A method for typing pathogenic Cronobacter spp. based on MIRA-CRISPR Cas12a

Abstract

The present invention discloses a pathogenic Cronobacter typing detection method based on MIRA-CRISPR Cas12a, which is divided into three steps: rapid extraction of Cronobacter genomic DNA, MIRA constant temperature amplification of target genes, and CRISPR Cas12a system typing detection. MIRA specific primers and corresponding specific CrRNAs for bacterial genera and strains are designed; if Cronobacter is present in the sample to be tested, the target gene is quickly recognized by the CrRNA for the target gene after a large amount of amplification by MIRA, and the Cas12a enzyme is activated to non-specifically cut the reporter probe to achieve the purpose of detection, and the result is interpreted by fluorescent signal or colloidal gold lateral flow chromatography test strip. The detection method constructed by the present invention is simple to operate, fast and convenient, highly sensitive, and suitable for on-site detection; it can identify whether Cronobacter contamination exists in the sample to be tested in a relatively short time, and the type of pathogenic bacteria is determined by typing, which is of great significance to the food safety risk assessment caused by Cronobacter.

Description

Technical Field

[0001] The present invention belongs to the technical field of rapid on-site detection of microorganisms, and specifically relates to a method for detecting pathogenic Cronobacter typing based on MIRA-CRISPRCas12a. Background Art

[0002] Cronobacter is one of the common foodborne pathogens. It belongs to the family Enterobacteriaceae and is a facultative anaerobic Gram-negative rod. The bacterium is extremely resistant to drying and can be detected in a variety of foods such as infant formula, meat, fruits, and vegetables. The susceptible population of Cronobacter is relatively special. Most of the infected cases are infants and young children, and the main infection channel is infant formula. Infants and young children infected with Cronobacter will develop symptoms such as bacteremia, meningitis, and necrotizing enterocolitis, with a mortality rate of up to 40%-80%. Compared with other foodborne pathogens, Cronobacter has a lower infection rate for most people, but it is a fatal threat to special groups that are susceptible to the bacteria.

[0003] The genus Cronobacter includes 7 species, and the most common pathogenic species are Cronobacter sakazakii, Cronobacter malondiate, and Cronobacter zurichensis. Although there are currently a variety of portable test kits and rapid detection methods for Cronobacter and Cronobacter sakazakii, there is no rapid typing detection method for common pathogenic Cronobacter. The establishment of this method is helpful for food safety risk assessment and disease prevention and control.

[0004] After searching, it was found that Cronobacter rapid detection kits and related rapid detection methods are mostly based on molecular detection, and the detection results are stable and reliable. However, most molecular detection methods require the pre-amplification of the target gene in the sample through PCR technology, which requires certain professionalism of the detection personnel and relies on expensive instruments and equipment, making it difficult to achieve economical and effective rapid detection. In addition, typing methods related to Cronobacter include: Multiplex Polymerase Chain Reaction (mPCR), Pulsed-Field Gel Electrophoresis (PFGE), Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), PCR-Restriction Fragment Length Polymorphism (PCR-RFLP), Multiple-Locus Sequence Typing (MLST), Whole-Genome Sequencing (WGS), etc. The above typing methods are stable and reliable, but they all have the disadvantages of complicated operation, high cost, large workload, long time consumption, and heavy reliance on precision instruments. They cannot meet the real-time and on-site testing needs of food companies' production lines and are not conducive to the immediate issuance of test results.

[0005] At present, through searching, no reports have been found on the use of the MIRA-CRISPR Cas12a detection system to achieve rapid typing detection of the main pathogenic Cronobacter in food microorganisms. Summary of the invention

[0006] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0007] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0008] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for detecting pathogenic Cronobacter typing based on MIRA-CRISPRCas12a.

[0009] In order to solve the above technical problems, the present invention provides the following technical solutions: a method for detecting pathogenic Cronobacter typing based on MIRA-CRISPRCas12a, comprising:

[0010] Identify the presence of Cronobacter in the sample at the genus level;

[0011] In case the genus identification result is positive, the pathogenic strains are typed and tested at the species level, including Cronobacter sakazakii, Cronobacter malonate and Cronobacter zurichensis;

[0012] The detection method includes boiling the bacterial solution at high temperature, lysing the bacteria, and releasing the nucleic acid sample;

[0013] Specific MIRA primers are used to amplify the genomic DNA extracted from the sample to obtain the amplified MIRA product;

[0014] Design and synthesize crRNA sequences in vitro;

[0015] The amplified MIRA product was added to the CRISPR Cas12a fluorescence system detection system, and the fluorescence signal generated by each group of enzyme cutting system was collected to obtain the detection results. At the same time, the CrRNA sequence was added to the CRISPR Cas12a system to determine the feasibility of cis-cutting;

[0016] The Cronobacter MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the amplified fragment size is 528 bp;

[0017] The Cronobacter sakazakii MIRA specific primer sequences are SEQ NO.3 and SEQ NO.4, and the amplified fragment size is 460 bp;

[0018] The malonate Cronobacter MIRA specific primer sequences are SEQ NO.5 and SEQ NO.6, and the amplified fragment size is: 300 bp;

[0019] The specific primer sequences of Cronobacter zurichensis MIRA are SEQ NO.7 and SEQ NO.8, and the amplified fragment size is: 248 bp;

[0020] The CrRNA nucleotide sequence of the Cronobacter genus is SEQ NO.9;

[0021] The CrRNA nucleotide sequence of Cronobacter sakazakii is SEQ NO.10;

[0022] The CrRNA nucleotide sequence of the malonate Cronobacter is SEQ NO.11;

[0023] The CrRNA nucleotide sequence of the Zurich Cronobacter is SEQ NO.12.

[0024] As a preferred embodiment of the detection method of the present invention, the high-temperature boiling of the bacterial liquid includes taking fresh bacterial liquid and boiling it at 100° C. for 10 minutes.

[0025] As a preferred embodiment of the detection method of the present invention, the preparation method of the MIRA product comprises:

[0026] Using the extracted Cronobacter genomic DNA as a template, the specific gene of Cronobacter was amplified. The amplification system is as follows:

[0027]

[0028] Amplification conditions were: 37°C, 30 min.

[0029] As a preferred embodiment of the detection method of the present invention, the CRISPR Cas12a fluorescence system detection system is as follows:

[0030]

[0031] The components were added in the above order. After a brief centrifugation, 3 μl of substrate DNA and 1.2 μl of fluorescent probe 10 μM were added. The reaction system was immediately transferred to a black 384-well ELISA plate, and the fluorescence signal was immediately monitored by an ELISA reader.

[0032] As a preferred embodiment of the detection method of the present invention, the microplate reader is set with an excitation wavelength of 494 nm, an emission wavelength of 520 nm, an incubation temperature of 37° C., 120 kinetic cycles, and a reading every 30 seconds.

[0033] As a preferred embodiment of the detection method of the present invention, the fluorescent probe is FAM-ssDNA-BHQ1, and its nucleotide sequence is: 6-FAM-TTTTTTTT-BHQ-1;

[0034] When the target gene is present, the trans-cleavage activity of Cas12a is stimulated, the fluorescent probe is cut, and the FAM fluorescent group loses the constraint of the BHQ1 quenching group to generate a fluorescent signal; when the target gene is not present, no fluorescent signal is generated.

[0035] As a preferred embodiment of the detection method of the present invention, the fluorescence detection result also includes:

[0036] Interpretation by handheld UV light: After the determination by the microplate reader is completed, the enzyme digestion reaction products in the 384-well plate are immediately recovered;

[0037] Place it in a dark environment, irradiate it with a 365nm handheld ultraviolet lamp, and observe the fluorescence results with the naked eye. The PCR tube with a positive result will show green fluorescence, while the negative result will have no fluorescence.

[0038] As a preferred embodiment of the detection method of the present invention, the detection method further comprises detection by colloidal gold lateral flow chromatography test strips.

[0039] As a preferred embodiment of the detection method of the present invention, the colloidal gold lateral flow chromatography test strip detection comprises:

[0040] The amplified product was directly added to the corresponding CRISPR Cas12a system for detection;

[0041] Among them, the CRISPR Cas12a detection system is assembled as follows:

[0042]

[0043] After brief centrifugation, 6 μl of substrate DNA and 0.8 μl of 100 nM reporter probe were added and reacted at 37°C;

[0044] After the reaction is finished, take 5 μl of the reaction product and add it to 45 μl of the test strip loading buffer. After mixing, slowly drip it onto the test strip loading area and read the result.

[0045] For high concentration bacterial sample 10 8 CFU / ml, samples were taken after 15 minutes of CRISPR Cas12a system digestion to determine the test results;

[0046] For low concentration bacterial sample 10 0 CFU / ml requires at least 60 minutes of enzyme digestion for sampling and determination of test results;

[0047] For samples with unknown bacterial content, the reaction product at 60 minutes is selected for verification to ensure the accuracy of the test results.

[0048] The result is interpreted as negative if both the quality control line and the test line show obvious purple-red bands;

[0049] If only the quality control line shows a purple-red band or the test line shows a relatively weak band, the result is judged as positive;

[0050] If no purple-red band appears on the quality control line, the result is invalid;

[0051] The reporter probe is ssDNA-FQ:6-FAM-TTTTTTTATTTTTTT-Biotin.

[0052] As a preferred embodiment of the detection method of the present invention, wherein: the detection limit of Cronobacter sakazakii is 10 0 CFU / ml, the detection limit for Cronobacter malonate is 10 0 CFU / ml, the detection limit for Cronobacter Zurich is 10 0 CFU / ml.

[0053] Beneficial effects of the present invention:

[0054] (1) The present invention provides a Cronobacter typing detection method with simple operation and accurate results. The detection process includes the following four steps: sample pretreatment, MIRA isothermal amplification, CRISPR Cas12a system detection, and result determination. The detection method established by the present invention only needs to replace the corresponding target nucleic acid sequence and CrRNA sequence, which can realize the detection of some microorganisms and has a wide range of applications.

[0055] (2) The detection limit of the detection method established by the present invention is low, and the detection limit of bacterial liquid samples can be as low as 10 0 CFU / ml; The detection method established by the present invention has strong specificity. In the established Cronobacter detection system, the presence of Escherichia coli, Staphylococcus aureus, and Salmonella will not stimulate the CRISPR Cas12a system to start the enzyme cutting mechanism to produce a fluorescent signal; the detection system of the three major pathogenic bacteria species established has no cross-reaction within the genus in addition to the inter-genus specificity.

[0056] (3) The detection method established by the present invention is relatively time-saving, and only takes 1.5 hours from sample pretreatment to issuing the test results. The test results of the detection method established by the present invention can be interpreted by fluorescence or dual-channel test strips, which meets the detection needs in different scenarios. It does not rely on traditional PCR instruments, electrophoresis and other equipment, is suitable for on-site detection, and has important practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0058] Figure 1 This is a diagram of the main pathogenic Cronobacter typing detection scheme based on the MIRA-CRISPR Cas12a system in the present invention.

[0059] Figure 2 This is a diagram showing the feasibility of cis-cutting of Cronobacter based on the CRISPR Cas12a system typing in the present invention.

[0060] Figure 3 This is a diagram showing the feasibility of trans-cleavage detection of Cronobacter based on the CRISPR Cas12a system in the present invention.

[0061] Figure 4 The figure is a graph of the electrophoresis results based on MIRA-specific primer screening in the present invention; wherein, lanes 1-4 of each electrophoresis graph are: Cronobacter sakazakii; lanes 5 and 6 are: Cronobacter malonate; lanes 7 and 8 are: Cronobacter zurichensis; lanes 9 and 10 are: Cronobacter moginii; lanes 11 and 12 are Escherichia coli; lanes 13 and 14 are Staphylococcus aureus; lanes 15 and 16 are Salmonella.

[0062] Figure 5 Figure 1 is a graph showing the specific characterization results of typing and detecting the main pathogenic Cronobacter based on the MIRA-CRISPR Cas12a fluorescence system in the present invention, wherein A, C, E, and G are dynamic fluorescence results, and Figures B, D, F, and H are fluorescence intensity results at 30 minutes.

[0063] Figure 6 These are the sensitivity characterization results of detecting Cronobacter based on the MIRA-CRISPR Cas12a fluorescence system in the present invention, wherein Figures A, C, and E are dynamic fluorescence results, and Figures B, D, and F are fluorescence intensity results at 30 minutes.

[0064] Figure 7 These are the sensitivity characterization results of detecting the main pathogenic Cronobacter based on the MIRA-CRISPR Cas12a fluorescence system in the present invention, wherein Figures A, C, and E are dynamic fluorescence results, and Figures B, D, and F are fluorescence intensity results at 30 minutes.

[0065] Figure 8 This is a graph showing the specific characterization results of typing and detecting the main pathogenic types of Cronobacter under ultraviolet light based on the MIRA-CRISPR Cas12a fluorescence system in the present invention.

[0066] Fig. 9 This is a sensitivity characterization result diagram of detecting Cronobacter genus under ultraviolet light based on the MIRA-CRISPR Cas12a fluorescence system in the present invention, wherein the three groups of targets to be detected, A, B, and C, are Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich, respectively.

[0067] Fig.10 This is a graph showing the sensitivity characterization results of typing and detecting the main pathogenic types of Cronobacter under ultraviolet light based on the MIRA-CRISPR Cas12a fluorescence system in the present invention.

[0068] Fig.11This is a graph showing the specific characterization results of typing and detecting the main pathogenic types of Cronobacter based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention.

[0069] Fig.12 These are the test results of bacterial liquid samples of different concentrations at different time points based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip detection system in the present invention.

[0070] Fig.13 This is a graph showing the sensitivity characterization results of detecting Cronobacter based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention, wherein the three groups of targets to be tested, A, B, and C, are Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich, respectively.

[0071] Fig.14 This is a graph showing the sensitivity characterization results of typing and detecting the main pathogenic types of Cronobacter based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention. DETAILED DESCRIPTION

[0072] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0073] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0074] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0075] The present invention provides a method for detecting the typing of major pathogenic Cronobacter based on the MIRA-CRISPR Cas12a system. Figure 1 As shown;

[0076] First, the presence of Cronobacter in the sample is identified at the genus level; if the genus identification result is positive, further typing of common pathogenic strains is performed at the species level to determine the risk.

[0077] Specifically, MIRA amplification is combined with the trans-cleavage reaction of Cas12a to identify the genus and species respectively. First, according to the conserved sequences of the specific genes of the three main pathogens in the genus Cronobacter and Cronobacter, MIRA primers and CrRNA sequences are designed and synthesized in vitro. By optimizing various reaction conditions and testing the specificity and sensitivity of the method, a typing detection method that can quickly distinguish the three main pathogens in the genus Cronobacter is established. The test results can be interpreted by fluorescent signals or colloidal gold lateral flow chromatography test strips according to the actual situation:

[0078] (1) Interpretation based on the fluorescence signal method: FAM-ssDNA-BHQ1 is used as the reporter probe in the system (6-FAM-TTTTTTTT-BHQ-1), one end of which is labeled with a FAM fluorescent group and the other end is labeled with a BHQ1 quenching group. When the target gene is present, the trans-cleavage activity of Cas12a is stimulated, the fluorescent probe is cut, and the FAM fluorescent group loses the constraint of the BHQ1 quenching group to generate a fluorescent signal. When the target gene is not present, almost no fluorescent signal is generated;

[0079] (2) Interpretation based on colloidal gold lateral flow chromatography test strip method: FAM-ssDNA-Biotin is used as the reporter probe in the system (6-FAM-TTTTTTTATTTTTTT-Biotin). When the target gene is present, the probe is cleaved, and only the quality control line of the test strip shows a purple-red band or the detection line shows a relatively weak color band; when the target gene is not present, the probe is not cleaved, and the probe is captured by the biotin conjugate on the detection line, and both the quality control line and the detection line show obvious purple-red bands.

[0080] The specific steps are as follows:

[0081] (1) Sample pretreatment: Boil the bacterial solution at high temperature to lyse the bacteria and release nucleic acids.

[0082] (2) MIRA amplification of target gene: Specific MIRA primers are used to amplify the genomic DNA extracted from the sample.

[0083] (3) Fluorescence detection: The amplified MIRA product is added to the CRISPR Cas12a fluorescence system detection system, and the fluorescence signal generated by each group of enzyme cutting system is collected to obtain the detection result.

[0084] (4) Or colloidal gold lateral flow chromatography test strip detection: add the amplified MIRA product to the CRISPR Cas12a colloidal gold lateral flow chromatography test strip system detection system, react for 1 hour, take the reaction product and immediately verify the result with the test strip.

[0085] The specific sequence information of the Cronobacter genus is NZ_CP011047.1 (3800953-3802391), the specific sequence information of Cronobacter sakazakii is NZ_CP011047.1 (3971886-3972860), the specific sequence information of Cronobacter malonate is NZ_CP013940.1 (4051145-4051450), and the specific sequence information of Cronobacter zurich is NZ_FN543093.2 (2404469-2404784).

[0086] The Cronobacter MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the amplified fragment size is 528 bp; the Cronobacter sakazakii MIRA-specific primer sequences are SEQ NO.3 and SEQ NO.4, and the amplified fragment size is 460 bp; the Cronobacter malonate MIRA-specific primer sequences are SEQ NO.5 and SEQ NO.6, and the amplified fragment size is 300 bp; the Cronobacter zurich MIRA-specific primer sequences are SEQ NO.7 and SEQ NO.8, and the amplified fragment size is 248 bp.

[0087] The nucleotide sequence of the crRNA of the genus Cronobacter is SEQ NO.9; the nucleotide sequence of the crRNA of Cronobacter sakazakii is SEQ NO.10; the nucleotide sequence of the crRNA of Cronobacter malonate is SEQ NO.11; the nucleotide sequence of the crRNA of Cronobacter zurich is SEQ NO.12. The nucleotide sequence of the probe FAM-ssDNA-BHQ1 is SEQ NO.13; the nucleotide sequence of the probe FAM-ssDNA-Biotin is SEQ NO.14.

[0088] Example 1

[0089] The specific steps of the present invention are as follows:

[0090] (1) Design of primers, crRNA and probes

[0091] Through literature and database comparison, NZ_CP011047.1 (3800953-3802391) was selected as the Cronobacter-specific sequence, NZ_CP011047.1 (3971886-3972860) and NZ_CP011047 (3972871-3975551) were selected as Cronobacter-specific genes; NZ_CP013940.1 (4051145-405145 0) and NZ_CP013940.1 (221468-221935) were selected as the specific genes of Cronobacter malonate; NZ_FN543093.2 (2404469-2404784) and NZ_FN543094.1 (25819-26232) were selected as the specific genes of Cronobacter zurichensis, and the software was used to design specific MIRA primers and CrRNA for the genus Cronobacter and the above three major pathogenic species.

[0092] Among them, SEQ NO.1, SEQ NO.2, SEQ NO.15, and SEQ NO.16 are primer sets corresponding to the specific sequence of NZ_CP011047.1 (3800953-3802391);

[0093] SEQ NO.3 and SEQ NO.4 are primer sets corresponding to the specific sequence of NZ_CP011047.1 (3971886-3972860), and SEQ NO.17 and SEQ NO.18 are primer sets corresponding to the specific sequence of NZ_CP011047 (3972871-3975551);

[0094] SEQ NO.5 and SEQ NO.6 are primer sets corresponding to the specific sequence of NZ_CP013940.1 (4051145-4051450), and SEQ NO.19 and SEQ NO.20 are primer sets corresponding to the specific sequence of NZ_CP013940.1 (221468-221935);

[0095] SEQ NO.7 and SEQ NO.8 are primer sets corresponding to the specific sequence of NZ_FN543093.2 (2404469-2404784); SEQ NO.21 and SEQ NO.22 are primer sets corresponding to the specific sequence of NZ_FN543094.1 (25819-26232).

[0096] The CRISPR system fluorescence visualization detection system uses the fluorescent probe: FAM-ssDNA-BHQ1 as the reporter probe in the system; the colloidal gold lateral flow chromatography strip visualization detection system uses FAM-ssDNA-Biotin as the reporter probe in the detection system.

[0097] Primers, CrRNA transcription templates and all probes were synthesized by a third-party primer synthesis company, and colloidal gold test strips used commercial test strips.

[0098] (2) Activation, cultivation and counting of bacterial strains

[0099] Take out the frozen Cronobacter from the -80℃ refrigerator and slowly thaw it on ice. Inoculate the glycerol bacteria onto the LB solid culture medium plate through three-zone lines and invert it at 37℃ for 12h; pick a single colony on the plate and inoculate it into a test tube containing 5ml LB liquid culture medium, and incubate it in a shaker at 220rpm and 37℃ for 12h; take 100μl of bacterial solution and dilute it in 900μl of physiological saline, and take the diluted bacterial solution and dilute it 10 times in sequence; take 50μl of bacterial solution for each gradient and spread it on the LB solid culture medium plate, and repeat one gradient three times; invert it at 37℃ for 24h, and select the plate with a colony count between 20-200CFU for counting.

[0100] The activation and culture of Escherichia coli, Staphylococcus aureus and Salmonella can refer to the above methods.

[0101] (3) Extraction of Cronobacter genomic DNA

[0102] Take 1 ml of fresh bacterial liquid, boil it at 100℃ for 10 minutes, lyse the bacteria and obtain genomic DNA.

[0103] (4) MIRA amplification of target gene

[0104] Using the extracted Cronobacter genomic DNA as a template, the specific gene of Cronobacter was amplified. The amplification system is as shown in the following table, and the amplification conditions are: 37°C, 30min.

[0105]

[0106] (5) CrRNA transcription and purification

[0107] The CrRNA involved in this experiment is Transcription was performed using the T7Quick High Yield RNA Synthesis Kit (New England Biolabs). The CrRNA transcription template was purified by RNA Cleanup Kit (New England Biolabs). The CrRNA transcription template was synthesized by a third-party primer synthesis company into short oligonucleotide chains and then annealed.

[0108] The specific steps are as follows:

[0109] 5 μl of each of the transcription template short oligonucleotide chain (10 μM) and its complementary chain (10 μM) were annealed in a PCR instrument. The annealing program was: 95°C for 5 min, decreasing by 1°C per minute until 25°C, which was used as the template for CrRNA transcription.

[0110] The transcription process was carried out according to the instructions of the transcription kit. Since the target product CrRNA was short in length, the total transcription system was adjusted to 30 μl. The system is as follows:

[0111]

[0112]

[0113] The transcription conditions were as follows: overnight transcription at 37°C. The next day, the volume was filled to 50 μl with sterile enzyme-free water, 2 μl of DNase I was added, and the cell culture was incubated at 37°C for 15 min to remove the transcription template.

[0114] According to the instructions of the RNA purification kit, the transcribed crRNA was purified. The specific steps are as follows:

[0115] Add 100 μl RNA Cleanup Binding Buffer to 50 μl of transcription product, add 150 μl (1 volume) of ethanol (≥95%), and mix well with a pipette. Insert the chromatographic column into the collection tube, transfer the sample to the chromatographic column, centrifuge at 16000 rpm for 1 min, and discard the waste liquid. Add 500 μl RNA Cleanup Wash Buffer to elute, centrifuge at 16000 rpm for 1 min, and repeat the elution once. After drying the chromatographic column matrix, transfer the chromatographic column to an RNase-free 1.5 ml centrifuge tube, add 50 μl Nuclease-free water, let stand at room temperature for 5 min, and centrifuge at 16000 rpm for 1 min to obtain the purified CrRNA. After measuring the concentration using an ultra-micro UV spectrophotometer, immediately freeze it in a -80°C refrigerator for later use.

[0116] (6) MIRA-specific primer screening

[0117] The specificity of different primers for Cronobacter spp. was verified using Escherichia coli, Staphylococcus aureus, and Salmonella existing in the laboratory as negative controls.

[0118] Escherichia coli, Staphylococcus aureus, and Salmonella were used as negative controls between genera, and different Cronobacter species were used as negative controls between different species within the genus to verify the specificity of different primers for the three main pathogenic species.

[0119] According to "(3)", the genomic DNA of each strain was extracted and used as a template. The electrophoresis results of each set of primers were as follows: Figure 4 As shown: Figure 4 -A is the verification result of the primer set of SEQ NO.1 and SEQ NO.2; Figure 4 -B is the verification result of the primer set of SEQ NO.15 and SEQ NO.16; Figure 4 -C is the verification result of the primer set of SEQ NO.3 and SEQ NO.4; Figure 4 -D is the verification result of the primer set of SEQ NO.17 and SEQ NO.18; Figure 4 -E is the verification result of the primer set of SEQ NO.5 and SEQ NO.6, Figure 4 -F is the verification result of the primer set of SEQ NO.19 and SEQ NO.20; Figure 4 -G is the verification result of primer set of SEQ NO.7 and SEQ NO.8; Figure 4 -H is the verification result of the primer set of SEQ NO.21 and SEQ NO.22.

[0120] There are differences in the specificity of different primers. After screening, SEQ NO.1 and SEQ NO.2 are the verification results of Cronobacter primers. The results show that only the lane where Cronobacter is located has a band, and the band size is consistent with the expected result, indicating that the Cronobacter primer group has a high specificity; SEQ NO.3 and SEQ NO.4, SEQ NO.5 and SEQ NO.6, SEQ NO.7 and SEQ NO.8 are the verification results of Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich specific primers, respectively. All three pairs of primers are specific and have no cross-reaction; the remaining primer groups all have nonspecific amplification results and will not be used in subsequent experiments.

[0121] (7) Feasibility analysis and results of cis-cutting of CRISPR Cas12a system

[0122] In order to verify whether the Cas12a enzyme (New England Biolabs) in the CRISPR Cas12a system can accurately cut the target under the guidance of crRNA, the feasibility of its cis-cutting target was experimentally verified. The specific steps are as follows:

[0123] The CRISPR Cas12a cis-cutting positive system (1000bp cutting target + CrRNA for the target) verified in the laboratory was used to verify the CRISPR Cas12a cis-cutting system. The verification system is as follows: (The main components of the buffer are: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100μg / ml Recombinant Albumin, pH7.9)

[0124]

[0125] Each component was added in strict accordance with the above order, and incubated at room temperature for 10 min to allow Cas12a to fully bind to CrRNA; 3 μl of substrate DNA was added, and the enzyme digestion results were verified by electrophoresis after incubation at 37 °C for 15 min.

[0126] The results are as follows Figure 2 As shown, lane 1 of the control group is substrate DNA with a fragment length of 996bp; lanes 2 and 3 are Cas12a enzyme cutting systems. According to the position of crRNA targeting substrate DNA, after Cas12a accurately cuts the target gene, the expected enzyme cutting products are 636bp and 364bp. Lanes 2 and 3 show that each lane has 3 bands: the first band is fuzzy and consistent with the position of the control group, and is analyzed as part of the uncut substrate; the second and third bands are long and short fragments after enzyme cutting, respectively, and the positions of the bands are basically in line with the expected results. This preliminarily indicates that the Cas12a enzyme in the CRISPR Cas12a system can accurately cut the target under the guidance of crRNA.

[0127] (8) Feasibility analysis and results of CRISPR Cas12a system trans-cutting

[0128] Based on the experimental results of cis-cleavage in (5), the feasibility of trans-cleavage by Cas12a enzyme in CRISPR Cas12a system was further verified. The specific steps are as follows:

[0129] The product amplified by MIRA is used as the cutting target, and the verification system is as follows:

[0130]

[0131] The total reaction system is 30 μl. In addition to the verification system, three more systems are set up: Cas12a, CrRNA and substrate DNA of these three systems are removed respectively, and other components remain unchanged as three control groups. Each component is added in strict accordance with the above order. After a brief centrifugation, 3 μl substrate DNA and 1.2 μl fluorescent probe (10 μM) are added, and the reaction system is immediately transferred to a black 384-well ELISA plate, and the ELISA reader immediately monitors the fluorescence signal. The ELISA reader is set to an excitation wavelength of 494 nm, an emission wavelength of 520 nm, an incubation temperature of 37 ° C, a kinetic cycle of 120 times, and a reading every 30 seconds.

[0132] The results are as follows Figure 3 As shown, the results show that only when Cas12a, CrRNA and substrate DNA exist at the same time can the non-specific cleavage activity of Cas12a be stimulated and the fluorescent probe be cut to produce a fluorescent signal.

[0133] Example 2

[0134] Detection of major pathogenic Cronobacter species based on the MIRA-CRISPR Cas12a fluorescence system:

[0135] The genomic DNA of Cronobacter was extracted by thermal lysis method, and specific MIRA primers were used to amplify the specific genes of Cronobacter and three major pathogenic bacteria in Cronobacter (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich). The amplification system and experimental procedures refer to "(4)".

[0136] The amplified product was added to the corresponding CRISPR Cas12a system, and the dynamic fluorescence signal of the entire reaction process was monitored by an ELISA reader. The CRISPR Cas12a detection system and experimental steps refer to “(8)”.

[0137] To meet the needs of portable on-site testing, the fluorescence test results can be interpreted with the help of a handheld ultraviolet lamp: after the microplate reader is used to measure the result, the enzyme cleavage reaction products in the 384-well plate are immediately recovered, placed in a dark environment, and illuminated with a 365nm handheld ultraviolet lamp. The fluorescence results are observed with the naked eye. The PCR tube with a positive result shows green fluorescence, and the negative result has no fluorescence.

[0138] Example 3

[0139] Detection of major pathogenic Cronobacter species based on MIRA-CRISPR Cas12a colloidal gold lateral flow test strip system:

[0140] The genomic DNA of Cronobacter was extracted by thermal lysis method, and specific MIRA primers were used to amplify the specific genes of Cronobacter and three major pathogenic bacteria in Cronobacter (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich). The amplification system and experimental procedures refer to "(4)".

[0141] The amplified product was directly added to the corresponding CRISPR Cas12a system for detection. The CRISPR Cas12a detection system was assembled according to the table below. After a brief centrifugation, 6 μl of substrate DNA and 0.8 μl of reporter probe (100 nM) were added and digested at 37 °C for 1 h. After the reaction, 5 μl of the reaction product was added to 45 μl of the test strip loading buffer, mixed and slowly dripped onto the test strip loading area, and the results were read after 5 min.

[0142] The interpretation method is: if both the quality control line and the test line have obvious purple-red bands, the result is judged to be negative; if only the quality control line has a purple-red band or the test line shows a relatively weak color band, the result is judged to be positive; if no purple-red band appears on the quality control line, the result is invalid.

[0143]

[0144] Example 4

[0145] Characterization of specific experimental results of typing and detection of major pathogenic Cronobacter based on MIRA-CRISPR Cas12a fluorescence system:

[0146] To verify the feasibility of the constructed method, its specificity was first characterized. The specificity of the Cronobacter fluorescence signal readout detection system was verified using Escherichia coli, Staphylococcus aureus, and Salmonella existing in the laboratory as negative controls.

[0147] Escherichia coli, Staphylococcus aureus, and Salmonella were used as negative controls between genera, and different Cronobacter species were used as negative controls between different species within the genus to verify the specificity of the fluorescence signal readout detection system for three major pathogenic bacteria (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich).

[0148] Figure 5 A, C, E, and G in the figure are the dynamic fluorescence results measured by the microplate reader. The results show that after MIRA specific amplification, the nucleic acid signal is amplified, and the specific genes of Cronobacter and the three main pathogenic bacteria can be effectively recognized by the specific CrRNA in the CRISPR system to stimulate the Cas12 enzyme to trans-cleave the fluorescent probe to produce a fluorescent signal. As time goes by, the fluorescence signal gradually increases, and at about 30 minutes, the fluorescence signal reaches a plateau. Take the fluorescence signal intensity corresponding to different detection systems at this time point of 30 minutes, such as

[0149] Figure 5 As shown in B, D, F, and H. The results show that in the established Cronobacter detection system, the presence of Escherichia coli, Staphylococcus aureus, and Salmonella will not stimulate Cas12a to initiate the enzyme cleavage mechanism to produce fluorescent signals; the established detection system for the three main pathogenic bacteria has no cross-reaction within the genus in addition to inter-genus specificity.

[0150] Figure 8 This is the result of the fluorescence detection system under the irradiation of a handheld ultraviolet lamp when the CRISPR system reacted for 60 minutes. Among them, the targets to be tested in tubes 1-7 are: Cronobacter sakazakii, Cronobacter malonate, Cronobacter zurich, Cronobacter mogins, Escherichia coli, Staphylococcus aureus, and Salmonella, and there is no target to be tested in tube NC. The detection system of Cronobacter and the detection systems of the three main pathogens in the Cronobacter genus all show good specificity. Only when the target to be tested is present, a fluorescent signal visible to the naked eye is generated in the tube. This interpretation method does not require any instruments or equipment. It is simple, portable, low-cost and suitable for on-site detection and judgment.

[0151] Example 5

[0152] Characterization of the sensitivity test results of typing and detecting the main pathogenic Cronobacter based on the MIRA-CRISPR Cas12a fluorescence system:

[0153] Different concentrations of Cronobacter bacterial suspension were prepared according to "(2)", and sterile enzyme-free water was used as a negative control to verify the detection limit of the fluorescence signal readout detection system for Cronobacter and three major pathogenic bacteria in the Cronobacter genus (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich).

[0154] The experimental method was referred to as “(8)”. Different bacterial concentrations were expressed as CFU / ml and their corresponding fluorescence intensities were plotted. Each data point was measured three times in duplicate, and the lowest detectable bacterial concentration was defined as the sensitivity of the detection method.

[0155] Figure 6 The sensitivity results of the Cronobacter detection system determined by the ELISA instrument are shown in Figure 2. Figure 7 Characterization of the sensitivity results of the detection system for three major pathogenic bacteria in the genus Cronobacter. Figure 6 and Figure 7 A, C, and E are the dynamic fluorescence results of detecting bacterial solutions with different concentrations.

[0156] From the overall trend analysis, the fluorescence intensity increases with time. There are certain differences in the time when the bacterial solutions of different concentrations reach the plateau. The fluorescence intensity of the low-concentration bacterial solution did not reach the plateau during the entire monitoring process, which indicates that low-concentration or even low-abundance samples may require a longer incubation time. The corresponding fluorescence intensity of the bacterial solution of each concentration in the four detection systems at 30 minutes was plotted and a significance analysis was performed. As shown in Figures B, D, and F, at 30 minutes, the fluorescence intensity generated by the detection system of each concentration of bacterial solution was significantly different from that of the NC group (negative control) (P < 0.05), and the concentration of the bacterial solution was as low as 10 0 CFU / ml, there is still a certain fluorescence intensity. The results show that the detection limit of each detection system is 10 0 CFU / ml.

[0157] After the determination by the ELISA instrument, the reaction system was recovered, placed under a 365nm ultraviolet lamp for naked eye interpretation and recorded with a mobile phone. The results were as follows: Fig. 9 , Fig.10 As shown, Fig. 9 This is the test result of Cronobacter detection system under ultraviolet light. Fig.10The results of the detection system of three main pathogenic bacteria in the genus Cronobacter under ultraviolet light. There is no target in the NC tube, no fluorescence signal, and as the concentration of the bacterial solution decreases, the fluorescence signal gradually weakens, but there is a clear difference from the NC group. 0 The test results can also be accurately interpreted at CFU / ml.

[0158] Example 6

[0159] Characterization of specific experimental results of typing and detection of major pathogenic Cronobacter based on MIRA-CRISPR Cas12a test strip system

[0160] The existing Escherichia coli, Staphylococcus aureus and Salmonella in the laboratory were used as negative controls to verify the specificity of the Cronobacter test strip signal readout detection system.

[0161] Escherichia coli, Staphylococcus aureus, and Salmonella were used as negative controls between genera, and different Cronobacter species were used as negative controls between different species within the genus to verify the specificity of the test strip signal readout detection system for three major pathogenic bacteria (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurichensis). The experimental method is based on “(9)”.

[0162] Fig.11 The specific results of the visual detection system of the test strips are shown in Figures 1-7. Cronobacter sakazakii, Cronobacter malonate, Cronobacter zurich, Cronobacter mogins, Escherichia coli, Salmonella, and Staphylococcus aureus are used as the targets to be tested, and there is no target to be tested in the NC group. The test strip reading results show that for each detection system, the enzyme cleavage mechanism can only be activated when the target to be tested exists, the reporter probe is cut, the detection line cannot form an immunoprint, and a purple-red band appears on the quality control line. Visual interpretation of colloidal gold lateral flow chromatography test strips confirms that the constructed Cronobacter detection system is specific. In addition to the inter-genus specificity, the detection system for the three main pathogens in the Cronobacter genus has no cross-reaction within the genus.

[0163] Example 7

[0164] Characterization of the sensitivity test results of typing and detecting the main pathogenic types of Cronobacter based on the MIRA-CRISPR Cas12 test strip system:

[0165] Different concentrations of Cronobacter bacterial suspension were prepared according to "(2)", and sterile enzyme-free water was used as a negative control to verify the detection limit of the test strip signal readout detection system for Cronobacter and three major pathogenic bacteria in the Cronobacter genus (Cronobacter sakazakii, Cronobacter malonate, and Cronobacter zurich).

[0166] For experimental methods, refer to “(9)”.

[0167] The nucleic acid content of bacterial solutions of different concentrations after amplification is different, which leads to differences in the number of enzyme digestion reactions stimulated. Under the same enzyme digestion time, low-concentration bacterial solution samples stimulate less enzyme digestion reactions, and the probe cannot be fully cut. Compared with the NC group test strips, the detection line will show a relatively weak purple-red band. 8 CFU / ml and 10 0 The enzyme digestion products of the two gradient bacterial samples of CFU / ml were taken at 15min, 30min, and 60min respectively and verified with test strips. The results are as follows: Fig.12 As shown, for 10 8 CFU / ml bacterial sample can produce accurate results when CRISPR Cas12a enzyme digestion reaction is 15min, while for 10 0 The CFU / ml bacterial liquid sample needs at least 60 minutes to be different from the control group. Considering that the bacterial content of the sample is unknown in the actual test, the test strip visual detection system selects the reaction product at the 60-minute time point for verification to ensure the accuracy of the test results.

[0168] Fig.13 The sensitivity characterization results of the Cronobacter detection system are shown in Figure 2. Fig.14 The sensitivity characterization results of the detection system of three major pathogens in the genus Cronobacter. In each detection system: the NC group has no target to be detected, the probe is captured by the biotin conjugate on the detection line to form an immunoblot, and the result is judged as negative. Fig.13 , Fig.14 The results showed that the detection limit of each detection system based on the MIRA-CRISPRCas12a colloidal gold lateral flow chromatography test strip system for typing the main pathogenic types of Cronobacter was 10 0 CFU / ml.

[0169] The sequences used in the present invention are:

[0170] Cronobacter F sequence:

[0171] SEQ NO.1: GACTCCTCTCTAACATCGGCGGCGACGAC

[0172] Cronobacter R sequence:

[0173] SEQ NO.2: CATACCACGTGCGGAGATCTTGTTGGACGG

[0174] Cronobacter sakazakii F sequence:

[0175] SEQ NO.3: TGCTACTATGGCAGCGGCAACGAAGTGTCC

[0176] Cronobacter sakazakii R sequence:

[0177] SEQ NO.4: TGCAGGTGGCGTTGACCTCAAAGCTGCTCC

[0178] Cronobacter malonate F sequence:

[0179] SEQ NO.5: ACAAAACTACCATTGTCCCTCAGAGCAAGA

[0180] Cronobacter malonate R sequence:

[0181] SEQ NO.6: CACTCAGACTCAAAGGTTTAGGTGTAACAGGA

[0182] Cronobacter zurichensis F sequence:

[0183] SEQ NO.7: GCTTTCAAACTTATCCTGTGGTACAAAGCC

[0184] Cronobacter zurichensis R sequence:

[0185] SEQ NO.8: AACGGACAGTAGAGGAGTTTACATTTACGC

[0186] Cronobacter CrRNA sequence, SEQ NO.9:

[0187] UAAUUUCUACUAAGUGUAGAUGAGAUCAGGUAGUCAACAACA

[0188] Cronobacter sakazakii CrRNA sequence, SEQ NO.10:

[0189] UAAUUUCUACUAAGUGUAGAUGCUGAUGAAUGAUAAAGGCCA

[0190] Cronobacter CrRNA sequence, SEQ NO.11:

[0191] UAAUUUCUACUAAGUGUAGAUUAUGACAGGGGAUGAGAUCUG

[0192] Cronobacter CrRNA sequence, SEQ NO.12:

[0193] UAAUUUCUACUAAGUGUAGAUUCGCCAGGCGAUAAGCUCACU

[0194] SEQ NO.13: ssDNA-FQ:6-FAM-TTTTTTTT-BHQ-1

[0195] SEQ NO.14: ssDNA-FQ:6-FAM-TTTTTTTTATTTTTTT-Biotin

[0196] Sequences of Cronobacter sp.:

[0197] SEQ NO.15: TTCTAACATCGGCGGCGACGACCACGACAC

[0198] Sequences of Cronobacter sp.:

[0199] SEQ NO.16: CATACCACGTGCGGAGATCTTGTTGGACGG

[0200] Sequence of Cronobacter sakazakii:

[0201] SEQ NO.17: GTTACTGCTGCTGATAATGTTTGCGCTTGG

[0202] Sequence of Cronobacter sakazakii:

[0203] SEQ NO.18: TAAGTAAACGTCACCTGTACGGCGCTTTTCA

[0204] Sequence of Cronobacter malonate:

[0205] SEQ NO.19: TGATTAGCAACAGACTAAGTAACTGCCAACCG

[0206] Sequence of Cronobacter malonate:

[0207] SEQ NO.20: TCTGCTACCTGACCGTCTCACCTGCCCTCT

[0208] Sequence of Cronobacter zurichensis:

[0209] SEQ NO.21: GCGCATAAAACGGCTGATTCCACGGCACGT

[0210] Sequence of Cronobacter zurichensis:

[0211] SEQ NO.22: GTCTTCAAGCCATTGAGCGTTCGGCGGACA

[0212] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

Claims

1. A non-diagnostic typing detection method for pathogenic Cronobacter based on MIRA-CRISPR Cas12a, characterized in that: include, Identify the presence of Cronobacter in the sample at the genus level; In case the genus identification result is positive, the pathogenic strains are typed and tested at the species level, including Cronobacter sakazakii, Cronobacter malonate and Cronobacter zurichensis; The detection method includes boiling the bacterial solution at high temperature, lysing the bacteria, and releasing the nucleic acid sample; Specific MIRA primers are used to amplify the genomic DNA extracted from the sample to obtain the amplified MIRA product; Design and synthesize crRNA sequences in vitro; The amplified MIRA product was added to the CRISPR Cas12a fluorescence system detection system, and the fluorescence signal generated by each group of enzyme cutting system was collected to obtain the detection results. At the same time, the CrRNA sequence was added to the CRISPR Cas12a system to determine the feasibility of cis-cutting; The Cronobacter MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the amplified fragment size is 528 bp; The Cronobacter sakazakii MIRA specific primer sequences are SEQ NO.3 and SEQ NO.4, and the amplified fragment size is 460 bp; The malonate Cronobacter MIRA specific primer sequences are SEQ NO.5 and SEQ NO.6, and the amplified fragment size is: 300 bp; The specific primer sequences of Cronobacter zurichensis MIRA are SEQ NO.7 and SEQ NO.8, and the amplified fragment size is: 248 bp; The CrRNA nucleotide sequence of the Cronobacter genus is SEQ NO.9; The CrRNA nucleotide sequence of Cronobacter sakazakii is SEQ NO.10; The CrRNA nucleotide sequence of the malonate Cronobacter is SEQ NO.11; The CrRNA nucleotide sequence of Cronobacter Zurich is SEQ NO.12; Among them, the fluorescent probe is 6-FAM-TTTTTTTT-BHQ-1, one end of which is labeled with a FAM fluorescent group and the other end is labeled with a BHQ1 quenching group; When the target gene is present, the trans-cleavage activity of Cas12a is stimulated, the fluorescent probe is cut, and the FAM fluorescent group loses the constraint of the BHQ1 quenching group to generate a fluorescent signal; when the target gene is not present, no fluorescent signal is generated.

2. The non-diagnostic detection method according to claim 1, characterized in that: The high temperature boiling bacterial liquid, The process includes taking fresh bacterial liquid and boiling it at 100°C for 10 minutes.

3. The non-diagnostic detection method according to claim 1 or 2, characterized in that: The CRISPR Cas12a fluorescence system detection system is as follows: Reagent Name Volume μl Nuclease-free water 10.8 10×NEB Buffer 3 CrRNA 1μM 6 Cas12a 1μM 6 The components were added in the above order, and after a brief centrifugation, 3 μl of MIRA product and 1.2 μl of fluorescent probe 10 μM were added, and the reaction system was immediately transferred to a black 384-well ELISA plate, and the fluorescence signal was immediately monitored by an ELISA reader.

4. The non-diagnostic detection method according to claim 3, characterized in that: The microplate reader is set with an excitation wavelength of 494 nm, an emission wavelength of 520 nm, an incubation temperature of 37° C., 120 kinetic cycles, and a reading every 30 seconds.

5. The non-diagnostic detection method according to claim 3, characterized in that: Fluorescence detection results also include: Interpretation by handheld UV light: After the determination by the microplate reader is completed, the enzyme digestion reaction products in the 384-well plate are immediately recovered; Place it in a dark environment, irradiate it with a 365nm handheld ultraviolet lamp, and observe the fluorescence results with the naked eye. The PCR tube with a positive result will show green fluorescence, while the negative result will have no fluorescence.

6. A non-diagnostic typing detection method for pathogenic Cronobacter based on MIRA-CRISPR Cas12a, characterized in that: include, Identify the presence of Cronobacter in the sample at the genus level; In case the genus identification result is positive, the pathogenic strains are typed and tested at the species level, including Cronobacter sakazakii, Cronobacter malonate and Cronobacter zurichensis; The detection method includes boiling the bacterial solution at high temperature, lysing the bacteria, and releasing the nucleic acid sample; Specific MIRA primers are used to amplify the genomic DNA extracted from the sample to obtain the amplified MIRA product; Design and synthesize crRNA sequences in vitro; The Cronobacter MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the amplified fragment size is 528 bp; The Cronobacter sakazakii MIRA specific primer sequences are SEQ NO.3 and SEQ NO.4, and the amplified fragment size is 460 bp; The malonate Cronobacter MIRA specific primer sequences are SEQ NO.5 and SEQ NO.6, and the amplified fragment size is: 300 bp; The specific primer sequences of Cronobacter zurichensis MIRA are SEQ NO.7 and SEQ NO.8, and the amplified fragment size is: 248 bp; The CrRNA nucleotide sequence of the Cronobacter genus is SEQ NO.9; The CrRNA nucleotide sequence of Cronobacter sakazakii is SEQ NO.10; The CrRNA nucleotide sequence of the malonate Cronobacter is SEQ NO.11; The CrRNA nucleotide sequence of Cronobacter Zurich is SEQ NO.12; The MIRA products were directly added to the corresponding CRISPR Cas12a system for detection; Among them, the CRISPR Cas12a detection system is assembled as follows: Reagent Name Volume μl Nuclease-free water 3.2 10×NEB Buffer 2 CrRNA 1μM 4 Cas12a 1μM 4 After brief centrifugation, 6 μl of MIRA product and 0.8 μl of 100 nM reporter probe were added and reacted at 37°C; After the reaction is finished, take 5 μl of the reaction product and add it to 45 μl of the test strip loading buffer. After mixing, slowly drip it onto the test strip loading area and read the result. For high concentration bacterial solution samples 10 8 CFU / ml, samples were taken after 15 minutes of CRISPR Cas12a system digestion to determine the test results; For low concentration bacterial sample 10 0 CFU / ml requires at least 60 minutes of enzyme digestion for sampling and determination of test results; For samples with unknown bacterial content, the reaction product at the 60-min time point is selected for verification to ensure the accuracy of the test results; The result is interpreted as negative if obvious purple-red bands appear on both the quality control line and the test line; If only the quality control line shows a purple-red band or the test line shows a relatively weaker band compared with the negative control, the result is judged as positive; If no purple-red band appears on the quality control line, the result is invalid; The reporter probe is ssDNA-FQ:6-FAM-TTTTTTTATTTTTTT-Biotin.

7. The non-diagnostic detection method according to claim 1, characterized in that: The method, wherein the detection limit of Cronobacter sakazakii is 10 0 CFU / ml, the detection limit for Cronobacter malonate is 10 0 CFU / ml, the detection limit for Cronobacter Zurich is 10 0 CFU / ml.

Images