify them by the appearance and morphological characteristics of the fungus, and it is necessary to establish a highly specific molecular marker method for identification and protection. Simple sequence repeats, also known as microsatellite (Simple sequence repeat, SSR) markers, have been widely used in gene positioning and cloning, disease diagnosis, kinship analysis, variety identification, crop breeding, etc. due to their high polymorphism, easy detection, and good specificity. They can also be used for the rapid and easy identification and protection of microbial species and strains. In order to effectively identify and protect the commercialized Javanese Cordyceps JS001, its specific SSR molecular markers are screened and its specific SSR molecular marker identification method is established. The present invention plays an important role in effectively evaluating the quality of fungal insecticide products and protecting the intellectual property rights of new pesticides. Summary of the invention

[0004] The present invention aims to provide a method for obtaining an ideal molecular marker of Javanese Cordyceps JS001 and to apply the same, and specifically to a method for screening strain-specific SSR molecular markers of Javanese Cordyceps JS001 by comparing different strains, so as to effectively identify Javanese Cordyceps JS001, perform quality control of related products, and effectively identify counterfeit products on the market.

[0005] The technical scheme of the present invention is as follows: based on the comparison of the genome sequences of Javanese Cordyceps JS001 and other strains, specific SSR markers of Javanese Cordyceps JS001 are screened, and then the genomes of different fungal strains are amplified by PCR using specific primers, and whether it is the Javanese Cordyceps JS001 strain is identified by the presence or absence of the amplified bands.

[0006] Compared with the prior art, the method of the present invention has the following beneficial effects: providing a specific molecular marker of a commercialized insecticidal fungus strain, which not only improves the quality control level of the product itself, but also helps to identify whether there are counterfeit products on the market. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figure 1 Electrophoresis pattern of PCR amplification products of specific SSRs sites of Cordyceps javanica JS001 strain (M is a 20 bp DNA ladder, 8, 21, 2045, 2427, 2416, 4187, 4212, 4213, 6396, 6877, 8418, 7772, 9186, 9570, 10245, 10256, and 10306 are different SSRs sites, respectively.)

[0008] Figure 2 Electrophoresis pattern of PCR amplification products of SSRs loci of Cordyceps javanica SH2301 strain (M is 20 bp DNA ladder, 8, 21, 2045, 2427, 2416, 4187, 4212, 4213, 6396, 6877, 8418, 7772, 9186, 9570, 10245, 10256, and 10306 are different SSRs loci.)

[0009] Figure 3 Electrophoresis pattern of PCR amplification products of SSRs loci of Cordyceps javanica NT2301 strain (M is 20 bp DNA ladder, 8, 21, 2045, 2427, 2416, 4187, 4212, 4213, 6396, 6877, 8418, 7772, 9186, 9570, 10245, 10256, and 10306 are different SSRs loci.)

[0010] Figure 4 Electrophoresis pattern of PCR amplification products of SSRs loci of Cordyceps javanica SQ2301 strain (M is 20 bp DNA ladder, 8, 21, 2045, 2427, 2416, 4187, 4212, 4213, 6396, 6877, 8418, 7772, 9186, 9570, 10245, 10256, and 10306 are different SSRs loci, respectively.)

[0011] Figure 5 Electrophoresis pattern of PCR amplification products of cSSRs loci of Cordyceps javanica JS001 strain (M is 20 bp DNA ladder, 22, 71, 105, 134, 139, 185, 208, 223, 246, 248, 249, 255 are different cSSRs loci.)

[0012] Figure 6 Electrophoresis pattern of PCR amplification products of cSSRs loci of Cordyceps javanica SH2301 strain (M is a 20 bp DNA ladder, 22, 71, 105, 134, 139, 185, 208, 223, 246, 248, 249, and 255 are different cSSRs loci.)

[0013] Figure 7 Electrophoresis pattern of PCR amplification products of cSSRs loci of Cordyceps javanica NT2301 strain (M is a 20 bp DNA ladder, 22, 71, 105, 134, 139, 185, 208, 223, 246, 248, 249, and 255 are different cSSRs loci.)

[0014] Figure 8 Electrophoresis pattern of PCR amplification products of cSSRs loci of Cordyceps javanica SQ2301 strain (M is a 20 bp DNA ladder, 22, 71, 105, 134, 139, 185, 208, 223, 246, 248, 249, and 255 are different cSSRs loci.) DETAILED DESCRIPTION

[0015] The embodiment of the present invention is a method combining existing genome sequence comparative analysis and PCR.

[0016] Based on the genome data of Cordyceps javanica JS001 strain, Krait software was used to determine the SSRs and cSSRs (gene coding region SSRs) sites of Cordyceps javanica JS001 strain. Combined with the genome data of other Cordyceps javanica strains published by NCBI, the specific SSRs and cSSRs sites of Cordyceps javanica JS001 were preliminarily screened and determined.

[0017] Primers were designed based on SSRs and cSSRs sites, and then amplified in JS001 and other strains of Cordyceps javanica to further clarify the specific markers of JS001. SSR primers were designed using Primer 5 software, and the main parameters of primer design were: primer length 17-24 bp; PCR product size 90-350 bp; primer annealing temperature 45-60°C, (G+C) content 40%-70%, and the optimum was 50%.

[0018] Genomic DNA of four strains of Cordyceps javanica, JS001, SH2301, NT2301, and SQ2301, was extracted, and then PCR amplification and electrophoresis were performed. The total volume of the amplification reaction system was 25 μL, including 13 μL 2×TSINGKE Master Mix (blue), 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 2 μL template DNA and 8 μL ultrapure water. The SSRs amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min. The cSSRs amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min. PCR amplification products were detected by 2% agarose gel electrophoresis.

[0019] Implementation Effect

[0020] The genome analysis of JS001 and other strains of Cordyceps javanica showed that the specific SSRs sites included 8, 21, 2405, 2416, 2427, 2496, 4187, 4212, 4213, 6396, 6877, 7772, 8418, 9186, 9570, 10245, 10256, 10306, and the specific cSSRs sites included 22, 71, 105, 134, 139, 185, 208, 223, 246, 248, 249, 255. The relevant amplification primers were designed accordingly.

[0021] The specific sites of JS001, SH2301, NT2301 and SQ2301 strains of Javanese Cordyceps were verified, and the above-mentioned specific sites were amplified respectively. After PCR and agarose gel electrophoresis detection, it was found that JS001, SH2301, NT2301 and SQ2301 strains of Javanese Cordyceps could amplify SSRs sites 8, 21, 2405, 2427, 4187, 4212, 6877, 8418, 10245, 10256 and 10306, and SSRs site 9570 could only be amplified in JS001 strain of Javanese Cordyceps, and could not be amplified in the other three strains ( Figure 1-4 The amplification results of cSSRs sites 22, 71, 105, 139, 185, 223, 246, 248, 249, and 255 in the above strains showed that no site was found that could be specifically amplified only in the JS001 strain ( Figure 5-8 ), cannot be used as a specific molecular marker for JS001 strain screening.

[0022] from Figure 1-8 It can be seen that only SSRs site 9570 has a specific SSRs site amplification band in the JS001 strain of Cordyceps javanica, while the other three strains of Cordyceps javanica SH2301, NT2301, and SQ2301 have no amplification bands, indicating that 5'-TGCTTCCCTTGAACCACTCC-3' and 5'-AGTCATTTGGCGAGGAGAGG-3' can be used as molecular marker primers for the microsatellite site 9570 of Cordyceps javanica JS001. The molecular weight of the DNA fragment amplified by the primers was 147 bp, and the specific sequence was: ATTGCCGTCGAGCGAACG CTGCTTGCACCTTCCATT GCTCTTGTCCCCGTCACTACATGTTCTTCCCCTTCTTCTTCTTCTTCTTCTTCTTCCTCCTCACTCTCAATCCTCTCCTCGCCAAATGACTGTGTCTCATCGTAGTAACTG, in which the repeated sequence CTTCTTCTTCTTCTTCTTCTTCTT can be used as a specific SSRs molecular marker of the JS001 strain of Cordyceps javanica and used for the identification of this strain.

Claims

1. A specific molecular marker of the JS001 strain of Cordyceps javanica, characterized in that: The specific SSR site is 9570, and its PCR amplification primer sequence pair is 5'-TGCTTCCCTT GAACCACTCC-3' and 5'-AGTCATTTGGCGAGGAGAGG-3'. The amplified DNA fragment size is 147 bp. The specific sequence is ATTGCCGTCGAGCGAACGCTGCTTGC ACCTTCCATTGCTCTTGTCCCCGTCACTACATGTTCTTCCCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCTCCTCACTCTCAATCCTCTCCTCGCCAAATGACTGTGTCTCATCGTAGTAACTG.

2. The specific molecular marker of the Cordyceps javanica JS001 strain according to claim 1, characterized in that The SSR 9570 locus was used as a specific molecular marker for rapid identification and detection of the JS001 strain of Cordyceps javanica.

Images