Biosynthesis of elemene and its application in tea plant resistance to aphids

Abstract

The invention discloses a biosynthesis of elemene and its application in tea tree anti-aphid, belonging to the field of biotechnology, elemene synthase, and its amino acid sequence is shown in SEQ ID No. 1. By increasing the content of elemene in tea trees, the ability of tea trees to avoid tea aphids is improved. The method of the invention can effectively control aphid pests, protect the growth and development of tea trees, improve the quality and yield of crops, and increase farmers' income.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the biosynthesis of elemene and application of elemene in resisting aphids in tea trees. Background Art

[0002] At present, tea, as a popular healthy drink, is becoming more and more popular among people. In recent years, due to the great changes in the global climate, the natural environment has become abnormal, making tea trees more susceptible to abiotic (temperature, drought, salinity, heavy metals, etc.) and biotic stresses during cultivation, which ultimately greatly affects the growth, development, yield and quality of tea trees. Under adverse stress, plants often evolve a set of complex and effective defense mechanisms (signal transduction, transcriptional regulation, response, etc.) to avoid or reduce damage to themselves. With the rapid development of molecular biology, the molecular mechanism of tea tree stress resistance has been elucidated through various biotechnology methods, which is of great significance for enhancing tea tree stress resistance and cultivating tea tree varieties with high stress resistance.

[0003] Pests and diseases are important factors that affect its yield and quality. The occurrence of pests and diseases in my country's tea gardens is characterized by many types, wide occurrence areas, and great harm, which often brings huge economic losses to tea production. Therefore, tea tree pest and disease control has always been regarded as an indispensable part of the production process. At present, pest control generally chooses the method of spraying pesticides, but it is easy to cause pesticide residues, drug resistance, killing natural enemies, and polluting the environment. It is not worth promoting. Therefore, green prevention has gradually been promoted. Among them, tea tree volatile substances, as an information substance for communication between plants, can improve the resistance of tea trees, in the hope of becoming a new way as a green prevention and control method.

[0004] Tea aphids often harm tea during the spring harvesting period, causing poor development of new tea shoots, hindered bud and leaf extension, and in severe cases, causing leaf curling and reduced yield. The dry tea made from the affected buds and leaves will also become dark, turbid and fishy, ​​resulting in a decline in quality. Due to the consideration of the safe interval and pesticide residue of pesticides, spraying pesticides to control aphids often delays the production date of high-quality tea, missing the best production and sales period. How to effectively prevent and control aphids has become an issue that cannot be ignored in current tea production.

[0005] Tea aphids, also known as tea dichotomous aphids, are incomplete metamorphosis insects belonging to the order Hemiptera and the family Aphididae. They can reproduce continuously parthenogenetically or bisexually, and have strong reproductive capacity. They can produce a large number of nymphs, and can grow one generation in 5 to 7 days, with obvious overlapping of generations. Tea aphids are divided into winged aphids and wingless aphids. The winged adult aphids are about 2 mm long, dark brown, and shiny. The midrib of the forewings is bifurcated, with 4 black spots on each side of the abdomen and back. The length of the abdominal tube is longer than the tail and shorter than the fourth segment of the antennae, with a net pattern at the base. The winged nymphs are brown-brown, and the wing buds are milky white. The wingless adult aphids are hypertrophic, nearly oval, brown to dark brown, with black antennae and milky white bases of each segment. The wingless nymphs are small and lighter in color, light brown or light yellow. The eggs are oblong, about 0.6 mm long, slightly thin at one end, with a significant bulge on the back, and are dark and shiny. It is widely distributed in my country's vast tea-growing areas. It has a strong tendency to attract young plants. It likes to gather on the back of new shoots and tender stems to suck juice, which hinders the extension of damaged buds and leaves, even stagnates, and seriously shrinks or even withers. The honeydew it excretes can also cause coal fungus parasitism. It is one of the pests that seriously affects the yield and quality of spring and autumn tea. Tea aphids mainly cause harm by parthenogenesis during the spring tea production period. If attractants are sprayed in the field in autumn to interfere with the mating of tea aphids to produce overwintering generations, the insect population base in the spring of the following year may be reduced, reducing the degree of damage. Based on this, a method of using volatiles induced by herbivorous insects as a defensive weapon to improve the avoidance of tea trees to tea aphids is of great importance. Summary of the invention

[0006] The technical problem to be solved by the present invention is: how to utilize the endogenous metabolites released by the tea tree itself to replace the traditional pesticides, and at the same time inhibit tea aphids and ensure the quality and safety of tea leaves.

[0007] The technical solution of the present invention is: elemene synthase, whose amino acid sequence is shown in SEQ ID No.1.

[0008] The nucleotide sequence of the gene encoding the above-mentioned elemene synthase is shown in SEQ ID No.2.

[0009] An expression vector containing a gene encoding the above-mentioned elemene synthase.

[0010] Application of the above-mentioned elemene synthase or the gene or the expression vector in synthesizing elemene.

[0011] A method for improving the repelling ability of tea trees to tea aphids, by increasing the content of elemene in the tea trees, thereby improving the repelling ability of the tea trees to tea aphids.

[0012] Furthermore, the method for increasing the content of elemene in tea plants is to overexpress the above-mentioned gene in tea plants.

[0013] Application of elemene in resistance against tea aphids.

[0014] Application of elemene in preparing preparations against tea aphids.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. Control aphid pests: By detecting and utilizing the repellency of aphids’ endogenous aroma, more efficient aphid control methods can be developed, thereby reducing crop losses caused by aphid pests.

[0017] 2. Environmentally friendly: Compared with traditional chemical pesticide control methods, aphid endogenous aroma repulsion detection technology can reduce environmental pollution and damage to the ecosystem, and is more environmentally friendly.

[0018] 3. Reduce the use of pesticides: The use of aphid endogenous aroma repulsion detection technology can achieve accurate aphid control and avoid excessive use of pesticides, thereby reducing the use of pesticides, reducing crop residues and pollution to the environment.

[0019] 4. Improve the quality and yield of crops: Effective control of aphid pests can protect the growth and development of tea trees, improve the quality and yield of crops, and increase farmers' income.

[0020] 5. Sustainable agricultural development: The application of aphid endogenous aroma repulsion detection technology can promote sustainable agricultural development, reduce dependence on chemical pesticides, protect the ecological environment, and improve the sustainability of agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the protein gel image after prokaryotic expression. The base sequence sent to the company was calculated using a translation website to calculate the protein mass of 65.88kDa. The protein purification tag is 26kDa. The corresponding position is compared with the protein marker in the protein electrophoresis gel result image. The molecular mass of the translated protein is consistent with the expectation.

[0022] Figure 2 To analyze the in vitro enzyme activity after the enzyme protein was expressed, the volatile components were detected by GC-MS. β-elemene peaked at 28.4 min, which was the same as the mass spectrum and peak time of the standard, and the relative peak area of ​​this peak was the highest. It can be determined that this gene mainly uses FPP as a substrate, and the main product synthesized is β-elemene.

[0023] Figure 3Analysis of enzyme activity in tea plants after enzyme protein expression (Figure A is the quantitative expression of tea leaf after the gene is overexpressed in tea plants. To determine the overexpression of the target gene, the result analysis B is the determination of the aroma content of tea leaves after overexpression, which is about 0.95PPM. C is the analysis of volatile components of leaves after gene overexpression in tea plants. GC-MS detected elemene. Comparison with the standard product shows that the product can be detected in the overexpressed tea plant).

[0024] Figure 4 Design diagram for aphid avoidance experiment;

[0025] Figure 5 The avoidance rate of different concentrations of elemene to aphids at different times was used to judge the effect of aphids on β-elemene. The statistical method was (±SEM) (n=5). The values ​​are converted data. SPSS17.0 was used to perform Duncan test to determine the significance of the differences between the groups. Means with similar letters had no significant difference.

[0026] Figure 6 The results of the aphid toxicity test were used to determine whether elemene had toxic activity. The population had a significant toxic effect compared to the control, and the overall number of aphids showed a downward trend within 48 hours, but the effect was weaker than that of the insecticide imidacloprid.

[0027] Figure 7 To verify the inhibitory effect of AsODN on the target gene, the expression level of the target gene was determined after silencing the elemene synthase gene for 3 days (A). The aphid population showed an upward trend compared with the blank control, which indirectly proved that the gene had an insect-resistant effect on aphids (B). DETAILED DESCRIPTION

[0028] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0029] 1. Candidate gene cloning

[0030] The target gene (nucleotide sequence is shown in SEQ ID No. 2, encoding the protein of the amino acid sequence shown in SEQ ID No. 1) was amplified using the cDNA of Shucha Zaocha tree as a template. The PCR product was purified using a gel extraction kit. The purified product was connected to the pGEX-4T1 vector linearized by enzyme BamH Ι and enzyme Sal Ι, and then transferred into competent cells DH5α. The bacterial solution was evenly spread on LB medium (carbenicillin cab: 50 μg / mL) and inverted overnight culture at 37°C for 10h-12h. A single colony was picked in 300 μL liquid LB medium (carbenicillin cab: 50 μg / mL), shaken and cultured at 37°C and 200rpm for 2h, and 1 μL was taken for colony PCR detection. The colony PCR product was detected using agarose gel, and the bacterial solution that met the length of the target gene was selected and sent to Anhui General Biological Co., Ltd. for sequencing.

[0031] 2. Expression and purification of exogenous proteins

[0032] Transform the recombinant plasmid with correct sequencing and the negative control (empty load) into E. coli BL21 (DE3) pLysS competent cells, evenly spread on LB medium (carbenicillin cab: 50 μg / mL, chloramphenicol Cm: 50 μg / mL), and culture at 37°C overnight for 10-12 hours. Pick a single clone in liquid LB medium with the same resistance, and culture at 37°C, 200 rpm, shaking until OD 600 Between 0.6 and 0.8. After the culture medium was cooled to 16°C, a final concentration of 1 mM isopropyl-β-D-thiogalactoside (IPTG) was added, and the colonies were collected by centrifugation at 16°C and 150 rpm for 22 hours, ultrasonically broken, and purified using GST-bound resin. The concentration of the purified protein was determined using the Coomassie Brilliant Blue method. The size of the protein was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The results are as follows: Figure 1 As shown, the prediction of protein molecular mass by translating DNA sequence into amino acid sequence translation website is consistent with the results.

[0033] 3. In vitro enzyme activity analysis

[0034] (1) The system used was: 1 mL reaction buffer (pH 7.5 50 mM Tris-HCL, 10 Mm MgCl2, 5 mM DTT); 50-100 μg pure enzyme (protein purified after prokaryotic expression of the gene in Escherichia coli) plus 5 μg FPP / GPP; a 50 mL gas chromatography-mass spectrometer was used for reaction at 30°C in a water bath for 1 h, followed by solid phase microextraction (SPME) manual headspace adsorption (2 cm-50 / 30 μm DVB / CarboxenTM / PDMS Stable FlexTM from Supelco) at 42°C in a water bath for 30 min; the reaction system products were then detected by GC-MS.

[0035] (2) Detection of enzyme activity products: Gas phase conditions: injection port temperature 250°C, separation of carrier gas: 1 mL / min of helium using a fused silica column (DB-5, 30 m×0.25 mm×0.25 μm, Folsom, USA); non-split injection; column oven initial temperature 45°C, maintained for 1 min, increased to 90°C at a rate of 20°C / min, maintained for 1 min, increased to 110°C at a rate of 3°C / min, maintained for 0 min, increased to 250°C at a rate of 30°C / min, maintained for 3 min.

[0036] (3) Mass spectrometry conditions: solvent delay 3.00 min, ion source EI, electron energy 80 eV, full ion scan mode mass scan range 41-300 m / z.

[0037] The results are as follows Figure 2 As shown, the products formed by the enzymatic activity of the protein in vitro were analyzed by GC-MS. The products formed in the in vitro enzymatic activity reaction system without and with FPP were analyzed. The mass spectrum and retention index of the product were compared with those of the standard, and β-elemene was identified as the main product.

[0038] 4. Prokaryotic overexpression in tea plants

[0039] The gene was constructed into the vector pCAMBIA1302, and the restriction endonucleases were replaced with NcoI and Spel. After colony PCR detection, the correct sequencing vector and the empty vector were transferred into GV3101 Agrobacterium using the freeze-thaw method. Agrobacterium containing the correctly sequenced gene and the empty vector was activated by shaking a small amount at 28°C / 220rpm overnight, and then 1mL of the bacterial solution was inoculated into LB liquid culture medium containing the corresponding antibiotics at a ratio of 1:100, and the shaking was continued at 28°C / 220rpm until the OD600 of the bacterial solution reached between 1.2 and 1.8; the shaken bacterial solution was centrifuged at 5000xg for 10min, and then the bacteria were resuspended with infection solution (MES50mM; MgCl2 10mM; acetosyringone 150μM), and the OD600 was adjusted to about 0.6; tea plants in good growth condition in the solar greenhouse were selected, and a 1mL syringe without a gun tip was used to inject from the lower epidermis of the tea leaves, and the injection was marked; after that, the injected tea plants were cultured in weak light for 2d, and the complete leaves were collected with liquid nitrogen.

[0040] Real-time fluorescence quantitative PCR (Real-time qPCR) analysis Design quantitative primers and verify their specificity: Submit the full-length cDNA of the gene to be quantified to the primer3plus website (https: / / dev.primer3plus.com / index.html) to design quantitative primers, and then submit the candidate primer pairs to http: / / tpdb.shengxin.ren / for BLAST, and select specific primers (Table 3-4) for quantitative analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference gene. Each treatment was repeated at least 3 times, and each biological repeat was repeated 3 times. 2 -ΔCT The relative expression level of each gene was calculated.

[0041] The results are as follows Figure 3 As shown in A, the relative expression level of the gene was measured by real-time fluorescence quantitative gene expression in the overexpressed tea leaves, indicating that the gene was indeed overexpressed in the tea tree.

[0042] 5. Analysis of enzyme activity in tea trees

[0043] (1) After freeze-drying for 12 h, grind the mixture, weigh 0.1 g and put it into a 20 ml gas chromatography-mass spectrometry bottle, add 1 μl of 1 PPM ethyl decanoate methanol as an internal standard, incubate at 60°C for 50 min, and then detect the product of the reaction system by GC-MS.

[0044] (2) Detection of enzyme activity products: non-split injection; column oven initial temperature 50°C, maintained for 2 min, increased to 80°C at a rate of 2°C / min, maintained for 1 min, increased to 100°C at a rate of 3°C / min, maintained for 4 min, increased to 130°C at a rate of 3°C / min, maintained for 4 min, increased to 150°C at a rate of 5°C / min, maintained for 0 min, increased to 200°C at a rate of 10°C / min, maintained for 0 min, increased to 240°C at a rate of 20°C / min, maintained for 3 min.

[0045] (3) Mass spectrometry conditions: solvent delay 3.00 min, ion source EI, electron energy 80 eV, full ion scan mode mass scan range 41-300 m / z.

[0046] (4) Gas chromatography conditions: A ThermoFisher gas chromatograph Trace1300 and a mass spectrometer ISQ3000 (Thermo Fisher Scientific, San Jose, CA, USA) equipped with a TG-5MS quartz capillary column (30 m×0.25 mm×0.25 μm) were used; high-purity helium with a purity of 99.999% was used as the carrier gas with a flow rate of 1 mL / min and an inlet temperature of 250°C.

[0047] The results are as follows Figure 3 As shown in B and C, the gene was transiently overexpressed in tea leaves without adding FPP, and the formed products were analyzed by GC-MS, as well as the content of elemene in tea leaves after overexpression in tea trees.

[0048] 6. Aphid endogenous aroma avoidance experiment

[0049] The behavioral response of wingless aphids to tea volatiles was determined by using a circular plastic aphid repellent. A plastic culture dish (15 cm in diameter) was perforated with 2 mm diameter holes on all sides and sealed with a sealing film. A 0.5 ml centrifuge tube was sealed with a sealing film and stuffed with cotton. Double-sided tape was attached to the edge of the sealing film on the centrifuge tube, and a small amount of cotton was stuffed in the middle to stick the centrifuge tube to the culture dish. Before use, scented water was injected into the centrifuge tube with a syringe, and the woody part was retained by using branches cut into an inclined surface. The cotton containing scented water was inserted into the test tube through the hole and the sealing film in the culture dish. Untreated pure water was injected into the upper and lower centrifuge tubes, and branches without aphids were inserted; the right side was scented with 10% methanol water, and the left side was 10% methanol water; branches infected with aphids and leaves were inserted ( Figure 4 ); take photos of both sides with a camera every 12 hours, tap the branches before taking photos to screen out aphids that do not feed or have died, count the number of aphids with Image J, and calculate the aphid avoidance rate; put them in an insect incubator (28°C, 70% humidity, 14:10 photoperiod) during the culture period.

[0050] Aphid avoidance rate (ANt-ΔNC) / (ΔNt+ΔNc)·100%

[0051] ΔNc is the change number of the control group, and ΔNt is the change number of aphids in the treatment group

[0052] The results are as follows Figure 5 As shown, the aphid avoidance rate statistics of different concentrations of elemene at different times verify the insect resistance of elemene.

[0053] 7. Contact toxicity bioassay

[0054] The commercial repellent imidacloprid was diluted to 100 μL / mL as a positive control. Aphids in the control group were treated with water only. Sample solutions were deposited on the back of each aphid using an automatic microapplicator with different concentrations of elemene. Adding 0.1% Tween80 to the formula increased the adsorption of the agent to aphids. Nine groups were repeated for each concentration, and three tea buds were placed in each culture dish (inner diameter 9.0 cm, outer diameter 1.5 cm). After application, the tea seedlings treated with aphids were moved into the culture dishes. The number of aphids was evaluated at 0 hours, 12 hours, 24 hours, 36 hours and 48 hours after application.

[0055] The results are as follows Figure 6 As shown, the aphid toxicity experiment verifies the insect resistance of Elemi.

[0056] 8. Effect of silencing of elemene synthase gene on aphid population

[0057] Antisense oligonucleotide (AsODN) was used to silence the genes in tea trees. The specific oligo sequence (GTGCGTTGATACAGGTATTG) was found on the antisense oligonucleotide design website (http: / / sfold.wadsworth.org / cgi-bin / soligo.pl?dt=0629210919&pid=8108) and sent to the company for synthesis. The tea seedlings were dark-treated for about half an hour in advance and injected in the dark. The injection of ddH2O was used as a control. For tea seedlings with about 50 to 100 aphids, the back of the third leaf mature leaf was selected and the Oligo sequence primer was injected from the back of the leaf. The entire leaf was injected. After culturing for 24 hours, samples were taken to verify the silencing effect of the primer (silencing primers were supplemented every 24 hours). The number of aphid populations at different times was counted. Nine groups were repeated. The results are as follows. Figure 7 As shown in A, the function of this gene in tea plants was verified.

[0058] The relative expression level of the gene was measured using a real-time fluorescence quantitative PCR system (Bio-Rad), indicating that the gene was successfully silenced in the tea plant. Figure 7 As shown in B.

Claims

1. Elemene synthase, the amino acid sequence of which is shown in SEQ ID No.

1.

2. A gene encoding the elemene synthase according to claim 1, wherein the nucleotide sequence thereof is shown in SEQ ID No.

2.

3. An expression vector containing a gene encoding the elemene synthase according to claim 1.

4. Use of the elemene synthase according to claim 1, the gene according to claim 2, or the expression vector according to claim 3 in synthesizing elemene.

5. A method for improving the repellency of tea plants to tea aphids, characterized in that: By increasing the content of elemene in tea trees, the tea tree's ability to repel tea aphids is improved. The method for increasing the content of elemene in tea trees is to overexpress the gene described in claim 2 in the tea trees.

Images