Specific target of cronobacter sakazakii based on RPA-CRISPR, RPA primer and detection system and method

Abstract

The invention discloses a Cronobacter sakazakii specific outer membrane protein gene target based on RPA-CRISPR, a primer, a detection system and a detection method. According to the present invention, the target sequence, the RPA primer and the crRNA have good inter-genus specificity, and the constructed detection method has no specific recognition reaction on other genus species, has a certain broad spectrum on other Cronobacter species of the same genus, and has accurate and reliable detection results. Besides, the detection method is combined with a boiling method or a kit to extract sample DNA, and on the premise that thallus enrichment is not carried out, the detection sensitivity of the cronobacter sakazakii genome DNA is 10 <-4 > ng / mu L, the target sensitivity is 1.43 copies / mu L, and the bacterial liquid sensitivity is 6 CFU / mL. The method is simple in operation, high in sensitivity and reliability and suitable for on-site rapid detection of cronobacter sakazakii in related supervision departments when standard detection is carried out on infant formula milk powder and goat milk powder, the sample detection limit reaches 100 CFU / mL, and the method is simple in sample pretreatment, convenient to operate, high in sensitivity and high in reliability and is suitable for on-site rapid detection of cronobacter sakazakii in related supervision departments.

Description

Technical Field

[0001] The present invention belongs to the technical field of food detection. More specifically, it relates to a specific target, RPA primers, detection system and method for Cronobacter sakazakii based on RPA-CRISPR. Background Art

[0002] Cronobacter was formerly known as Enterobacter sakazakii. Bacteria of this genus are facultative anaerobic Gram-negative bacilli living in the intestines of humans and animals. This genus includes seven species, and all have been detected in foods such as infant milk powder, meat, and grains. Among them, infant milk powder is the main infection route of this bacterium. Infections mainly cause bacteremia, meningitis, necrotizing enterocolitis, etc., with a fatality rate as high as 80%. Especially for infants and immunocompromised people, the harm is extremely great. At present, China's inspection standard GB 4789.40-2016 "National Food Safety Standard Food Microbiology Examination - Examination of Cronobacter (Enterobacter sakazakii)" uses traditional microbiological methods to detect and identify Cronobacter sakazakii. This method uses microbial plate culture and physiological and biochemical identification, which has the advantages of high accuracy, good stability, and low cost. However, the sample pretreatment is complex, the detection takes a long time, the technical requirements are high, and it is difficult to achieve rapid and efficient on-site detection. To overcome this defect, some rapid detection methods such as molecular biology methods, immunoassay methods, and sensor methods have been developed. Compared with molecular biology methods, immunoassay methods take longer time and have lower sensitivity, and also do not meet the requirements of rapid and sensitive on-site detection. Currently, the molecular biology methods for detecting Cronobacter sakazakii all target nucleic acids, including PCR method and real-time fluorescence PCR method. Although these methods have high sensitivity, they rely on expensive and bulky large-scale instruments, with cumbersome operations, which are not conducive to the on-site rapid detection by relevant regulatory authorities.

[0003] In recent years, many DNA isothermal amplification technologies such as LAMP, RCA, RPA, etc. have emerged as the times require, which provides the possibility for on-site rapid nucleic acid detection. Currently, DNA isothermal amplification technologies have been widely reported for the detection of pathogenic bacteria. For example, Yang et al. (2021) designed a LAMP detection method based on the specific target sequence ITS in Cronobacter sakazakii, and detected the amplification products after LAMP with a lateral flow dipstick (LFD), showing higher specificity and sensitivity compared to PCR. However, the LAMP technology requires complex primer design and is prone to non-specific amplification. Therefore, the RPA technology with simple primer design principles, strong selectivity for targets, and high amplification efficiency has received wide attention. Gao et al. (2021) combined the improved propidium monoazide (PMAxx) with qRPA to distinguish and quantitatively analyze dead and live Cronobacter sakazakii, with a sensitivity of 164 CFU / mL.

[0004] However, after RPA amplification, it is still necessary to purify the amplification product and combine nucleic acid electrophoresis or other complex methods to judge the detection result. The operation is cumbersome and the signal output intensity is poor. Further, the rise of CRISPR technology brings new "opportunities" for RPA detection of pathogenic bacteria. Using CRISPR / Cas12a protein to combine with RPA to detect Cronobacter sakazakii in food, the CRISPR / Cas12a protein quickly and specifically recognizes the nucleic acid target in the amplification product and activates its own nuclease activity, thus cutting the fluorescent probe indiscriminately and outputting a large amount of fluorescent signals. The detection efficiency is high, the sensitivity is high, the time consumption is short, and it is suitable for on-site rapid detection. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the above-mentioned existing technologies, and provide a target, RPA primer, detection system and method capable of quickly and specifically detecting Cronobacter sakazakii.

[0006] The first object of the present invention is to provide a specific base sequence for detecting Cronobacter sakazakii.

[0007] The second object of the present invention is to provide an RPA primer for detecting Cronobacter sakazakii.

[0008] The third object of the present invention is to provide the application of the RPA primer in the product for detecting Cronobacter sakazakii.

[0009] The fourth object of the present invention is to provide a CRISPR / Cas12a detection system for detecting Cronobacter sakazakii.

[0010] The fifth object of the present invention is to provide the application of the detection system in the product for detecting Cronobacter sakazakii.

[0011] The sixth object of the present invention is to provide a method for quickly detecting Cronobacter sakazakii.

[0012] The seventh object of the present invention is to provide a kit for detecting Cronobacter sakazakii.

[0013] The above objects of the present invention are achieved by the following technical solutions:

[0014] Based on the related genes such as 16S rRNA, 23S rRNA, ompA, ompW, gluA, and repA of Cronobacter sakazakii, these gene sequences were downloaded from the NCBI website, and these gene sequences were respectively input into the BLAST module of the NCBI website to search for and download all corresponding homologous sequences. The Snapgene software was used to align all the sequences to screen for specific base sequences. Finally, a base sequence with intergeneric specificity and broad-spectrum within the genus was screened out in the outer membrane protein ompA gene.

[0015] According to the operation guide of the RPA kit 《 Assay Design Manual》, RPA primers based on this specific target were designed. Through agarose gel electrophoresis, a set of primers with the highest amplification efficiency and the best specificity were selected. The RPA primers have good intergeneric specificity and are suitable for the detection of Cronobacter sakazakii.

[0016] In the present invention, crRNA was designed at the PAM site in the target sequence interval. The crRNA sequence can be divided into two parts. The part near the 5'-end is a fixed base sequence, and the 3'-terminal part is complementary to the non-target strand of the target DNA. Thus, a highly specific crRNA for the target sequence was obtained, which has high specificity for the target DNA fragment.

[0017] Based on the above RPA primers and crRNA, the present invention combined an ssDNA-FQ fluorescence reporter probe labeled with a FAM reporter group to construct a CRISPR / Cas12a detection system for the detection of Cronobacter sakazakii, and established a method for the rapid detection of Cronobacter sakazakii. Since the RPA primers and crRNA designed in the present invention have both high specificity and high sensitivity, they can directly perform RPA amplification using DNA templates extracted by the boiling method or a kit, without complex sample pretreatment and microbial enrichment steps, and finally achieve the rapid fluorescence visual detection of Cronobacter sakazakii.

[0018] The present invention provides a specific target for the detection of Cronobacter sakazakii, and the target sequence is shown as SEQ ID NO.1.

[0019] The present invention provides an RPA primer P5-F / P5-R for the detection of Cronobacter sakazakii, and the primer sequences are shown as SEQ ID NO.2~3.

[0020] The RPA primer P5-F / P5-R of the present invention has the characteristics of high specificity and high sensitivity, and can be used for the detection of Cronobacter sakazakii.

[0021] Therefore, the present invention claims the application of the RPA primers P5-F / P5-R in detecting Cronobacter sakazakii or in preparing a product for detecting Cronobacter sakazakii as shown in SEQ ID NO.2-3.

[0022] The present invention also provides an RPA-CRISPR / Cas12a detection system for detecting Cronobacter sakazakii, which includes RPA primers P5-F / P5-R, crRNA, CRISPR / Cas12a protein, and ssDNA-FQ fluorescent reporter probe; the sequence of the crRNA is as shown in SEQ ID NO.4, and the sequence of the ssDNA-FQ fluorescent reporter probe is as shown in SEQ ID NO.5.

[0023] The present invention also claims the application of the above detection system in detecting Cronobacter sakazakii or in preparing a product for detecting Cronobacter sakazakii.

[0024] Preferably, the ssDNA-FQ carries a FAM fluorescent group and a BHQ quenching group, see Example 2.

[0025] The present invention also provides a method for rapidly detecting Cronobacter sakazakii, which includes the following steps:

[0026] 1. Extract the DNA of the sample to be tested using the boiling method or a kit;

[0027] 2. Use the DNA obtained in step 1 as the DNA template and perform isothermal nucleic acid amplification with the RPA primers P5-F / P5-R;

[0028] 3. Prepare the detection system with the crRNA, ssDNA-FQ fluorescent reporter probe, and CRISPR / Cas12a protein in the detection system, and add the amplification product obtained in step 2 for reaction; if under blue light irradiation, the blank control has no fluorescence, and the positive control and the sample to be tested produce green fluorescence, then the sample to be tested contains Cronobacter sakazakii.

[0029] When the positive control has no green fluorescence or the blank control shows green fluorescence, it indicates that there is an operation error or the reagent is contaminated.

[0030] Preferably, in step 1, the boiling method is used to extract the DNA of the sample to be tested or a kit is used to obtain genomic DNA, see Example 4.

[0031] Preferably, in the reaction system of the isothermal nucleic acid amplification reaction in step 2, the final concentration of the primers P5-F / P5-R is 0.56 μM, see Example 1.

[0032] Preferably, in the reaction conditions of the isothermal nucleic acid amplification reaction in step 2, the final concentration of dNTPs is 2 mM, see Example 1.

[0033] Specifically, the reaction system of the isothermal nucleic acid amplification reaction described in step 2 is as follows: 3.98 μL of C buffer, 1 μL of L buffer, 2.4 μL of P-core, 0.5 μL of dNTPs (10 mM each), the final concentration of primers P5-F / P5-R is 0.56 μM, 0.5 μL of B buffer, 0.5 μL of DNA template, and the total volume of the system is 10 μL.

[0034] Preferably, the reaction conditions of the isothermal nucleic acid amplification reaction described in step 2 are 37 °C for 25 min, as shown in Example 1.

[0035] Preferably, in the detection system described in step 3, the final concentration of Cas12a is 80 nM, the final concentration of crRNA is 80 nM, and the final concentration of the ssDNA-FQ fluorescent reporter probe is 240 nM, as shown in Example 2.

[0036] Specifically, the CRISPR / Cas12a fluorescence detection system described in step 3 is as follows: CRISPR / Cas12a detection system: 2.5 μL of 10×NEBuffer 2.1, 2 μL of Cas12a (1 μM), 2 μL of crRNA (1 μM), 0.6 μL of ssDNA-FQ (10 μM), 0.5 μL of RNase inhibitor (0.4 U), 7.4 μL of ddH2O, and the total volume of the system is 15 μL.

[0037] Preferably, the reaction conditions of the reaction described in step 3 are 37 °C for 10 min, as shown in Example 2.

[0038] Specifically, the samples described in the present invention include but are not limited to infant formula milk powder, infant formula goat milk powder, etc.

[0039] The present invention also provides a kit for detecting Cronobacter sakazakii, which contains RPA primers P5-F / P5-R, CRISPR / Cas12a protein, crRNA, and ssDNA-FQ fluorescent reporter probe.

[0040] The present invention has the following beneficial effects:

[0041] (1) The target sequence, RPA primers, and crRNA described in the present invention all have high intergeneric specificity, and specifically amplify only the target DNA fragment of the genus Cronobacter including Cronobacter sakazakii, without non-specific amplification and recognition detection of other bacillus genera with high homology. The detection method of Cronobacter sakazakii constructed based on the target sequence, RPA primers, and crRNA has the characteristics of high specificity and high sensitivity, is suitable for the detection of Cronobacter sakazakii, and the results are accurate.

[0042] (2) The detection method of Cronobacter sakazakii constructed by the present invention can achieve rapid detection of Cronobacter sakazakii without relying on the laboratory environment. It is easy to operate, time-consuming, suitable for on-site rapid detection, and has strong practicability. By optimizing the reaction conditions and reaction procedures of RPA isothermal amplification and RPA-CRISPR / Cas12a reaction, amplification and detection can be completed under isothermal (37 °C) conditions. The RPA amplification process only takes 25 minutes, and the CRISPR / Cas12a detection process only takes 10 minutes. In addition, combined with the boiling method, sample pretreatment and DNA extraction can be achieved within 15 minutes. Without microbial enrichment, the whole process can be shortened to 50 minutes, with high detection efficiency.

[0043] (3) By detecting artificially spiked samples of infant formula milk powder and infant formula goat milk powder, it is found that when extracting sample DNA with a commercial kit, the detection limit for both samples reaches 10 0 CFU / mL; when extracting sample DNA by the boiling method, the detection limit for both samples reaches 10 2 CFU / mL, with relatively high sensitivity, meeting the requirements of on-site detection.

[0044] (4) The RPA-CRISPR / Cas12a detection method for Cronobacter sakazakii established by the present invention is applicable to the inspection of samples such as infant formula milk powder and goat milk powder, with a wide range of applications. It is completely consistent with the detection results of commercial real-time fluorescence PCR kits, has high reliability, and does not rely on expensive and sophisticated large instruments, being suitable for the rapid detection of relevant regulatory departments. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 FIG. is the result of RPA primer screening; FIG. A is the amplification results of 6 pairs of designed RPA primers. Among them, lane M is 5000bp DNA Marker, and lanes 1-6 correspond to the amplification results of primer pairs P1-F / P1-R, P2-F / P2-R, P3-F / P3-R, P4-F / P4-R, P4-F / P4-R, P5-F / P5-R, P6-F / P6-R respectively; FIG. B is the specific detection result of RPA primer P5-F / P5-R. Among them, lane M is 5000bp DNA Marker, and the species corresponding to lanes 1-10 are Cronobacter sakazakii, Cronobacter malonaticus, Cronobacter zurichensis, Escherichia coli, Salmonella, Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Vibrio parahaemolyticus, Citrobacter respectively, and lane 11 is the negative control (ddH2O).

[0046] Figure 2Specific detection of the RPA-CRISPR / Cas12a detection system; among them, 1 is Cronobacter sakazakii, 2 is Cronobacter zurichensis, 3 is Cronobacter malonaticus, 4 is Escherichia coli, 5 is Staphylococcus aureus, 6 is Salmonella, 7 is Citrobacter, 8 is Bacillus cereus, 9 is Vibrio parahaemolyticus, 10 is Listeria monocytogenes, and 11 is the negative control (ddH2O).

[0047] Figure 3 Results of the genomic DNA sensitivity detection of the RPA-CRISPR / Cas12a detection system. The amounts of genomic DNA of Cronobacter sakazakii detected are successively 10 1 、10 0 、10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、NTC.

[0048] Figure 4 Results of the target sensitivity detection of the RPA-CRISPR / Cas12a detection system. The target concentrations of Cronobacter sakazakii detected are successively 10 5 、10 4 、10 3 、10 2 、10 1 、10 0 、NTC.

[0049] Figure 5 Results of the bacterial solution sensitivity detection of the RPA-CRISPR / Cas12a detection system. The colony numbers of Cronobacter sakazakii detected are successively 10 6 、10 5 、10 4 、10 3 、10 2 、10 1 、10 0 、NTC.

[0050] Figure 6 Results of the spiked detection of the RPA-CRISPR / Cas12a detection method applied to commercially available infant formula milk powder and goat milk powder; Figure A is the detection limit of Cronobacter sakazakii when extracting DNA from infant formula milk powder with the kit, Figure B is the detection limit of Cronobacter sakazakii when extracting DNA from infant formula goat milk powder with the kit, Figure C is the detection limit of Cronobacter sakazakii when extracting DNA from infant formula milk powder by the boiling method, Figure D is the detection limit of Cronobacter sakazakii when extracting DNA from infant formula goat milk powder by the boiling method. The spiked concentrations of Cronobacter sakazakii in both milk powders are 10 7 、106 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 , NTC, where NTC is the negative control (ddH2O).

[0051] Figure 7 is the confirmed test result of a commercially available real-time fluorescence PCR kit established for Cronobacter sakazakii. Among them, 1 is the positive control, and the bacterial solution concentrations of 2-5 are 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL, and 6 is NTC. Specific embodiments

[0052] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments. However, the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0053] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0054] Example 1 is the design of RPA primers and the optimization of the reaction

[0055] Design and screening of specific isothermal amplification primers (RPA primers) for Cronobacter sakazakii

[0056] In this invention, genes such as 16S rRNA, 23S rRNA, ompA, ompW, gluA, repA of Cronobacter sakazakii and their corresponding homologous DNA sequences were downloaded from the NCBI database. The SnapGene software was used to align these genes of Cronobacter sakazakii with the DNA sequences of other foodborne pathogenic bacteria with relatively high homology. Finally, an intergeneric specific DNA sequence was screened out in the outer membrane protein ompA gene. The species information involved in the homologous DNA sequence of ompA is shown in Table 1. The specific DNA sequence screened out after homologous alignment analysis of the ompA gene is 5’-GTTGGTCCCAGTTCCACGATACCGGCTTTATCCCTAACGACGGCCCGACTCACGAAAGCCAGCTGGGCGCAGGCGCGTTCGGTGGTTACCAGGTTAACCCGTACGTTGGTTTCGAAATGGGCTACGACTGGCTGGGCCGCATGCCGTATAAAGGCGACACTGTAAACGGCGCTTTCAAAGCTCAGGGCGTACAGCTGACCGCTAAACTGGGTTACCCGGTAACCGACGACCTGGACGTATACACCCGTCTGGGCGGCATGGTATGGC-3’.

[0057] Table 1 Species information involved in the homologous alignment of specific targets of Cronobacter sakazakii

[0058]

[0059]

[0060]

[0061] Through homologous alignment, a region that is conserved within the genus in the outer membrane protein gene ompA region of Cronobacter sakazakii and has a large difference from the homologous DNA sequences of other foodborne pathogenic bacteria was selected as the target, and specific isothermal amplification primers were designed. The sequences of the designed primers are shown in the following table, and 6 pairs of primers were initially screened out.

[0062]

[0063]

[0064] The designed primers were specifically screened through the Primer-BLAST tool on an online website. Then, using the genomic DNA of Cronobacter sakazakii as the amplification template for the RPA experiment, the amplified products were purified and subjected to nucleic acid electrophoresis detection. Primer pairs with single and bright bands were selected as alternative primers. Finally, the DNA of 2 strains of Cronobacter belonging to the same genus and 7 other foodborne pathogenic bacteria were used for RPA amplification to verify the specificity of the primers. Finally, primers with single and bright bands and no non-specific amplification were selected as the best primers. After a series of detection and screening, the finally selected RPA primers were P5-F / P5-R, and the primer sequences are as follows:

[0065] Sequence of P5-F (SEQ ID NO.2): 5’-GTTGGTCCCAGTTCCACGATACCGGCTTTA-3’

[0066] Sequence of P5-R (SEQ ID NO.2): 5’-GCCATACCATGCCGCCCAGACGGGTGTATA-3’

[0067] The fragment size amplified by the isothermal amplification specific primer pair P5-F / P5-R is 267 bp.

[0068] The specific detection results of the RPA primers P5-F / P5-R are as Figure 1 shown in B. Among them, lane M is 5000 bp DNA Marker; the species corresponding to lanes 1-10 are Cronobacter sakazakii, Cronobacter malonaticus, Cronobacter zurichensis, Escherichia coli, Salmonella, Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Vibrio parahaemolyticus, and Citrobacter, respectively. Lane 11 is the negative control (ddH2O). From Figure 1 this, it can be seen that the RPA isothermal amplification primers P5-F / P5-R designed and screened in the present invention have the best amplification effect and high intergeneric specificity, and can be used for the detection of Cronobacter sakazakii.

[0069] In order to further improve the detection effect, the present invention optimized the reaction conditions of RPA isothermal amplification, and the specific optimization parameters are shown in Table 2.

[0070] Table 2

[0071]

[0072]

[0073] While keeping other conditions unchanged, the detection effects under different primer concentrations, dNTPs concentrations, amplification temperatures and reaction times were tested. The fluorescence brightness of the reaction tubes under blue light and the fluorescence values measured in the qPCR instrument were compared. Considering both fluorescence intensity and reagent cost, the RPA reaction parameters of the optimal reaction system were obtained. Among them, the final concentration of the primer in the optimal reaction system should be 0.56 μM, the final concentration of dNTPs is 2 mM, the optimal amplification time is 25 min, and the optimal amplification temperature is 37 °C.

[0074] Example 2 is the construction and optimization of the RPA-RISPR / Cas12a detection system

[0075] In the present invention, by designing and screening in the amplification target region of the RPA primers described in Example 1, a specific crRNA targeting the amplified target DNA was obtained, and its sequence is 5’-UAAUUUCUACUAAGUGUAGAUUCCCUAACGACGGCCCGACUC-3’ (SEQ ID NO.3); at the same time, a ssDNA-FQ fluorescence probe was designed. Its sequence is 5’FAM-TTTTTT-3’BHQ (SEQ ID NO.4), and thus the RPA-CRISPR / Cas12a detection system was established. The FQ-ssDNA fluorescence probe carries a FAM fluorescence reporter group and a BHQ quenching group.

[0076] Based on the optimized RPA amplification system, the Cas12a enzyme concentration, crRNA / Cas12a ratio and ssDNA-FQ / Cas12a ratio in the CRISPR / Cas12a reaction system were optimized. The specific optimization conditions are shown in Table 3:

[0077] Table 3

[0078]

[0079] While keeping other conditions unchanged, the detection effects under different Cas12a enzyme concentrations, crRNA / Cas12a ratios and ssDNA-FQ / Cas12a ratios were tested. The fluorescence brightness of the reaction tubes under blue light and the fluorescence values measured in the qPCR instrument were compared. Considering both fluorescence intensity and reagent cost, the optimal CRISPR / Cas12a reaction condition parameters of the reaction system were obtained. Among them, the final concentration of Cas12a in the optimal reaction system should be 80 nM, the crRNA / Cas12a ratio is 1:1, and the ssDNA-FQ / Cas12a ratio is 3:1.

[0080] The present invention uses the constructed optimal RPA-CRISPR / Cas12a detection system, combined with DNA extraction, to detect Cronobacter sakazakii.

[0081] Specifically, in this embodiment, the DNA stored at -20°C after being extracted using a bacterial genomic DNA extraction kit was used for the system establishment. To explore the influence of the complex matrix of real samples on the extraction method, in the spiked real sample detection, DNA of the samples was obtained using two methods: the boiling method and the kit method. Among them, the specific steps of the boiling method were as follows: Take 1 mL of artificially contaminated milk powder solution, centrifuge at 12,000 rpm / min for 2 min, and discard the supernatant; then wash the precipitate twice with 200 μL of ddH2O; dissolve the precipitate with 100 μL of ddH2O, boil the suspension in a boiling water bath for 10 min; finally, centrifuge at 12,000 rpm / min for 2 min, let it stand on ice for 2 min, take the supernatant, transfer the supernatant containing DNA to a new centrifuge tube, and store it at -20°C for standby. The obtained supernatant was used as the DNA template. The steps of the kit method were carried out according to the kit operation manual.

[0082] After optimizing the RPA isothermal amplification system and the CRISPR / Cas12a detection system in the RPA-CRISPR / Cas12a detection system multiple times respectively, the final RPA isothermal amplification system and CRISPR / Cas12a detection system were as follows:

[0083] RPA isothermal amplification system: 3.98 μL of C buffer, 1 μL of L buffer, 2.4 μL of P-core, 0.50 μL of dNTPs (10 mM each), the final concentration of primers P5-F / P5-R was 0.56 μM, 0.50 μL of B buffer, 0.50 μL of DNA template, and the total system was 10 μL.

[0084] CRISPR / Cas12a detection system: 2.5 μL of 10×NEBuffer 2.1, 2 μL of Cas12a (1 μM), 2 μL of crRNA (1 μM), 0.6 μL of ssDNA-FQ (10 μM), 0.5 μL of RNase inhibitor (0.4 U), 7.4 μL of ddH2O, and the total system was 15 μL.

[0085] The reaction conditions of the RPA-CRISPR / Cas12a detection system were as follows: The RPA isothermal amplification system reacted at 37°C for 25 min; the amplified system was added to the prepared CRISPR / Cas12a detection system and reacted at 37°C. CRISPR / Cas12a recognized the target, the ssDNA-FQ fluorescent probe was cleaved and fluorescence was released, and the fluorescence intensity increased with time. After reacting for 10 min, when there were no samples with lower concentrations in the same group of samples producing green fluorescence and the blank control had no fluorescence, preferably, the optimal reaction time should be 10 min.

[0086] The detection results of RPA-CRISPR / Cas12a were observed by a micro blue light gel cutter, and the results were saved by taking pictures with a mobile phone for result determination: When green fluorescence is produced in both the sample to be tested and the positive control, and no green fluorescence is produced in the blank control, the sample to be tested is determined to be positive; When green fluorescence is produced in the positive control, no green fluorescence is produced in the sample to be tested, and no green fluorescence is produced in the blank control, it is determined that Cronobacter sakazakii is not detected in the sample; If no green fluorescence is produced in the positive control or green fluorescence is produced in the blank control, it indicates that the operation fails or there is reagent contamination, and the experiment needs to be repeated.

[0087] Example 3 is the specificity verification of the RPA-CRISPR / Cas12a detection system

[0088] To verify the specificity of the RPA-CRISPR / Cas12a detection system constructed by the present invention, the DNA of Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter malonaticus, Escherichia coli, Staphylococcus aureus, Salmonella, Citrobacter, Bacillus cereus, Vibrio parahaemolyticus, and Listeria monocytogenes were respectively extracted as detection objects to verify the specificity of the constructed RPA-CRISPR / Cas12a detection system. The DNA extraction, RPA-CRISPR / Cas12a detection system and reaction conditions were the same as those in Examples 1 and 2, and the fluorescence value was determined at the end point by a qPCR instrument. The specificity verification results of the RPA-CRISPR / Cas12a detection system are as Figure 2 shown. It can be seen that the detection system of the present invention only produced obvious visible green fluorescence on the DNA templates of Cronobacter sakazakii and the other two species in the same genus of Cronobacter, and there was no fluorescence reaction for the remaining 7 species such as Escherichia coli, Staphylococcus aureus, and Salmonella, indicating that the RPA-CRISPR / Cas12a detection system of the present invention has high intergeneric specificity.

[0089] Example 4 Sensitivity of the RPA-CRISPR / Cas12a detection method

[0090] To verify the sensitivity of the constructed RPA-CRISPR / Cas12a detection method, the genomic DNA of Cronobacter sakazakii was used as a template, and systems with different gradient DNA concentrations were set for detection. The amounts of genomic DNA in the systems were 10 1 、10 0 、10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、0 (NTC). The detection results are as Figure 3As shown in the figure, it can be seen from the figure that the detection limit of the RPA-CRISPR / Cas12a detection method constructed by the present invention for the genomic DNA of Cronobacter sakazakii is 10 -4 ng / μL.

[0091] Example 5 Detection Limit of RPA-CRISPR / Cas12a Detection Method

[0092] To verify the detection limit of the constructed RPA-CRISPR / Cas12a detection method, the present invention prepared samples with artificial labeling to simulate the contamination of commercially available infant formula milk powder and goat milk powder by Cronobacter sakazakii, and evaluated and verified them through the RPA-CRISPR / Cas12a detection system described in the present invention.

[0093] The evaluation results of the detection limit are as Figure 6 shown. When the sample contains 10 0 CFU / mL of Cronobacter sakazakii, it can be detected by the RPA-CRISPR / Cas12a system established by the present invention, and the experimental tube emits obvious green fluorescence visible to the naked eye, showing a positive detection result. When the sample is not labeled, the system cannot recognize the target, and the test tube does not produce green fluorescence, and the detection result is negative. Therefore, the detection limit of the RPA-CRISPR / Cas12a system constructed by the present invention for Cronobacter sakazakii can reach 10 0 CFU / mL.

[0094] Example 6 Accuracy of RPA-CRISPR / Cas12a Detection Method

[0095] To prove the accuracy of the RPA-CRISPR / Cas12a detection method of the present invention, a commercially available real-time fluorescence PCR kit established for Cronobacter sakazakii was used to verify the accuracy of the constructed RPA-CRISPR / Cas12a detection system. The Cronobacter sakazakii in the sample was detected according to the real-time fluorescence PCR method, and the results are as Figure 7 shown. The results show that the use of the commercially available real-time fluorescence PCR detection method is completely consistent with the detection results of the present invention ( Figure 5 ), thus proving that the RPA-CRISPR / Cas12a detection method of the present invention has high accuracy and can be applied to the rapid detection of Cronobacter sakazakii in food.

[0096] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An RPA-CRISPR / Cas12a composition for detecting Cronobacter sakazakii, characterized in that It includes a Cronobacter sakazakii-specific base sequence based on an outer membrane protein gene, RPA primers P5-F / P5-R, crRNA, CRISPR / Cas12a protein and ssDNA-FQ probe; the specific base sequence is shown in SEQ ID NO.1, the sequence of the RPA primers P5-F / P5-R is shown in SEQ ID NO.2-3, the sequence of the crRNA is shown in SEQ ID NO.4, and the sequence of the FQ-ssDNA is shown in SEQ ID NO.

5.

2. The RPA-CRISPR / Cas12a composition for detecting Cronobacter sakazakii according to claim 1, characterized in that The method for obtaining the specific base sequence comprises the following steps: Step 1: Download the 16S rRNA, 23S rRNA, ompA, ompW, gluA, repA and other genes and all their homologous sequences from the NCBI website; Step 2: Perform base-by-base alignment in SnapGene software to screen specific base sequences.

3. Use of the composition according to claim 1 or 2 in products for detecting Cronobacter sakazakii.

4. A method for rapid detection of Cronobacter sakazakii, characterized in that: The following steps are involved: Step 1: Extract DNA from the sample to be tested; Step 2: Using the DNA obtained in step 1 as a template, performing a nucleic acid isothermal amplification reaction using the RPA primers P5-F / P5-R described in claim 1; Step 3: Prepare a detection system using crRNA, ssDNA-FQ and CRISPR / Cas12a protein in the composition of claim 1, and react the amplified product obtained in step 2 and add it thereto; The 5' end of the ssDNA-FQ is labeled with a FAM group, and the 3' end is labeled with a BHQ group; a portable blue light gel cutting instrument is used to directly visually determine whether Cronobacter sakazakii is present in the sample.

5. The method for rapid detection of Cronobacter sakazakii according to claim 4, characterized in that: In step 1, the DNA of the sample to be tested is extracted by boiling method or kit.

6. The method for rapid detection of Cronobacter sakazakii according to claim 5, characterized in that: In the reaction system of the nucleic acid isothermal amplification reaction in step 2, the final concentration of primers P5-F / P5-R is 0.56 μM.

7. The method for rapid detection of Cronobacter sakazakii according to claim 6, characterized in that: In the detection system described in step 3, the final concentration of Cas12a is 80nM, the final concentration of crRNA is 80nM, and the final concentration of ssDNA-FQ is 240nM.

8. A kit for detecting Cronobacter sakazakii, characterized in that: Containing the RPA-CRISPR / Cas12a composition of claim 1.

Images