A method for assisting in detecting the trait of intramuscular fat content in pigs

By detecting DNA insertion or deletion at specific locations in the pig genome, the genotype of the pig's intramuscular fat content is solved, and the problem of difficulty in assisting the detection of intramuscular fat content in living pigs in the prior art is solved, efficient and accurate breeding assisted detection is achieved, and the average value of intramuscular fat content is improved.

CN118389694BActive Publication Date: 2025-06-27INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410397154.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-03
Publication Date
2025-06-27
Estimated Expiration
2044-04-03

AI Technical Summary

Technical Problem

The prior art is difficult to assist in detecting intramuscular fat content traits in living pigs, resulting in a long time to select the best during breeding and high cost.

Method used

By detecting the polymorphism differences in insertion or deletion of 31 deoxyribonucleotides at specific locations on chromosome 12 of the pig reference genome Sscrofa11.1, the genotype of the pig to be tested is +/+ or -/- to assist in the detection of intramuscular fat content.

Benefits of technology

Accurate auxiliary detection of pig muscle fat content traits is achieved, the breeding process is simplified, the cost of selection is reduced, and the average value of intramuscular fat content is increased by about 0.61%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118389694B_ABST
    Figure CN118389694B_ABST
Patent Text Reader

Abstract

The present invention determines whether the genotype of a pig to be tested is + / +, or - / -, by detecting the presence or absence of the insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between the 55423395th deoxyribonucleotide and the 55423396th deoxyribonucleotide on chromosome 12 of the pig reference genome Sscrofa11.1. The intramuscular fat content trait of pigs with the + / + genotype is higher than that of pigs with the - / - genotype. Applying the method of the present invention can reduce breeding costs, effectively increase the intramuscular fat content of pigs in actual production, and improve meat quality. The method of the present invention is simple to operate, has high accuracy, and can achieve automated detection, and will play a huge role in pig breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for assisting in detecting the intramuscular fat content trait of Damin pigs and its application in breeding. Background Art

[0002] As one of the important meat quality traits, the intramuscular fat content of pigs has attracted wide attention. One of the common characteristics of black pork with a relatively high price in the market is its high intramuscular fat content. However, the intramuscular fat content is a trait measured after slaughter, which is irreconcilable with the contradiction of live animal breeding. Therefore, it is particularly important to develop a molecular method for assisting in detecting the intramuscular fat content trait of pigs.

[0003] As an important meat quality trait, the intramuscular fat content can also directly affect consumers' desire to purchase, and has always been concerned by breeders. Currently, 34,333 pig QTLs have been discovered, among which 881 are related to the IMF trait (https: / / www.animalgenome.org / cgibin / QTLdb / SS / summary). There are numerous reports on molecular research related to the intramuscular fat content trait of pigs. Among them, the genes and molecular markers in the 45-58 Mb interval on chromosome 12 are the hot genomic regions for research (Cho IC, Park HB, Ahn JS, Han SH, Lee JB, Lim HT, Yoo CK, Jung EJ, Kim DH, Sun WS, Ramayo-Caldas Y, Kim SG, Kang YJ, Kim YK, Shin HS, Seong PN, Hwang IS, Park BY, Hwang S, Lee SS, Ryu YC, Lee JH, Ko MS, Lee K, Andersson G, Pérez-Enciso M, Lee JW. A functional regulatory variant of MYH3 influences muscle fiber-type composition and intramuscular fat content in pigs. PLoS Genet. 2019, 15(10):e1008279). Therefore, exploring molecular markers closely associated with the intramuscular fat content trait in this interval can provide technical support for the molecular breeding of the intramuscular fat content trait of pigs. Summary of the Invention

[0004] The object of the present invention is to provide a method for assisting in detecting the intramuscular fat content trait of Damin pigs. By detecting whether there is an insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG (represented by +) or no insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG (represented by -) between the 55,423,395th deoxyribonucleotide and the 55,423,396th deoxyribonucleotide on chromosome 12 of the porcine reference genome Sscrofa11.1 of the pig to be tested, the genotype of the pig to be tested is determined to be + / + or - / -, and this mutation site is named ADPRM Indel.

[0005] The object of the present invention also lies in providing the application of the above detection method in the breeding of Damin pigs.

[0006] The present invention is implemented as follows:

[0007] A method for assisting in detecting the intramuscular fat content trait of Damin pigs, comprising the following steps:

[0008] (1) PCR amplification: According to the porcine ADPRM Indel genomic DNA sequence information, the primer pair is used:

[0009] U (upstream primer): 5’-TCCCCTAGCTCCCAAAACCA-3’ (Sequence 1)

[0010] D (downstream primer): 5’-GTGAGTACACACCTGGAGCC-3’ (Sequence 2)

[0011] Using the genomic DNA of the pig to be tested as a template, PCR amplification is carried out;

[0012] (2) Sequencing analysis of the PCR amplification product:

[0013] Detect whether there is (+) or no (-) insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between the 55,423,395th deoxyribonucleotide and the 55,423,396th deoxyribonucleotide on chromosome 12 of the porcine reference genome Sscrofa11.1 of the pig to be tested;

[0014] (3) Determine whether the genotype of the pig to be tested is + / + or - / -:

[0015] Between the 55,423,395th deoxyribonucleotide and the 55,423,396th deoxyribonucleotide on chromosome 12 of the porcine reference genome Sscrofa11.1, there are 31 deoxyribonucleotides

[0016] Homozygote with the insertion of GATCTCGGACCTGGGTAGTAAGTCAGCTGCG, genotype + / +;

[0017] There are no 31 deoxyribonucleotides between the 55423395th and 55423396th deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1.

[0018] Homozygote with the insertion of GATCTCGGACCTGGGTAGTAAGTCAGCTGCG, genotype - / -;

[0019] The intramuscular fat content of pigs with genotype + / + is higher than that of pigs with genotype - / -.

[0020] Preferably, the method for determining whether there are 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG inserted between the 55423395th and 55423396th deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1 in the test pigs in step (2) is sequencing analysis.

[0021] Preferably, the method for determining whether there are 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG inserted between the 55423362nd and 55423363rd deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1 in the test pigs in step (2) is the PCR-SSCP method.

[0022] Any of the foregoing methods is used in pig breeding to breed pigs with higher intramuscular fat content traits.

[0023] There is a polymorphism difference of the insertion or non-insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between the 55423395th and 55423396th deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1 in the present invention. Since the gene closest to this polymorphism is ADPRM, this polymorphism is named ADPRMIndel. The intramuscular fat content of the longissimus dorsi muscle in the + / + homozygous genotype population is about 0.61% higher than that in the - / - homozygous genotype population. Therefore, this locus can be used as a molecular breeding marker for the intramuscular fat content trait in pigs.

[0024] The present invention uses gene sequencing methods to detect ADPRM Indel. Only PCR reactions and sequencing are required to determine the genotype of an individual. The genotype determination is very accurate, the detection cost is not high, and it has high practical application value in breeding. By using the method of the present invention to select for intramuscular fat content traits in pigs, the average intramuscular fat content of pigs can be increased by about 0.61%, thereby obtaining pigs with high intramuscular fat content.

[0025] By applying the method provided by the present invention to breed pigs, early screening of candidate pigs can be carried out, effectively alleviating the problem of long time for selecting excellent breeding pigs in actual production, reducing breeding costs, and effectively reducing or increasing the intramuscular fat content of pigs in actual production. The detection method of the present invention is simple to operate, low in cost, high in accuracy, and can achieve automated direct detection. The present invention will play a huge role in pig breeding work. Brief Description of the Drawings

[0026] Figure 1 The sequencing result sequence diagram M1 of the amplification product in the example, with the genotype of - / -.

[0027] Figure 2 The sequencing result sequence diagram M2 of the amplification product in the example, with the genotype of + / +. Detailed Embodiments

[0028] The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from regular biochemical reagent stores unless otherwise specified. The primers in the following examples were all synthesized by Invitrogen Biotechnology Co., Ltd.

[0029] Damin pigs: These pigs were produced by the Changping Experimental Pig Farm of the Institute of Animal Science, Chinese Academy of Agricultural Sciences.

[0030] Example 1. Establishment of a breeding method

[0031] I. PCR amplification and sequencing typing of the porcine ADPRM Indel polymorphic locus

[0032] 1. PCR amplification

[0033] Based on the information of the porcine ADPRM Indel genomic DNA sequence (between the 55423362nd and 55423363rd deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1), a pair of primers was designed as follows:

[0034] U (upstream primer): 5’-TCCCCTAGCTCCCAAAACCA-3’ (Sequence 1);

[0035] D (downstream primer): 5’-GTGAGTACACACCTGGAGCC-3’ (Sequence 2).

[0036] Three Damin pigs were selected as experimental materials. Damin pigs were obtained by crossing Large White pigs and Min pigs. Using the genomic DNA of Damin pigs as a template, PCR amplification was performed using primers U and D.

[0037] The amplification system was 25 μL: 12.5 μL of 2×Phanta Max Buffer, 1 μL of DNA, 0.5 μL of DNA Polymerase, 0.5 μL of dNTPs, 1 μL each of upstream and downstream primers, and 8.5 μL of sterile water.

[0038] The PCR reaction conditions were as follows: denaturation at 95°C for 5 min; then denaturation at 95°C for 20 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; finally, extension at 72°C for 10 min.

[0039] The PCR products were detected by agarose gel electrophoresis and stored at -20°C. The products amplified using the genomic DNA of three Damin pigs as templates were named Product 1, Product 2, and Product 3, respectively.

[0040] 2. Sequencing and sequence analysis

[0041] The three PCR products were respectively sent to Beijing Liuhe Huada Gene Technology Co., Ltd. The sequencing results showed that: Product 1 was Sequence M1, Product 2 was a mixture of Sequence M1 and Sequence M2, and Product 3 was Sequence M2; the length of Sequence M1 was 503 bp, the length of Sequence M2 was 534 bp, and there were 31 deoxyribonucleotide differences CGCAGCTGACTTACTACCCAGGTCCGAGATC, as shown in Figure 1 and Figure 2 . According to the different genomic DNA of the pigs to be tested, the nucleotide sequence of amplified Product Sequence M1 was shown in Sequence 3 of the sequence listing, and the nucleotide sequence of Sequence M2 was shown in Sequence 4 of the sequence listing.

[0042] Figure 1 and Figure 2 are the sequencing maps of the ADPRM Indel mutation sites in pigs.

[0043] As Figure 2 shown, the homozygous genotype with 31 deoxyribonucleotides (GATCTCGGACCTGGGTAGTAAGTCAGCTGCG) inserted between the 55423362nd and 55423363rd deoxyribonucleotides on chromosome 12 of the pig reference genome Sscrofa11.1 was named + / +.

[0044] As Figure 1As shown in the figure, the homozygous genotype without the insertion of 31 deoxyribonucleotides (GATCTCGGACCTGGGTAGTAAGTCAGCTGCG) between the 55,423,362nd and 55,423,363rd deoxyribonucleotides on chromosome 12 of the porcine reference genome Sscrofa11.1 is named - / -.

[0045] Their heterozygous genotype is + / -.

[0046] II. Correlation analysis between the porcine ADPRM Indel polymorphic locus and pork quality traits

[0047] To determine whether the porcine ADPRM Indel polymorphic locus is related to the intramuscular fat content of pigs, 439 Damin pigs were used as experimental materials for the following experiments: Genomic DNA was extracted for sequencing analysis, and the method was the same as in Step 1; at the same time, traits such as meat color a (24 h), meat color b (24 h), meat color L (24 h), and pH were measured and recorded, and an association analysis between the porcine ADPRM Indel polymorphic locus and the traits was carried out by the least squares method. The model used is as follows:

[0048] Y = S + G + e

[0049] Where Y is the trait measurement value, S is the sex effect, G is the genotype effect, and e is the residual effect.

[0050] The results are shown in Table 1.

[0051] Table 1 Association between the porcine ADPRM Indel polymorphic locus and meat quality traits

[0052]

[0053] Note: Values with the same superscript letter in the same column indicate no significant difference (P > 0.01).

[0054] The results show that in the trait of intramuscular fat content, the intramuscular fat content of individuals with the + / + genotype is higher than that of individuals with the - / - genotype.

[0055] III. Application of the method of the present invention in breeding

[0056] Selecting parents with the + / + genotype for mating can obtain offspring with a relatively high intramuscular fat content in pigs, and such breeding can increase the average intramuscular fat content of pigs by about 0.6%.

[0057] Selecting parents with the - / - genotype for mating can obtain offspring with a relatively low intramuscular fat content in pigs, and such breeding can reduce the average intramuscular fat content of pigs by about 0.6%.

[0058] IV. A kit for assisting in detecting the intramuscular fat content trait of pigs and its application in breeding

[0059] Prepare a kit for assisting in detecting the intramuscular fat content trait of pigs, which comprises primer pairs:

[0060] U (upstream primer): 5’-TCCCCTAGCTCCCAAAACCA-3’ (Sequence 1)

[0061] D (downstream primer): 5’-GTGAGTACACACCTGGAGCC-3’ (Sequence 2)

[0062] Detect whether there is an insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between the 55423395th and 55423396th deoxyribonucleotides on chromosome 12 of the pig reference genome Sscrofa11.1 of Damin pigs, whether it is present (+) or absent (-). To determine the genotype of the Damin pigs to be tested as + / +, - / -, or + / -, and breed the pigs to be tested using the aforementioned method.

Claims

1. A method for assisting in detecting the intramuscular fat content of Damin pigs, comprising the following steps: (1) PCR amplification: Based on pig ADPRM Indel genomic DNA sequence information, using primer pairs: Upstream primer: 5'-TCCCCTAGCTCCAAAACCA-3' (sequence 1) Downstream primer: 5'-GTGAGTACACACCTGGAGCC-3' (sequence 2) PCR amplification was performed using the pig genomic DNA to be tested as a template; (2) Sequencing analysis of PCR amplification products: Detect whether there is (+) or not (-) the insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between deoxyribonucleotides 55423395 and 55423396 on chromosome 12 of the pig reference genome Sscrofa11.1 of the tested pig; (3) Determine whether the genotype of the pig to be tested is + / + or - / -: There is a homozygous insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between deoxyribonucleotides 55423395 and 55423396 on chromosome 12 of the pig reference genome Sscrofa11.1, and the genotype is + / +; There is no homozygous insertion of 31 deoxyribonucleotides GATCTCGGACCTGGGTAGTAAGTCAGCTGCG between deoxyribonucleotides 55423395 and 55423396 on chromosome 12 of the pig reference genome Sscrofa11.1, and the genotype is - / -; Pigs with the + / + genotype had higher intramuscular fat content than those with the - / - genotype.

2. The method according to claim 1, characterized in that: It is used in pig breeding to produce pigs with higher intramuscular fat content.