A novel SNP molecular target for rapid identification of bacillus cereus and bacillus thuringiensis and application thereof

Abstract

The application discloses a novel SNP molecular target for rapidly identifying Bacillus cereus and Bacillus thuringiensis and application thereof. Genomes of Bacillus cereus strains are collected, authenticity of classification information of existing strains is verified and analyzed, and whole genome sequences of standard strains of Bacillus cereus and Bacillus thuringiensis are sliced according to CRISPR / Cas12a recognition requirements, and through comparison, a distinguishable target sequence NC-2 and ANN which is highly conservative in a non-coding region and has SNP difference is screened, and the application verifies and screens the novel molecular target for distinguishing Bacillus cereus and Bacillus thuringiensis by using experimental strains. The novel molecular target includes primer design of NC-2 and ANN, screening of primer pairs, and PCR-CRISPR / Cas12a experiments are carried out by taking Bacillus cereus and Bacillus thuringiensis as templates, so that accurate identification of Bacillus cereus and Bacillus thuringiensis is realized.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganism detection, and particularly relates to a novel SNP molecular target for rapid identification of Bacillus cereus and Bacillus thuringiensis and application thereof. BACKGROUND

[0002] Bacillus cereus and Bacillus thuringiensis belong to the same group of Bacillus cereus. Among them, Bacillus cereus is a common foodborne conditional pathogen, which can produce diarrhea toxin (enterotoxin) and emetic toxin. Bacillus thuringiensis is a kind of insect pathogen. It forms one or more parasporal crystals while forming spores, and the main component is insecticidal crystal protein, so it is widely used as a biological insecticide. Bacillus cereus and Bacillus thuringiensis are highly similar in physiological and biochemical characteristics, and the only difference that can be used for discrimination is the ability to produce parasporal crystals. In addition, the two have high genetic similarity, with 99%-100% similarity in 16S rRNA sequence, dDDH (digital DNA-DNA hybridization) value greater than the species division threshold of 70%, and ANI value greater than the species division threshold of 95%, all of which are higher than the standard value of population identification, and it is extremely difficult to distinguish. At present, there is no widely recognized rapid detection and identification method that can effectively distinguish Bacillus cereus and Bacillus thuringiensis worldwide, which may cause misjudgment during identification and bring great security risks to food safety and industry. Therefore, it is urgent to establish a method for accurate differentiation of Bacillus cereus and Bacillus thuringiensis.

[0003] At present, the method that can distinguish Bacillus cereus and Bacillus thuringiensis is still the traditional biochemical method. According to this method, Bacillus thuringiensis needs to be cultured for 4-5 days to produce protein crystals (parasporal crystals), while other Bacillus does not produce protein crystals. This process is time-consuming, and if the free spores are not abundant, the culture needs to be placed at room temperature for 2-3 days for secondary inspection. In addition, this method is greatly affected by the subjective judgment of the observer, and may produce misjudgment, which is not time-efficient and easy to operate in actual detection process. In recent years, with the continuous development of high-throughput sequencing technology, typing and comparison based on genomic information can realize the differentiation and identification of Bacillus cereus and Bacillus thuringiensis, but this method needs DNA extraction, second-generation sequencing, downstream bioinformatics analysis, etc., which is time-consuming, high in cost and operation requirement, and cannot meet the needs of laboratory routine use and grassroots high-throughput rapid detection.

[0004] Most of the current molecular detection methods for B. cereus group are based on some relatively conserved toxin genes, including the dodecapeptide cereulide and the genes for hemolytic enterotoxin hemolysin BL (Hbl), non-hemolytic enterotoxin (Nhe), cytotoxin K (CytK), enterotoxin (entFM), and emetic toxin (ces). qPCR is more sensitive and has better signal reading than PCR, but a method based on a single gene can only distinguish between B. cereus group and non-B. cereus group, and none of the above target genes can accurately distinguish between B. cereus and B. thuringiensis. PCR and 16s rRNA sequencing can only distinguish between B. cereus group and non-B. cereus group at the genus level, and cannot effectively distinguish between B. cereus and B. thuringiensis. In order to reduce the risk of misclassification and avoid the potentially harmful misclassification of the virulence potential of isolates, it is essential to obtain an accurate and rapid method for identifying and classifying B. cereus and B. thuringiensis.

[0005] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system is a kind of acquired immune system. CRISPR / Cas has the advantages of simple synthesis, convenient use and strong specificity, and in addition to being used for gene editing, it has become a research hotspot in the field of biosensing in recent years. At the same time, Cas protein also has non-specific transcleavage function, so CRISPR / Cas system can be combined with various nucleic acid amplification techniques, greatly improving the sensitivity and specificity of the entire detection system. DETECTR based on CRISPR / Cas12a and SHERLOCK nucleic acid detection method based on CRISPR / Cas13a have been developed, and some long-standing biosensing problems such as poor sensitivity and specificity have been solved. CRISRP / Cas system has excellent sensitivity for SNP differences compared to other means, and in the past, the differentiation work that often needs to be completed by high-throughput sequencing can now be quickly detected and identified using PCR-CRISPR / Cas12a fluorescence method. SUMMARY

[0006] The first object of the present application is to provide molecular targets NC-2 and ANN for identifying B. cereus and B. thuringiensis for non-disease diagnosis and treatment purposes, the nucleotide sequence of the NC-2 is shown as SEQ ID No. 1, and the nucleotide sequence of the ANN is shown as SEQ ID No. 2.

[0007] The two target sequences exist in the non-coding regions of Bacillus cereus and Bacillus thuringiensis, and the target genes are used for distinguishing Bacillus cereus and Bacillus thuringiensis, which can effectively distinguish the two strains in the fields of environment, food and its production chain, clinic, etc. The nucleotide sequence of the molecular target NC-2 is shown as SEQ ID NO. 1 (corresponding to Bacillus cereus), and the nucleotide sequence of the molecular target (ANN) is shown as SEQ ID NO. 2 (corresponding to Bacillus thuringiensis).

[0008] A second object of the present application is to provide a primer set for identifying Bacillus cereus and Bacillus thuringiensis for non-disease diagnosis and treatment purposes, the sequences of which are shown as SEQ ID No. 5 and SEQ ID No. 6, or as SEQ ID No. 7 and SEQ ID No. 8.

[0009] The primer set is as follows:

[0010] NC-2_F2: 5'-ACTTAGAACGGTTCTTACCTTTTGTCGTCA-3' (SEQ ID NO. 5);

[0011] NC-2_R3: 5'-AACACGGTGTATATGTGTCAACGAAATCTG-3' (SEQ ID NO. 6);

[0012] ANN_F2: 5'-TCCAAGAAAAGAAGTAGAAGAAATCACAACA-3' (SEQ ID NO. 7);

[0013] ANN_R1: 5'-TATGAACATATAGAAGCTTGCTCACGATTA-3' (SEQ ID NO. 8).

[0014] The primer set is designed according to the nucleotide sequences shown as SEQ ID NO. 1 and SEQ ID NO. 2, and the SNP difference containing the molecular target amplicon is recognized based on the PCR amplification reaction system and the CRISPR / Cas12a detection system to effectively distinguish the two.

[0015] The third object of the present application is to provide a method for rapid identification of Bacillus cereus and Bacillus thuringiensis for non-disease diagnosis and treatment purposes, which comprises the following steps: extracting genomic DNA of a sample to be tested, using the genomic DNA as a template, using the primer set described above as PCR amplification primers, using PCR-CRISPR / Cas12a fluorescence method to identify SNP differences of the amplicon containing the molecular target, and if there is a sequence completely complementary to the crRNA in the amplicon, the trans-cleavage activity is activated, the reporter probe is cut to generate a fluorescence signal, and Bacillus cereus and Bacillus thuringiensis are effectively distinguished.

[0016] Preferably, the PCR-CRISPR / Cas12a fluorescence method has a PCR reaction system comprising Taq DNA Polymerase, sample DNA to be tested, primer pairs, and sterilized double distilled water; and a CRISPR / Cas12a detection system comprising Cas12a buffer, Cas12a protein, crRNA, FQ-ssDNA, and PCR amplification product.

[0017] Preferably, the PCR reaction system is 2x Taq DNA Polymerase 10 μL, sample DNA to be tested 50 ng, 10 μM upper and lower upstream primers each 1 μL, and sterilized double distilled water to make up the volume to 20 μL.

[0018] Preferably, the CRISPR / Cas12a detection system is 10x Cas12a buffer 2 μL, PCR amplification product 1 μL, 10 μM Cas12a protein 0.2 μL, 10 μM crRNA 0.6 μL, 10 μM FQ-ssDNA 1.2 μL, and DEPC water to make up the volume to 20 μL.

[0019] Preferably, the PCR-CRISPR / Cas12a fluorescence method first uses a three-step method for PCR on a Bio-Rad Thermal Cycler, and the reaction program is: 95℃ pre-denaturation for 5 min, one cycle; 95℃ denaturation for 10 s; 55℃ annealing for 20 s, 72℃ extension for 10 s, a total of 30 cycles; then constant temperature reaction on a LightCycler96, and the CRISPR / Cas12a detection reaction program is: 37℃ incubation for 40 s; 37℃ incubation and real-time monitoring of FAM fluorescence signal for 40 s, a total of 30 cycles.

[0020] The fourth object of the present application is to provide a kit for rapid identification of Bacillus cereus and Bacillus thuringiensis for non-disease diagnosis and treatment purposes, which comprises the primer set described above.

[0021] A fifth object of the present application is to provide the use of the above-mentioned molecular target, the above-mentioned primer set, the above-mentioned method or the above-mentioned kit for the rapid identification of Bacillus cereus and Bacillus thuringiensis for non-disease diagnosis and treatment purposes.

[0022] A sixth object of the present application is to provide a method for accurately screening and distinguishing new molecular targets of Bacillus cereus and Bacillus thuringiensis, comprising the following steps:

[0023] (1) The Bacillus cereus group strain in the database includes Bacillus cereus and Bacillus thuringiensis genome download, de-redundancy and genome annotation by Prokka software;

[0024] (2) Bacillus cereus group strain genome classification information authenticity verification analysis: average nucleotide homology analysis, using existing international current Bacillus cereus group or closely related species reference strains as standard strains of Bacillus cereus group, comparing and analyzing the whole genome similarity between unknown strains and standard strains, selecting the highest similarity with the above-mentioned standard strains, preliminarily considering that the unknown strain is the species, using PhyloSuite software for ribosomal protein multiple locus sequence typing analysis, extracting ribosomal protein genes and connecting them in series, constructing a maximum likelihood tree, and confirming the strain species identity, using the whole genome sequence to construct a real identity verification Bacillus cereus local alignment library;

[0025] (3) Screening new molecular targets for distinguishing Bacillus cereus and Bacillus thuringiensis: slicing the obtained Bacillus cereus and Bacillus thuringiensis whole genome sequences with authenticity of identity information according to the requirement of Cas12a protein recognizing PAM sequence, extracting nucleic acid sequences of 27 nt continuous starting with TTN or TTTV, performing Blast on all extracted sequences with the local alignment library, screening out sequences that only match Bacillus cereus or Bacillus thuringiensis through scripts, and predicting the secondary structure of candidate crRNA to screen out target sequences with linear structure recognition region.

[0026] The present application collects a large number of public database and Bacillus cereus group strain genomes in previous studies, conducts authenticity verification analysis on the existing strain classification information, slices the whole genome sequences of Bacillus cereus and Bacillus thuringiensis according to the recognition requirement of CRISPR / Cas12a, obtains target sequences with high conservation and SNP differences in non-coding regions, and designs primers, screens primer pairs, and performs PCR-CRISPR / Cas12a fluorescence method experiments with Bacillus cereus and Bacillus thuringiensis DNA as templates, thereby realizing accurate identification of Bacillus cereus and Bacillus thuringiensis.

[0027] This invention employs sequence alignment and screening of candidate sequences from tissue sections, crRNA secondary structure prediction, and experimental verification to detect specific SNP sites, thereby effectively identifying *Bacillus cereus* and *Bacillus thuringiensis*. Based on the PCR-CRISPR / Cas12a fluorescence method, this invention eliminates the need for sequence-specific probes compared to qPCR. The entire process is simple and offers advantages such as high sensitivity, good specificity, low cost, and fast detection speed, while also providing high resolution capable of distinguishing changes in individual bases. Attached Figure Description

[0028] Figure 1 Phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on rMLST.

[0029] Figure 2 This is a schematic diagram of SNP sites in the NC-2 and ANN target sequences, where A, B, C, and D represent the conservation of NC-2, the conservation of ANN, the specificity of NC-2, and the specificity of ANN, respectively.

[0030] Figure 3 This is a prediction diagram of the secondary structure of crRNA targeting NC-2(A) and ANN(B).

[0031] Figure 4 Phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on NC-2 and ANN target sequences.

[0032] Figure 5 Phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on NC-2 and ANN target sequence amplicon sequences.

[0033] Figure 6 To demonstrate the specificity of Bacillus cereus and Bacillus thuringiensis based on the PCR-CRISPR / Cas12a method, A and B respectively used NC-2 and ANN, and C in the legend is the negative control.

[0034] Figure 7 To enhance the conservation of PCR-CRISPR / Cas12a in identifying Bacillus cereus and Bacillus thuringiensis, A and B were determined using NC-2 and ANN, respectively, with C representing the negative control.

[0035] Figure 8 To assess the sensitivity of PCR-CRISPR / Cas12a method for identifying Bacillus cereus and Bacillus thuringiensis, A and B are correlation analyses of colony-forming units and fluorescence intensity in pure culture mode for Bacillus cereus and Bacillus thuringiensis, respectively. In the legend, C represents 0 CFU / mL. Detailed Implementation

[0036] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings.

[0037] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0038] Example 1:

[0039] 1. Based on the genomes of Bacillus cereus or closely related species in GenBank and existing Bacillus cereus and Bacillus thuringiensis data, redundant genome data (contigs ≥ 200) that did not meet the analysis requirements were removed after downloading the genomes. The genome names were modified, and genome annotation was performed using Prokka software. Verification analysis of the authenticity of Bacillus cereus strain genome classification information: First, ANI analysis was performed. Fourteen standard strains (Table 1) of the Bacillus cereus group were selected as reference strains, including those within the current detection standards, recognized as new species and considered validly published by the International Code of Nomenclature for Prokaryotes, and those with a certain sample size in NCBI public data. The whole genome similarity of unknown strains was compared with that of the standard strains. The strain with the highest similarity was preliminarily considered to be of that species. Ribosomal multilocus sequence typing (rMLST) analysis was performed using PhyloSuite software, extracting 53 ribosomal protein genes (Table 2), which were then tandemly constructed using a maximum likelihood tree. Strains whose evolutionary relationships and ANI analysis results are consistent are confirmed to be Bacillus cereus or Bacillus thuringiensis. Figure 1 ).like Figure 1 As shown, different colors represent different Bacillus species. The rMLST method can effectively distinguish between Bacillus cereus and Bacillus thuringiensis strains. New molecular targets for screening and differentiating Bacillus cereus and Bacillus thuringiensis were developed: The obtained authentic whole genome sequences of Bacillus cereus and Bacillus thuringiensis were sliced ​​according to the PAM sequence requirements for Cas12a protein recognition. A continuous 27nt nucleic acid sequence starting with TTN or TTTV was extracted. All extracted sequences were BLASTed against a local alignment library (based on the genome structure of strains with verified identities from NCBI). A script was used to screen for sequences that perfectly matched only Bacillus cereus or Bacillus thuringiensis. The nucleotide sequences are shown in SEQ ID No. 1-2. SEQ ID No. 1 is the NC-2 nucleotide sequence of Bacillus cereus (e.g., Bacillus cereus ATCC 14579), and SEQ ID No. 2 is the ANN nucleotide sequence of Bacillus thuringiensis (e.g., Bacillus thuringiensis ATCC 10792).

[0040] Table 1 13 reference strains of the current international B. cereus group or related species

[0041]

[0042] Table 2 53 ribosomal protein genes

[0043]

[0044]

[0045] 2. According to the gene sequences of B. cereus and B. thuringiensis provided on GenBank and the completed sequencing, the difference target fragments NC-2 and ANN are mined through slice alignment screening of the whole genome sequence, and the SNP sites are conservative and specific as shown in the following table: Figure 2 To ensure the recognition efficiency in the detection process, the secondary structure of the candidate crRNA is predicted by the RNAfold web server (http: / / rna.urv.es / RNAfold.cgi), and the prediction result shows that the target recognition region is in linear structure. Finally, primers are designed based on the screened target sequence. Figure 3

[0046] The specific primers are as follows:

[0047] NC-2_F2: 5'-ACTTAGAACGGTTCTTACCTTTTGTCGTCA-3' (SEQ ID NO. 5);

[0048] NC-2_R3: 5'-AACACGGTGTATATGTGTCAACGAAATCTG-3' (SEQ ID NO. 6);

[0049] ANN_F2: 5'-TCCAAGAAAAGAAGTAGAAGAAATCACAACA-3' (SEQ ID NO. 7);

[0050] ANN_R1: 5'-TATGAACATATAGAAGCTTGCTCACGATTA-3' (SEQ ID NO. 8).

[0051] The primer is used for amplifying the B. cereus genomic DNA or the B. thuringiensis genomic DNA, wherein the amplification product in the B. cereus is the nucleotide sequence shown in SEQ ID NO. 3, and the amplification product in the B. thuringiensis is the nucleotide sequence shown in SEQ ID NO. 4.

[0052] ​3. Genomic DNA was extracted from 1 mL B. cereus ATCC 14579 and 1 mL B. thuringiensis ATCC 10792 culture solution using HiPure Bacterial DNA Kit D3146-03 (Guangzhou Meiji Biological Technology Co., Ltd.) according to the instructions, and the concentration and purity of the genomic DNA were detected using Thermo Scientific NanoDrop 2000c UV-Vis Spectrophotometer. TM NanoDrop TM The concentration and purity of the genomic DNA were detected using Thermo Scientific NanoDrop 2000c UV-Vis Spectrophotometer.

[0053] 4. To preliminarily explore the effect of the designed primers on the identification of B. cereus and B. thuringiensis, phylogenetic tree analysis was performed based on NC-2 (SEQ ID NO. 1) and ANN sequence (SEQ ID NO. 2) and their amplicons (SEQ ID NO. 3, SEQ ID NO. 4). Figure 4 and Figure 5 According to the neighbor-joining method, the difference sequences NC-2 and ANN can effectively distinguish B. cereus and B. thuringiensis strains. Figure 4 and Figure 5

[0054] 5. After accurate identification of B. cereus and B. thuringiensis, PCR-CIRSPR / Cas12a specific detection was performed based on target sequences NC-2 and ANN and other standard strains (Table 3) according to the following steps:

[0055] Prepare 10 mM forward primer solution and reverse primer solution with sterile water, and add 2x Taq DNA Polymerase 10 mL, NC-2 or ANN target sequence forward primer (step 2 NC-2_F2 or ANN_F2) 1 mL, and NC-2 or ANN reverse primer (step 2 NC-2_R3 or ANN_R1) 1 mL in a PCR tube. Add 50 ng of genomic DNA and sterile water as a negative control in different reaction wells, and add sterile water to each reaction well to a total volume of 20 mL. Perform PCR using a three-step method on a Bio-Rad Thermal Cycler with the following reaction program: 95°C pre-denaturation for 5 min, one cycle; 95°C denaturation for 10 s; 55°C annealing for 20 s, and 72°C extension for 10 s, for a total of 30 cycles.

[0056] ​In each reaction well of the eight-tube tube, 2 μL of 10x Cas12a buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 100 μg / mL BSA, pH 7.9), 0.2 μL of 10 μM Cas12a protein (induced expression in the laboratory of Guangdong Institute of Microbiology), 0.6 μL of 10 μM crRNA (synthesized by Shanghai Genechem Co., Ltd.), 1.2 μL of 10 μM FQ-ssDNA (synthesized by Huada Gene Co., Ltd.) (5'-FAM-TTATT-BHQ2-3', 5'-6-carboxyfluorescein (FAM)-TTATT-Black Hole Quencher 2 (BHQ2)-3' fluorescent probe) were added in sequence, and the volume was made up to 19 μL with DEPC water. In different reaction wells, 1 μL of amplification product of the previous step was added (1 μL of DEPC water was added as a negative control without adding the amplification product). The reaction was performed in a LightCycler96 h constant temperature device, and the CRISPR / Cas12a detection reaction program was as follows: 37°C incubation for 40 s; 37°C incubation and real-time monitoring of FAM fluorescence signal for 40 s, for a total of 30 cycles. The specific sequence of crRNA is as follows:

[0057] NC-2_crRNA: UAAUUUCUACUAAGUGUAGAUAACAUAAUUUCUUUACCUCAU;

[0058] ANN_crRNA: UAAUUUCUACUAAGUGUAGAUUAUCGAUUUGUUGGGCUAAAA.

[0059] Table 3 introduces the standard strains used in the experiment, which proves that the identification of Bacillus cereus and Bacillus thuringiensis can be effectively realized Figure 6 with good specificity.

[0060] Table 3 PCR-CRISPR / Cas12a fluorescence method experimental standard strain information

[0061]

[0062]

[0063] 6. Based on the NC-2 and ANN target sequences, the number of Bacillus cereus and Bacillus thuringiensis strains (Table 4) was increased for detection, and the PCR-CRISPR / Cas12a fluorescence method according to step 5 was used for conservative detection. The LightCycler96 software was used to analyze the fluorescence intensity value of the reaction in 30 min, and the conservation was good as shown in Figure 7 .

[0064] Table 4 PCR-CRISPR / Cas12a verification experiment strain information

[0065]

[0066] 7. After accurate identification of B. cereus and B. thuringiensis, the sensitivity detection was carried out based on the NC-2 and ANN target sequences, and the 10-fold gradient dilution culture counting was carried out according to the PCR-CRISPR / Cas12a detection method of step 5, and the standard strains of B. cereus ATCC-1457 and B. thuringiensis ATCC-10792 were detected with different unit volume of colony DNA template amount. The linear detection range of this method for B. cereus was 3.7 x 10 3 CFU / mL-3.7 x 10 7 CFU / mL, and the linear detection range for B. thuringiensis was 5.5 x 10 1 CFU / mL-5.5 x 10 7 CFU / mL. Figure 8

[0067] SEQ ID NO. 1

[0068] tttcaacataatttctttacctcat

[0069] SEQ ID NO. 2

[0070] ttatatcgatttgttgggctaaaat

[0071] SEQ ID NO. 3

[0072] acttagaacggttcttaccttttgtcgtca tttctccgtaacgcactaaaatatattcata tttcaac ataatttctttacctcat cacttcatataattttggcatcgtctcttttacaataccttcaaattgttttacttcttccattgtgttttctggtgccaaactaatacgaatagcgcttgcagctgctgcatgcggcactcccattgacactaacactctgctcacttcatttgcttttgaagaacaag cagatttcgttgacacatatacaccgtgtt

[0073] SEQ ID NO. 4

[0074] tccaagaaaagaagtagaagaaatcacaaca ​tttgttttttaaagtgctacatagaaaagacattggacatatcaatgtctttttatttttgagcgggta ttatatcgatttgttgggctaaaat gataaataagaaggaattactatttatttcataaaaaaaattaatgttctattaaggaaagtatgatacatt aatcgtgagcaagcttctatatg ttcata.

Claims

1. Use of the molecular targets NC-2 and ANN for the identification of B. cereus and B. thuringiensis for diagnostic and / or therapeutic purposes other than disease, characterized in that, The nucleotide sequence of the NC-2 is shown as SEQ ID No. 1, and the nucleotide sequence of the ANN is shown as SEQ ID No.

2.

2. A method for rapid identification of Bacillus cereus and Bacillus thuringiensis for non-disease diagnostic and / or therapeutic purposes, characterized in that, The method comprises the following steps: Genomic DNA of the sample to be tested is extracted, and the genomic DNA is used as a template, a primer group is used as a PCR amplification primer, and a PCR-CRISPR / Cas12a fluorescence method is used to identify SNP differences of an amplicon containing a molecular target NC-2 and ANN, if there is a sequence completely complementary to the crRNA in the amplicon, the trans-cleavage activity is activated, the reporter probe is cut to generate a fluorescence signal, and B. cereus and B. thuringiensis are effectively distinguished, the primer group sequences are shown as SEQ ID No. 5 and SEQ ID No. 6, or shown as SEQ ID No. 7 and SEQ ID No. 8, the nucleotide sequence of the NC-2 is shown as SEQ ID No. 1, and the nucleotide sequence of the ANN is shown as SEQ ID No.

2.

3. The method of claim 2, wherein, The PCR-CRISPR / Cas12a fluorescence method comprises a PCR reaction system, and the PCR reaction system comprises Taq DNA Polymerase, sample DNA to be tested, a primer pair, and sterilized double-distilled water; and a CRISPR / Cas12a detection system, and the CRISPR / Cas12a detection system comprises a Cas12a buffer, Cas12a protein, crRNA, FQ-ssDNA, and a PCR amplification product.

4. The method of claim 3, wherein, The PCR reaction system is 2×Taq DNA Polymerase 10 μL, sample DNA to be tested 50 ng, 10 μM upper and lower upstream primers each 1 μL, and sterilized double-distilled water, and the volume is made up to 20 μL.

5. The method of claim 3, wherein, The CRISPR / Cas12a detection system is 10×Cas12a buffer 2 μL, PCR amplification product 1 μL, 10 μM Cas12a protein 0.2 μL, 10 μM crRNA 0.6 μL, 10 μM FQ-ssDNA 1.2 μL, and DEPC water, and the volume is made up to 20 μL.

6. The method according to claim 2 or 3, characterized in that, The PCR-CRISPR / Cas12a fluorescence method is first subjected to PCR by using a three-step method on a Bio-Rad Thermal Cyclers, and the reaction program is as follows: 95℃ pre-denaturation for 5 min, one cycle; 95℃ denaturation for 10 s; 55℃ annealing for 20 s, and 72℃ extension for 10 s, a total of 30 cycles; and then constant temperature reaction is performed on a LightCycler96.

7. The method of claim 2 is used for rapid identification of B. cereus and B. thuringiensis for non-disease diagnosis and / or treatment purposes.

Images