KASP molecular marker, primer pair, kit and method for identifying sweet melon peel color character and application
By developing KASP molecular markers and primer pairs and utilizing the base mutation at the SNP site on chromosome 4 of the melon genome, the problem of the lag of melon peel color traits in the breeding process was solved, and rapid identification and efficient breeding at the seedling stage were achieved.
Patent Information
- Application Number
- CN202510797953.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-16
- Publication Date
- 2025-09-12
AI Technical Summary
The melon peel color trait has a significant lag in the breeding process, which leads to an extended breeding cycle and increased costs. The existing technology lacks tightly linked molecular markers for peel color screening.
A KASP molecular marker and primer pair were developed, using the SNP site (A/T base mutation) at Chr 04-999812 on chromosome 4 of the melon genome to accurately identify the fruit skin color trait at the seedling stage through PCR amplification and fluorescence signal detection, and a kit was provided for assisted selection breeding.
It has achieved the rapid and accurate identification of fruit skin color traits during the melon seedling stage, shortened the breeding cycle, improved the efficiency and accuracy of selective breeding, and reduced breeding costs.
Smart Images

Figure CN120624701A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to a KASP molecular marker, a primer pair, a kit, a method and an application for identifying the color trait of melon peel. Background Art
[0002] melon( Cucumis melo L. ) is widely cultivated in the world as a major melon crop and has important economic value; peel color is an important appearance trait of melon. It is not only a determining factor of fruit maturity and quality, but also a key factor affecting consumers' purchasing intention and market commodity value. Breeding melon varieties with diversified peel colors is an important goal of modern melon breeding.
[0003] Melon peel color only becomes apparent after ripening, a characteristic that leads to significant lags in phenotypic screening during the breeding process. On the one hand, color trait identification must wait for the entire fruit development cycle, extending the single-generation breeding cycle and limiting the number of breeding generations throughout the year, seriously delaying the breeding process. On the other hand, plants with non-target colors cannot be excluded during the immature stage, resulting in the continuous consumption of land, water, fertilizer, and management resources for ineffective materials, significantly increasing field planting costs and labor input. This results in long selection cycles and high costs for peel color breeding. Therefore, the development of molecular markers for peel color screening is of great significance for shortening the breeding cycle and reducing breeding costs.
[0004] The phenotypic variation of melon peel color is extremely rich. The essence of color difference comes from the pigment components such as carotene, chlorophyll, and flavonoids in the fruit, which are affected by environmental factors such as light and temperature. The genetic mechanism of melon peel color formation is a complex process. The research results on its genetic laws and related QTLs or gene positioning in the existing technology show that the gene on chromosome 4 is the most abundant. CmAPRR2 ( MELO3C003375 ) gene leads to differences in fruit peel color. However, the precise mapping, cloning, and genetic structure of other genes regulating melon peel color on chromosome 4 have not been reported, nor have molecular markers closely linked to melon peel color been found. Therefore, those skilled in the art are eager to develop molecular markers for identifying melon peel color traits, using them to screen germplasm resources and facilitate molecular-assisted selective breeding. Summary of the Invention
[0005] The present invention provides a KASP molecular marker, a primer pair, a kit, a method and an application for identifying the color traits of melon peel in order to more quickly and accurately identify the color traits of melon peel at the seedling stage.
[0006] One of the objectives of the present invention is to provide a KASP molecular marker for identifying the color trait of melon peel, wherein the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2, and the genotype at the 101st base of the KASP molecular marker nucleotide sequence is A or T.
[0007] A second object of the present invention is to provide a primer pair for amplifying and identifying the color trait of melon peel, the primer pair comprising CmMYC2-X, CmMYC2-Y and CmMYC2-C; the CmMYC2-X nucleotide sequence is shown in SEO ID NO.3, the CmMYC2-Y nucleotide sequence is shown in SEO ID NO.4, and the CmMYC2-C nucleotide sequence is shown in SEO ID NO.5.
[0008] A third object of the present invention is to provide a kit for identifying the color traits of melon peel, the kit comprising the above-mentioned primer pair.
[0009] A fourth object of the present invention is to provide the use of the above-mentioned KASP molecular marker, primer pair or kit in identifying the color traits of melon peel.
[0010] A fifth object of the present invention is to provide the use of the above-mentioned KASP molecular marker, primer pair or kit in auxiliary identification, auxiliary breeding and screening of melon peel color traits.
[0011] In a preferred embodiment of the present invention, the melon peel color is yellow or green.
[0012] A sixth object of the present invention is to provide a method for identifying the color traits of melon peel, the method comprising the following steps: S1: Extract genomic DNA from young leaves of the melon to be tested; S2: Using the DNA obtained in S1 as a template, perform PCR amplification using the above primer pairs to obtain PCR products; S3: Detecting the fluorescence signal of the PCR amplification product obtained in S2 by using an enzyme marker, and determining the color characteristics of the melon peel based on the fluorescence signal detection results.
[0013] In a preferred embodiment of the present invention, the PCR amplification system in S2 is : Contains 2×TaqMasterMix , 10 mmol / L CmMYC2-X forward primer , 10 mmol / L CmMYC2-Y forward primer , 10 mmol / L CmMYC2-C reverse primer , 10-100 ng DNA template , sterilized ddH2O .
[0014] In a preferred embodiment of the present invention, the PCR amplification program in S2 is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing-extension at 61-55°C for 1 min, decreasing the temperature by 0.6°C each cycle, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing-extension at 55°C for 1 min, and continuing amplification for 26 cycles; and storage at 4°C.
[0015] In a preferred embodiment of the present invention, the test result judgment standard in S3 is: if the fluorescent signal of the amplification product detection result shows a blue fluorescent signal, the melon to be tested is a homozygous genotype AA, and the phenotype is yellow peel; if the fluorescent signal of the amplification product detection result shows a red fluorescent signal, the melon to be tested is a homozygous genotype TT, and the phenotype is green peel; if the fluorescent signal of the amplification product detection result shows a green fluorescent signal, the melon to be tested is a heterozygous genotype TA, and the phenotype is green peel.
[0016] The beneficial effects of the present invention are as follows: the present invention uses the yellow-skinned muskmelon inbred line 9316 and the gray-green-skinned muskmelon inbred line 2019-126 as parents, hybridizes to obtain F1, and constructs a genetic population; by combining the whole genome resequencing of both parents with the BSA pooling technology of the F2 generation population, the mixed gene pool of extreme individuals in the F2 genetic population is resequenced, and the gene controlling the peel color trait is preliminarily located within the 3.5 Mb segment of chromosome 4 of the melon genome; by developing 12 CAPS (Cleaved Amplified Polymorphic Sequences) markers, 10 dCAPS (Derived Cleaved Amplified Polymorphic Sequences) markers and 1 InDel (Insertion and Deletion) marker within the above 3.5 Mb segment, and using the F2 genetic population, the gene controlling the peel color trait is finely located within a 14.377 Kb segment; MELO3C003412 The genes are candidate genes.
[0017] Through comparison of parental sequences and verification of natural populations, it was found that MELO3C003412 A SNP site was found in the gene promoter region, located at Chr 04-999812 on chromosome 4 of the melon genome, and an A / T base mutation occurred at this site. Based on the above A / T base mutation, a KASP marker was developed and named CmMYC2 , CmMYC2The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2. CmMYC2 The genotype at base 101 of the molecular marker nucleotide sequence is A or T, the genotype of yellow-rind melons is AA, and the genotype of green-rind melons is TT or TA. The present invention also provides a primer pair (nucleotide sequences shown in SEQ ID NOs. 3-5) for amplifying and identifying melon peel color traits, as well as a kit containing the primer pair.
[0018] The present invention provides CmMYC2 Molecular markers, primer pairs, or kits can be used to extract genomic DNA from test samples during the melon seedling stage to perform molecular marker-assisted selection for melon peel color traits, improving the accuracy and efficiency of breeding. The molecular markers, primer pairs, and kits provided by the present invention can be applied to screening for melon peel color traits, improving the accuracy of selective breeding, shortening the variety selection cycle, and accelerating the development of varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The phenotypes of the parents and F1 in Example 1 are shown; Figure 2 This is the location map of the melon peel color gene based on the BSA pooling technology in Example 1; Figure 3 For Example 4 CmMYC2 Genotyping results of molecular marker detection samples; A is the genotyping results of individuals 1-96 in the F2 generation population; B is the genotyping results of individuals 97-141, F1 and parental individuals in the F2 generation population. DETAILED DESCRIPTION
[0020] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is obvious that relevant persons can modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.
[0021] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments. The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained from commercial channels by those skilled in the art.
[0022] The steps for extracting DNA using the modified CTAB method described in the following examples are: S1: Take the young melon leaves to be tested as the material, place them in a 2 mL centrifuge tube, put them back to the laboratory with an ice pack, use a vacuum freeze dryer to dry them, and then use a grinder to grind them into powder; S2: Add the ground solution in S1 to the centrifuge tube. 1. Preheat the CTAB solution (add 2% β-mercaptoethanol) in a 65°C water bath for 1 h, shake to ensure full contact between the powder and the liquid, and place in a 65°C water bath for 1 h, mixing up and down 3-4 times during this period; S3: After cooling to room temperature, centrifuge at 4°C and 12,000 r / min for 20 min, transfer the supernatant to a new 2 mL centrifuge tube, and add The mixture (chloroform and isoamyl alcohol were mixed in a volume ratio of 24:1) was shaken thoroughly and centrifuged at 12,000 rpm for 30 min at 4°C. This step was repeated twice. S4: Pipet the supernatant after centrifugation in S3 , placed in a 1.5 mL centrifuge tube, and added Add 4°C pre-cooled anhydrous ethanol, shake thoroughly, and precipitate at 4°C for 1 h; centrifuge at 4°C and 12,000 rpm for 30 min, aspirate the supernatant, and retain the precipitate; S5: Wash the precipitate obtained in S4 2-3 times with 75% ethanol, dry it at room temperature, and add distilled water to make up the volume. , obtain the melon DNA sample to be tested.
[0023] Example 1: A KASP molecular marker for identifying melon peel color traits (1) Selection of test materials: The test materials include maternal, paternal, F1 and F2 generation populations; The male parent material is: yellow peel melon inbred line 9316; The female material is: gray-green peel melon inbred line 2019-126; The above-mentioned maternal and paternal materials were provided by Qiqihar Agricultural Technology Extension Center; The F1 generation population is obtained by hybridizing the yellow-skinned melon inbred line 9316 and the gray-green-skinned melon inbred line 2019-126 as parents to obtain an F1 generation population with green skin; The F2 generation population is: a population of 141 F2 plants obtained by self-pollination of the above-mentioned F1 generation.
[0024] (2) Genetic separation and identification Using the yellow-skinned muskmelon inbred line 9316 and the gray-green-skinned muskmelon inbred line 2019-126 as parents, the green-skinned F1 generation population was obtained by hybridization. The phenotypes of the parents and the F1 generation population are as follows: Figure 1 As shown in the figure, 120 F2 plants were obtained by self-pollination of the F1 generation. The fruit peel color phenotype of the F2 population was identified during the melon ripening period. The identification results showed that in the F2 population, the number of individual plants with yellow peel was 29, and the number of individual plants with green peel was 91. It can be seen that the segregation ratio of fruit peel color was green:yellow = 91:29, which is consistent with the Mendelian genetic segregation ratio of 3:1 (χ 2 >χ 2 0.05=3.841), indicating that the green peel trait is controlled by a dominant single gene.
[0025] (3) By combining whole-genome resequencing of parents with BSA pooling technology of F2 generation population (such as Figure 2 As shown in the figure, the mixed gene pool of extreme individuals in the F2 genetic population was resequenced, and the gene controlling the peel color trait was preliminarily located within a 3.5 Mb segment of chromosome 4 of the melon genome; by developing 12 CAPS (Cleaved Amplified Polymorphic Sequences) markers, 10 dCAPS (Derived Cleaved Amplified Polymorphic Sequences) markers and 1 InDel (Insertion and Deletion) marker within the above 3.5 Mb segment, and using the F2 genetic population, the gene controlling the peel color trait was finely located within a 14.377 Kb segment; MELO3C003412 The genes are candidate genes.
[0026] Based on the melon genome DHL92 v3.6.1, through the comparison of parental sequences and verification of natural populations, it was found that MELO3C003412 A SNP site was found in the gene promoter region, located at Chr04-999812 on chromosome 4 of the melon genome, and an A / T base mutation occurred at this site. Based on the above A / T base mutation, a KASP marker was developed and named CmMYC2 ,Should CmMYC2 Molecular markers of chromosome 4 in the melon genome DHL92 v3.6.1 MELO3C003412 The nucleotides 999712-1000351 in the 2 Kb region of the gene promoter are 640 bp in size. CmMYC2 The molecular marker nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, CmMYC2The genotype at the 101st base of the molecular marker nucleotide sequence is A or T, the genotype of the yellow-peeled melon is AA, and the genotype of the green-peeled melon is TT or TA.
[0027] SEQ ID NO.1: TGTTTATGTTCAGGATTCTACATCGAAAAAACATAAGACTTTCATAGCTCTTTTGTTATCCAATAGTTTAGATTTGTTAACACGAGTAATTTAACCATTA[A]; SEQ ID NO.2: TGTTTATGTTCAGGATTCTACATCGAAAAAACATAAGACTTTCATAGCTCTTTTGTTATCCAATAGTTTAGATTTGTTAACACGAGTAATTTAACCATTA[T].
[0028] Example 2: A primer pair for amplifying and identifying melon peel color traits According to the closely linked melon peel color trait obtained in Example 1 CmMYC2 Molecular markers were used to design primer pairs for amplifying and identifying the color traits of melon peel. Specifically, the primer pairs were obtained by screening in Example 1 on chromosome 4 of the melon genome. MELO3C003412 A primer pair was designed based on a SNP mutation (A / T mutation) at the Chr 04-999812 site within the gene promoter region. The primer pair comprises CmMYC2-X, CmMYC2-Y, and CmMYC2-C. The nucleotide sequence of CmMYC2-X is shown in SEO ID NO.3, the nucleotide sequence of CmMYC2-Y is shown in SEO ID NO.4, and the nucleotide sequence of CmMYC2-C is shown in SEO ID NO.5.
[0029] SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTGATTTGTTAACACGAGTAATTTAACCATTAA; SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTGATTTGTTAACACGAGTAATTTAACCATTAT; SEQ ID NO.5: GGCCTAAATTATCAAAAAGTATACTTCAAAC.
[0030] Example 3: A method for identifying the color characteristics of melon peel S1: Extract genomic DNA from young leaves of the melon to be tested; S2: Using the DNA obtained in S1 as a template, PCR amplification was performed using the primer pair with the nucleotide sequence shown in SEQ ID NO. 3-5 obtained in Example 2 to obtain a PCR product; the PCR amplification system is : Contains 2×Taq MasterMix , 10 mmol / L CmMYC2-X forward primer , 10 mmol / L CmMYC2-Y forward primer , 10mmol / L CmMYC2-C reverse primer , 10-100 ng DNA template , sterilized ddH2O The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing-extension at 61-55°C for 1 min, decreasing the temperature by 0.6°C each cycle, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing-extension at 55°C for 1 min, and amplification for 26 cycles, and storage at 4°C. S3: After the amplification is completed, when the temperature of each PCR amplification product obtained in S2 drops below 40°C, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent label sequence is observed and read at an excitation light of 485 nm and an emission light of 520 nm, and the HEX fluorescent label sequence is observed and read at an excitation light of 528 nm and an emission light of 560 nm). The color of the fluorescent signal is used to determine the DNA of each sample based on the label. CmMYC2 genotype.
[0031] The fluorescent signal color judgment standard is: if the fluorescent signal of the amplification product detection result shows a blue fluorescent signal, the melon to be tested is a homozygous genotype AA, and the phenotype is yellow peel; If the fluorescence signal of the amplification product detection result shows a red fluorescence signal, the melon to be tested is a homozygous genotype TT, and the phenotype is a green peel; If the fluorescence signal of the amplification product detection result shows a green fluorescence signal, the melon to be tested is a heterozygous genotype TA, and the phenotype is a green peel.
[0032] If the fluorescence signal is weak after PCR amplification and typing is inadequate, 5 more cycles can be added (denaturation at 94°C for 20 s, annealing and extension at 55°C for 1 min) until typing is complete.
[0033] The identification method provided by the present invention can be used to determine the color characteristics of the melon peel during the seedling stage, while conventional breeding requires measuring the peel color after the fruit matures. It can be seen that the identification method provided by the present invention can effectively shorten the breeding time and accelerate the breeding speed.
[0034] Example 4: To determine the CmMYC2 The molecular markers, the primer pairs obtained in Example 2, and the identification method obtained in Example 3 were used to determine the accuracy of melon peel color trait identification. In this example, the parents, F1, and 159 F2 populations were used as test samples to identify the melon peel color trait.
[0035] The peel color traits of each sample were identified using the method described in Example 3, and the melon peel color phenotype was determined at the fruit ripening stage (as shown in Table 1).
[0036] In this example, genomic DNA of the above-mentioned parents, F1 and 159 F2 generation melon varieties were extracted respectively, and the genomic DNA of the above samples was PCR amplified using the primer pairs obtained in Example 2. After the amplification was completed, when the temperature of each PCR amplification product to be obtained dropped below 40° C., the fluorescence value was read by scanning the FAM and HEX beams of a microplate reader (the FAM fluorescent label sequence was observed and read at an excitation light wavelength of 485 nm and an emission light wavelength of 520 nm, and the HEX fluorescent label sequence was observed and read at an excitation light wavelength of 528 nm and an emission light wavelength of 560 nm). The color of the fluorescent signal was used to judge the DNA of each sample based on the marker. CmMYC2 genotype.
[0037] The results are as follows Figure 3As shown in Table 1, the KASP molecular markers and primer pairs provided by the present invention successfully classified the genotypes of individual plants in the expanded F2 population into three distinct categories. These results were consistent with the phenotypic identification of yellow and green peel melons. This indicates that the KASP molecular markers and primer pairs provided by the present invention can be used to identify melon peel color traits during the seedling stage, enabling the determination of melon seed size during this stage, rapid screening of desired individuals, and accelerating the melon breeding process.
[0038] Table 1
[0039] Example 5: A kit for identifying the color characteristics of melon peel A kit for identifying melon peel color traits comprises the following reagents: the CmMYC2-X, CmMYC2-Y, and CmMYC2-C primer pairs described in Example 2; the CmMYC2-X nucleotide sequence is shown as SEO ID NO.3, the CmMYC2-Y nucleotide sequence is shown as SEO ID NO.4, and the CmMYC2-C nucleotide sequence is shown as SEO ID NO.5 (primer concentration is 10 mmol / L), 2×Taq MasterMix, and sterile ddH2O.
[0040] Any matters not described in detail in this specification are well known to those skilled in the art. Although the present invention has been disclosed above with reference to preferred embodiments, these are not intended to limit the present invention. Anyone skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be determined by the claims.
Claims
1. A KASP molecular marker for identifying melon peel color traits, characterized in that: The nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2, and the genotype at the 101st base of the KASP molecular marker nucleotide sequence is A or T.
2. A primer pair for amplifying and identifying the color trait of melon peel, characterized in that: The primer pair comprises CmMYC2-X, CmMYC2-Y and CmMYC2-C; the nucleotide sequence of CmMYC2-X is shown in SEO ID NO.3, the nucleotide sequence of CmMYC2-Y is shown in SEO ID NO.4, and the nucleotide sequence of CmMYC2-C is shown in SEO ID NO.
5.
3. A kit for identifying the color characteristics of melon peel, characterized in that: The kit comprises the primer pair according to claim 2.
4. Use of the KASP molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying the color traits of melon peel.
5. Use of the KASP molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in assisted identification, assisted breeding, and screening of melon peel color traits.
6. The use according to any one of claims 4 to 5, characterized in that The color of the melon peel is yellow or green.
7. A method for identifying the color characteristics of melon peel, characterized in that: The method comprises the following steps: S1: Extract genomic DNA from young leaves of the melon to be tested; S2: Using the DNA obtained in S1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product; S3: Detecting the fluorescence signal of the PCR amplification product obtained in S2 by using an enzyme marker, and determining the color characteristics of the melon peel based on the fluorescence signal detection results.
8. The method according to claim 7, wherein The PCR amplification system described in S2 is : Contains 2×Taq MasterMix , 10 mmol / L CmMYC2-X forward primer , 10 mmol / L CmMYC2-Y forward primer , 10 mmol / L CmMYC2-C reverse primer , 10-100 ng DNA template , sterilized ddH2O .
9. The method according to claim 7, wherein The PCR amplification program described in S2 was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing-extension at 61-55°C for 1 min, decreasing the temperature by 0.6°C each cycle, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing-extension at 55°C for 1 min, and continued amplification for 26 cycles; and storage at 4°C.
10. The method according to claim 7, characterized in that The test result judgment criteria described in S3 are: If the fluorescence signal of the amplification product detection result shows a blue fluorescence signal, the melon to be tested is a homozygous genotype AA, and the phenotype is yellow skin; If the fluorescence signal of the amplification product detection result shows a red fluorescence signal, the melon to be tested is a homozygous genotype TT, and the phenotype is a green peel; If the fluorescence signal of the amplification product detection result shows a green fluorescence signal, the melon to be tested is a heterozygous genotype TA, and the phenotype is a green peel.
Citation Information
Cited By
Application of a melon pseudo-response regulator CmAPRR2 gene editing technique
CN122405735A