CAPS molecular marker of rice salt-tolerant ST4 promoter region and application of CAPS molecular marker

By designing the CAPS molecular marker in the rice ST4 promoter region, and using specific primers and enzyme cleavage and electrophoresis technology, the problem of salt tolerance gene screening in rice varieties was solved, rapid and accurate salt tolerance identification was achieved, and breeding efficiency was improved.

CN120249538AActive Publication Date: 2025-07-04INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Application Number
CN202510241034.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-03
Publication Date
2025-07-04
Estimated Expiration
2045-03-03

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately screen out the salt-tolerant genes in rice varieties, resulting in long breeding cycles, high manpower and material consumption, and large interference from environmental factors.

Method used

The CAPS molecular marker of the rice ST4 promoter region was designed, and PCR amplification was performed using specific primers ST4-PRO-F1 and ST4-PRO-R1, and the enzyme was cleaved with Eco81I restriction enzyme, and agarose gel electrophoresis was used to determine whether there was a salt-tolerant gene fragment.

Benefits of technology

It has achieved rapid and accurate identification of salt tolerance of rice varieties, shortened breeding cycle, reduced environmental interference and manpower and material consumption in field experiments, and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249538A_ABST
    Figure CN120249538A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of agriculture, and particularly provides a CAPS molecular marker of a rice salt-tolerant ST4 promoter region and application of the CAPS molecular marker. The method comprises the following steps: selecting leaves of rice to extract genome DNA (Deoxyribonucleic Acid) of the tissues, and then respectively carrying out PCR (Polymerase Chain Reaction) amplification by taking the DNA of the tissues as a template and taking corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 as specific primers to obtain amplified fragments; carrying out enzyme digestion on the amplified fragment by using Eco81I restriction enzyme, and carrying out electrophoresis after enzyme digestion; after the ST4 promoter fragment is subjected to electrophoresis, a single plant with only one 2162bp main band is a salt-tolerant single plant, and a single plant with 1366bp and 784bp bands appearing in electrophoresis is a salt-sensitive single plant. According to the invention, the rice variety improved by utilizing the wild rice ST4 gene can be rapidly bred, the current situations of much field work and large workload caused by carrying out a large amount of salt tolerance identification by utilizing a population material can be improved, and the method has important theoretical and practical significance for breeding a new variety of rice with salt tolerance character.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of rice variety screening, and particularly to CAPS molecular markers for screening salt-tolerant genes in the promoter region of rice ST4 and their applications. Background Art

[0002] Soil salinization is one of the important constraints for global agricultural development. The global area of saline-alkali soil exceeds 800 million hectares, accounting for 8.7% of the earth's surface area. Due to soil degradation, more than 1.5 billion people globally face major challenges in food production, and agricultural sustainable development faces a major crisis. Rice (Oryza sativa L.) is one of the important food crops in China and is also a moderately salt-sensitive plant. At present, the area of saline-alkali land in China is continuously increasing. Cultivating salt-tolerant rice varieties is of great practical significance for utilizing saline-alkali soil in China and protecting food security in China.

[0003] Wild rice is the ancestral species of cultivated rice. Due to growing in the natural environment for a long time, it contains a large number of stress-resistant and disease-resistant genes that were lost or weakened during the domestication of rice. In recent decades, due to the large-scale promotion of cultivated varieties, the genetic basis of cultivated rice variety resources has become increasingly narrow. Developing and utilizing salt-tolerant genes in wild rice germplasm resources is the key means to broaden the genetic basis of cultivated rice and cultivate salt-tolerant rice varieties. Through molecular marker-assisted breeding, the breeding cycle can be greatly shortened, and new salt-tolerant rice varieties can be quickly cultivated. Therefore, it is particularly important to develop molecular markers associated with salt-tolerant genes in wild rice. Summary of the Invention

[0004] The technical personnel of the present invention discovered a new salt-tolerant gene LOC_Os04g52660 in wild rice in the early stage. This gene is located on chromosome 4 and encodes an expressed protein. Through near-isogenic lines, transgenic experiments, etc., it was verified that the allelic genes in wild rice have extremely strong salt-tolerant functions.

[0005] The purpose of the present invention is to design new molecular markers based on the sequence polymorphisms of this gene in wild rice and cultivated rice, for future molecular-assisted selection in cultivating new varieties using this gene, so as to accelerate the process of rice salt-tolerant breeding.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides an application of a CAPS molecular marker in the rice ST4 promoter region in screening salt-tolerant rice varieties. The CAPS molecular marker is located on chromosome 4 of the rice genome, and the polymorphic site is G / A. The upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is as shown in ST4-PRO-F1, and the downstream primer sequence is as shown in ST4-PRO-R1. Upstream primer ST4-PRO-F1: ATTTGCTGATGTGGTTTGGGTTCG; downstream primer ST4-PRO-R1: AAGATTGGTGGTGCTCGGGCTTAC. The amplification product sizes of the specific primer pair for amplifying the CAPS molecular marker in Nipponbare and NIL are 2150bp and 2162bp respectively( Figure 1 ); After the amplification product of rice with a salt-tolerant gene fragment in the ST4 promoter region is digested with the restriction enzyme Eco81I, there is only one main band of 2162bp. After the amplification product of rice without a salt-tolerant gene fragment in the ST4 promoter region is digested with the restriction enzyme Eco81I, there are two main bands of 1366bp and 784bp.

[0008] The second aspect of the present invention provides an application of the specific primer pair of the CAPS molecular marker in molecular screening of salt-tolerant rice varieties.

[0009] The third aspect of the present invention provides a method for screening the presence or absence of a salt-tolerant gene in the rice ST4 promoter region, which includes the following steps:

[0010] S1. Select the leaves of rice to extract the genomic DNA of the above tissue. Then, using the DNA of the above tissue as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 described in claim 1 as specific primers, perform PCR amplification respectively to obtain amplification fragments;

[0011] S2. The PCR amplification product is digested with the restriction enzyme Eco81I, and the digested product is typed by agarose gel electrophoresis. Determine whether it contains a salt-tolerant gene fragment according to the electrophoresis bands;

[0012] S3. Identification result: If there is only one main band of 2162bp in the digested product, the ST4 promoter region of the tested rice contains a salt-tolerant gene fragment; if the digested product contains two main bands of 1366bp and 784bp, the ST4 promoter region of the tested rice does not contain a salt-tolerant gene fragment.

[0013] Furthermore, the system for PCR amplification is as follows: the volume is 50 μL, including 25 μL of 2×PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterile water is added to make up to 50 μL.

[0014] Furthermore, the procedure for PCR amplification is as follows: pre-denaturation at 95°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 1 min, with 34 cycles; finally, extension at 68°C for 10 min.

[0015] Advantages of the present invention:

[0016] Using this CAPS marker to detect the genotypes of different single plants of the ST4 promoter can quickly select rice varieties improved by this salt tolerance locus of wild rice. The successful development of this molecular marker has achieved precise laboratory identification of salt tolerance genotypes. Compared with the traditional field phenotype screening method, it can effectively improve the situation that field trials are greatly interfered by environmental factors, have a long screening cycle, and consume a high amount of manpower and material resources, providing an efficient molecular marker-assisted selection technology system for rice salt tolerance breeding, which has important theoretical and practical significance. Description of the Drawings

[0017] Figure 1 Electrophoresis diagrams before and after digestion of the rice ST4 promoter fragment: Figure 1 In A, it is the electrophoresis diagram of the digestion of the Nipponbare and NIL ST4 promoter fragments in Example 1: M is Marker Ⅲ, and lanes 1 and 2 are Nipponbare and NIL respectively; Figure 1 In B, it is the electrophoresis diagram of the Nipponbare and NIL ST4 promoter fragments before and after digestion.

[0018] Figure 2 It is the electrophoresis diagram of the digestion of the rice ST4 promoter fragment in Example 2: M is Marker Ⅲ, and lanes 1 - 20 are respectively: Nipponbare (cultivated rice), NIL, salt-tolerant single plants in the F2 population, NIL, Nipponbare. Figure 3 Phenotype diagrams of salt tolerance of Nipponbare and NIL: Figure 3 On the left are the Nipponbare and NIL seedlings growing normally for 15 days, Figure 3 On the right are the Nipponbare and NIL seedlings treated with 150 mM NaCl for 7 days and then cultured in clear water for 7 days for recovery. Detailed Implementation Modes

[0019] The specific embodiments of the present invention will be described below to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions created using the concept of the present invention are within the scope of protection.

[0020] Experimental materials: A wild rice chromosome segment substitution line population CSSL118 constructed with common wild rice as the donor parent and Nipponbare as the recipient parent, the F2 generation produced by the hybridization of CSSL118 and Nipponbare, and the near-isogenic line population NIL.

[0021] Example 1

[0022] A method for screening the presence or absence of the salt-tolerant gene ST4 in the promoter region of rice, comprising the following steps:

[0023] S1. Select the leaves of rice to extract the genomic DNA of the above tissues. Then, using the DNA of the above tissues as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 as specific primers, perform PCR amplification respectively to obtain amplification fragments; the PCR amplification volume is 50 μL, including 25 μL of 2×PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterilized water is added to make up to 50 μL; the PCR amplification program is pre-denaturation of DNA at 95°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 1 min, for 34 cycles; finally, extension at 68°C for 10 min.

[0024] S2. The PCR amplification product is digested with the restriction enzyme Eco81I. The digestion system is: 1 μg of PCR product, 2 μL of FastDigest Eco81I, 2 μL of 10×FastDigest Green Buffer, and ddH2O is added to make up to 32 μL; the digestion condition is incubation at 37°C for 1.5 h. The digested product is typed by agarose gel electrophoresis, and it is judged whether it contains the salt-tolerant gene fragment according to the electrophoresis bands.

[0025] S3. Identification results: For NIL, there is only one main band of 2162 bp after electrophoresis of the ST4 promoter fragment, which is a salt-tolerant single plant; for Nipponbare, there are two bands of 1366 bp and 784 bp after electrophoresis, which is a salt-sensitive single plant. The molecular identification results of the salt tolerance of the two kinds of rice are consistent with the phenotypic results, indicating that the identification procedure of the present invention is simple and has a wide application range ( Figure 1 and Figure 3 ).

[0026] Example 2

[0027] A method for screening the presence or absence of the salt-tolerant gene ST4 in the promoter region of rice, comprising the following steps:

[0028] S1. Select the leaves of rice to extract the genomic DNA of the above tissue. Then, using the DNA of the above tissue as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 as specific primers, perform PCR amplification respectively to obtain amplification fragments; the volume of PCR amplification is 50 μL, including 25 μL of 2×PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and make up to 50 μL with sterilized water; the PCR amplification program is pre-denaturation of DNA at 95°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 1 min, for 34 cycles; finally, extension at 68°C for 10 min.

[0029] S2. Digest the PCR amplification product with the restriction endonuclease Eco81I. The digestion system is: 1 μg of PCR product, 2 μL of FastDigest Eco81I, 2 μL of 10×FastDigest Green Buffer, and make up to 32 μL with ddH2O; the digestion condition is incubation at 37°C for 1.5 h. The digested product is typed by agarose gel electrophoresis, and whether it contains the salt-tolerant gene fragment is judged according to the electrophoresis band.

[0030] Identification result: For the salt-tolerant single plants in the F2 population, there is only one main band of 2162 bp after electrophoresis of the ST4 promoter fragment; for Nipponbare, two bands of 1366 bp and 784 bp appear after electrophoresis, which are salt-sensitive single plants ( Figure 2 ).

[0031] In summary, using this molecular marker, salt-tolerant rice varieties improved by using the wild rice ST4 gene can be quickly bred, helping breeders overcome the disadvantages of large workload and long time consumption in the field salt-tolerance identification that must use a large number of population materials.

[0032] In the present invention, specific embodiments are used to elaborate the principle and implementation manner of the present invention. The description of the above embodiments is only used to help understand the method and its core idea of the present invention; at the same time, for those of ordinary skill in the art, according to the idea of the present invention, there will be changes in the scope of the specific implementation manner. In summary, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. Application of CAPS molecular marker in promoter region of rice ST4 in screening salt-tolerant rice varieties, characterized in that, The CAPS molecular marker is located on chromosome 4 of the rice genome, and the polymorphic locus is G / A; the upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is as shown in ST4-PRO-F1, and the downstream primer sequence is as shown in ST4-PRO-R1; upstream primer ST4-PRO-F1: ATTTGCTGATGTGGTTTGGGTTCG; downstream primer ST4-PRO-R1: AAGATTGGTGGTGCTCGGGCTTAC; After the amplification product of rice containing the salt tolerance gene fragment in the ST4 promoter region is digested with the restriction enzyme Eco81I, there is only one main band of 2162bp. After the amplification product of rice without the salt tolerance gene fragment in the ST4 promoter region is digested with the restriction enzyme Eco81I, it contains two main bands of 1366bp and 784bp.

2. Use of the specific primer pair of the CAPS molecular marker according to claim 1 in molecular screening of salt-tolerant rice varieties.

3. Method for screening the presence or absence of salt-tolerant genes in the promoter region of rice ST4, characterized in that, Comprising the following steps: S1. Select the leaves of rice to extract the genomic DNA of the above tissue. Then, using the DNA of the above tissue as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 described in claim 1 as specific primers, perform PCR amplification respectively to obtain amplification fragments; S2. The PCR amplification product is digested with the restriction enzyme Eco81I, and the digested product is typed by agarose gel electrophoresis. Whether it contains the salt tolerance gene fragment is judged according to the electrophoresis band; S3. Identification result: If there is only one main band of 2162bp in the digested product, the ST4 promoter region of the rice to be tested contains the salt tolerance gene fragment; if the digested product contains two main bands of 1366bp and 784bp, the ST4 promoter region of the rice to be tested does not contain the salt tolerance gene fragment.

4. The method according to claim 3, characterized in that, The system of the PCR amplification is: the volume is 50 μL, including 25 μL of 2×PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and add sterile water to 50 μL.

5. The method according to claim 3, characterized in that, The program of the PCR amplification is: pre-denaturation at 95°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 68°C for 1 min, 34 cycles; finally, extension at 68°C for 10 min.

Citation Information

Patent Citations

  • Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang common wild rice and application of molecular marker

    CN116814846A

  • CAPS molecular marker of rice salt-tolerant SS5 promoter region and application of CAPS molecular marker

    CN117604140A

Cited By

  • Specific primer pair for detecting rice salt-tolerant gene HKT1-W and application of specific primer pair

    CN121538350A