Application of novel sandwich-mediated detection technology based on aptamer / antibody in the diagnosis of pan-cancer marker C1QC

Abstract

The present invention provides an enzyme-linked antibody-aptamer sandwich method (ELAAS) and a chemiluminescent aptamer sensor (CLAS), which can be directly used for the detection of C1QC in clinical serum samples. This technology combines the pan-cancer marker C1QC with ELAAS or CLAS technology, which can capture early cancer signals in a wider range, greatly improving the possibility of early cancer detection and reducing missed detection due to individualization and differences in molecular biological characteristics of different tumors. At the same time, on the basis of a significant improvement in overall detection performance, it also has the advantages of accessibility such as non-invasiveness, low detection costs, and simple sampling, which can greatly improve the compliance of high-risk population screening, which is of great significance for improving the survival rate of patients, improving the prognosis of patients, and healthy sustainable development.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme-linked immunosorbent assay and chemiluminescence method, and in particular to an application of a novel aptamer / antibody-based sandwich-mediated detection technology in the diagnosis of a pan-cancer marker C1QC. Background Art

[0002] Cancer is one of the leading causes of death worldwide and a major global public health problem (H. Sung, J. Ferlay, RL Siegel, M. Laversanne, I. Soerjomataram, A. Jemal, F. Bray, Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, Ca-a Cancer Journal for Clinicians. 71 (2023) 209-249.). It is a chronic disease that is associated with uncontrolled abnormal cell growth at the molecular level. These tumor cells continue to proliferate and differentiate without interference, invade nearby tissues, and spread throughout the body through the blood and lymphatic systems (JIOmage, E. Easterday, JT Rumph, I. Brula, B. Hill, J. Kristensen, DT Ha, CLGalindo, MK Danquah, N. Sims, VTN Guyen, Cancer Diagnostics and Early Detection Using Electrochemical Aptasensors, Micromachines. 13 (2022) 522-550.). However, the onset of early cancer is hidden, the specific symptoms are not obvious, and most patients lack awareness of census screening, resulting in a low early diagnosis rate of cancer. When most patients find discomfort and undergo testing, the tumor cells have already spread and entered the middle and late stages, and the opportunity for radical surgery is lost. It can be seen that early diagnosis of cancer is a fundamental challenge, that is, detecting small tumor lesions before symptoms appear, so as to carry out earlier intervention, which is crucial to increasing patient survival rates, improving patient prognosis, and increasing treatment and cure success rates.

[0003] In the past few decades, many methods for detecting tumors have been developed, including computed tomography (CT), chest X-ray (CRG), magnetic resonance imaging (MRI), positron emission tomography (PET) and other biopsy techniques. However, due to the high cost of testing and radiation / chemical damage to the body, widespread screening is not possible at present, and the sensitivity is highly dependent on instrument performance and physician experience. Most patients are diagnosed when the cancer develops to the late stage. These methods have extremely limited contribution to early cancer screening.

[0004] The pan-cancer early screening products based on liquid biopsy technology can be traced back to: BGI's multi-omics pan-cancer early screening technology; Herui Gene's Quansining; Burning Rock Medical's ELSA-seq technology; Lemon Juntai's Masep; Benchmark Medical's AURORA technology; Tailai Bio's Ananpan; Siqin Medical's Sikangning; Thrive Earlier Detection's CancerSEEK; GRAIL's Galleri, etc. Most of these products focus on gene testing, single gene mutations, methylation modifications, ctDNA and circulating tumor cells CTC for analysis. They show good specificity and sensitivity at the clinical trial level, but the application scenarios are relatively limited. They are mainly used for companion diagnosis and auxiliary screening. There are large individual differences in the channels for collecting cancer lesion signals, complex operations, and the need to be equipped with expensive testing equipment. In addition, for middle- and low-income cancer patients, it is difficult to afford such high testing fees as regular pan-cancer screening.

[0005] Biomarkers have advantages in early cancer detection and diagnosis. The increase in tumor marker levels can reflect the occurrence and progression of cancer and is closely related to the diagnosis and clinical treatment of certain cancers. At the same time, tumor markers as biochemical parameters provide an efficient method for understanding the cancer spectrum and can be applied to screening, diagnosis and prognosis. To date, some pan-cancer tumor markers have become important monitoring targets for adjuvant therapy, such as neuron-specific enolase (NSE), cancer antigen 19-9 (CA19-9), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), cancer antigen 125 (CA125), cytokeratin 19 fragment (CYFRA21-1) and tissue polypeptide antigen (TPA). However, the low expression levels of these pan-cancer tumor markers, the high complexity of biological systems and insufficient specificity may lead to false positive results.

[0006] The discovery of nucleic acid aptamers has made a historic breakthrough in the study of antibody-antigen reactions and opened up a new path for the development of traditional immunoassay technology. Oligonucleotides obtained by in vitro screening through systematic evolution of ligands by exponential enrichment (SELEX) are a class of ssDNA or RNA molecules that can fold into a specific three-dimensional structure and recognize target molecules in a similar way to antibodies through complementary structures. They have the advantages of enhanced stability to high temperature and extreme pH, long half-life, easy modification, small batch-to-batch differences, no immunogenicity, artificial synthesis and lower cost (W.Wu, Q.Sun, T.Li, K.Liu, Y.Jiang, Y.Wang, Y.Yang, Selection and characterization ofbispecificaptamers against malachite green and leucomalachite green, Anal Biochem. 658 (2022) 114849-114857. J.-R.Liu, Y.-L.Pan, Y.-P.Zhao, M.-C.Liu, J.-H.Chen, C.-Y.Li, A colorimetric method for vascular endothelial growth factor detection based on aptamer and magnetic beads, Nan fang yi ke da xue xue bao = Journal of Southern Medical University. 37 (2016) 210-215.).

[0007] Currently, in order to further improve the early diagnosis of multiple cancer types based on liquid biopsy, the development of low-cost, highly sensitive, rapid and highly specific marker detection technology has become the focus of work in this field. Summary of the invention

[0008] Through research, our team has confirmed that C1QC is a tumor-promoting factor and a highly sensitive pan-cancer biomarker that enhances many processes that are conducive to tumor progression and is closely related to the patient's survival and prognosis. The present invention uses the advantages of functionalized magnetic microspheres that can efficiently separate and effectively enrich targets, combined with the high specificity and affinity of aptamers, to develop aptamer-functionalized magnetic nanomaterials, and on this basis, constructs a new aptamer / antibody sandwich-mediated liquid biopsy technology for rapid diagnosis of pan-cancer early screening marker C1QC, including enzyme-linked antibody-aptamer sandwich method (ELAAS) and chemiluminescent aptamer sensor (CLAS), which can be directly used for a comprehensive strategy for C1QC detection in clinical serum samples. This technology is also the world's first application in the C1QC multi-cancer early screening strategy. Compared with traditional cancer screening such as tumor markers and imaging, the pan-cancer marker C1QC combined with ELAAS or CLAS technology screening can capture early cancer signals in a wider range, greatly improving the possibility of early cancer detection and reducing missed detection due to individualization and differences in molecular biological characteristics of different tumors. At the same time, on the basis of greatly improved overall detection performance, it also has the advantages of accessibility such as non-invasiveness, low detection costs, and simple sampling, which can greatly improve the screening compliance of high-risk populations, which is of great significance for improving patients' survival rate, improving patients' prognosis and healthy sustainable development.

[0009] On the one hand, the present invention provides a method for detecting the pan-cancer marker C1QC using an enzyme-linked antibody-aptamer sandwich method, using a functionalized aptamer magnetic nanomaterial as a capture probe, and the nucleotide sequence of the aptamer of the functionalized aptamer magnetic nanomaterial is SEQ ID NO: 1.

[0010] In some embodiments, the enzyme-linked antibody-aptamer sandwich method for detecting the pan-cancer marker C1QC comprises:

[0011] a. Add the functionalized aptamer magnetic nanomaterial to the C1QC standard wells of different concentrations, rotate and mix, and incubate for 10-30 minutes, preferably 20 minutes to set as the standard wells; add the functionalized aptamer magnetic nanomaterial to the wells of the sample to be tested, rotate and mix, and incubate for 10-30 minutes, preferably 20 minutes to set as the sample wells to be tested;

[0012] b. Separate the magnetic beads in the fishing standard well and the sample well by magnetic stand, discard the liquid, and do not wash;

[0013] c. Add Anti-C1QC antibody working solution to each well, rotate and mix, and incubate for 10-30 minutes, preferably 20 minutes;

[0014] d. Separate the magnetic beads in the fishing standard wells and the sample wells with a magnetic stand, discard the liquid, and wash with TBST;

[0015] e. Add TMB-H2O2 substrate solution to each well, and add stop solution after color development for 5-10 minutes in the dark;

[0016] f. Use a magnetic stand to separate the magnetic beads in the standard wells and the sample wells to be tested, transfer the supernatant to the ELISA plate and mix evenly, and use an ELISA reader to measure the absorbance value of each well at a wavelength of 400-500nm, preferably 450nm.

[0017] On the other hand, the present invention provides a method for detecting the pan-cancer marker C1QC using a chemiluminescent aptamer sensor, using a functionalized aptamer magnetic nanomaterial as a capture probe, wherein the nucleotide sequence of the aptamer of the functionalized aptamer magnetic nanomaterial is SEQ ID NO:1.

[0018] In some embodiments, the method for detecting the pan-cancer marker C1QC by the chemiluminescent aptamer sensor comprises:

[0019] i. Place the functionalized aptamer magnetic nanomaterial in a full-white chemiluminescent plate, then add the sample solution to be tested, and react at room temperature for 10-30 minutes, preferably 20 minutes;

[0020] ii. Remove the supernatant by magnetic separation, then add Santa Cruz HRP-modified C1QC protein antibody to the magnetic microspheres, and react at room temperature for 20-40 minutes, preferably 30 minutes;

[0021] iii. removing the supernatant by magnetic separation to obtain magnetic microspheres, and washing;

[0022] iv. Suspend the magnetic microspheres in the Luminal substrate solution, mix well, and measure the CL value in a chemiluminescent microplate detector within 5-10 minutes, preferably within 5 minutes.

[0023] In some embodiments, the preparation method of the functionalized aptamer magnetic nanomaterial includes: fully mixing the biotin aptamer and streptavidin magnetic beads, incubating at room temperature, retaining the supernatant, washing with DPBS to remove free biotin aptamers, adding a biotin blocker, incubating at room temperature, and washing with DPBS to obtain the functionalized aptamer magnetic nanomaterial; the nucleotide sequence of the biotin aptamer is SEQ ID NO: 1.

[0024] In some embodiments, the biotin aptamer is diluted with DPBS to a target concentration of 400-600 nM, preferably 500 nM, and renatured by heating in a metal bath at 90-100°C, preferably 95°C for 8-15 min, preferably 10 min, followed by vigorous vortexing for 20-40 s, preferably 30 s, and equilibration at room temperature for 2 h to 3 h.

[0025] In some embodiments, the streptavidin magnetic beads are obtained by washing, activating, coupling, blocking and purifying carboxyl-modified magnetic nanoparticles.

[0026] In some embodiments, the denatured biotin aptamer and the streptavidin magnetic beads washed with DPBS are fully mixed; incubated at room temperature for 40-50 minutes, preferably 45 minutes, and the supernatant is retained; washed with DPBS to remove free biotin aptamers; after adding a biotin blocker, incubated at room temperature for 10-20 minutes, preferably 15 minutes to obtain a functionalized aptamer magnetic nanomaterial; washed with DPBS again to obtain the functionalized aptamer magnetic nanomaterial; the nucleotide sequence of the biotin aptamer is SEQ ID NO: 1.

[0027] In some embodiments, the streptavidin magnetic beads are obtained by washing, activating, coupling, blocking and purifying carboxyl-modified magnetic nanoparticles.

[0028] The washing comprises washing the carboxyl-modified magnetic nanoparticles with DPBS buffer;

[0029] The activation is to mix equal volumes of 8-15 mg / mL, preferably 10 mg / mL NHS and 8-15 mg / mL, preferably 10 mg / mL EDC, and add the mixture to the washed carboxyl-modified magnetic nanoparticles to activate the carboxyl groups on the surface of the carboxyl-modified magnetic nanoparticles;

[0030] The coupling is to add the activated carboxyl-modified magnetic nanoparticles to streptavidin and incubate them on a room temperature rotating mixer to generate an aminocarboxylation reaction, so that the amino groups on the streptavidin and the carboxyl groups on the magnetic nanoparticles are dehydrated and condensed to form a covalent bond, thereby being fixed on the surface of the magnetic nanoparticles;

[0031] The blocking step is to add a mixed solution of 0.8-1.2 mol / L, preferably 1 mol / L ethanolamine hydrochloride and 2-4 mol / L, preferably 3 mg / mL BSA to the coupled magnetic nanoparticles, and incubate on a rotary mixer at room temperature to block the excess unamino binding sites on the surface of the magnetic nanoparticles;

[0032] The purification is carried out on a magnetic separator, by fishing the blocked magnetic nanoparticles and washing with DPBST.

[0033] The key technical points of the present invention are:

[0034] 1) The ELAAS and CLAS kits for detecting C1QC in clinical samples of the present invention include calibrators, functionalized magnetic microsphere suspensions, signal amplification antibodies, luminescent substrates, enzyme-linked substrates, enzyme-linked stop solutions, sample diluents, and washing solutions. The calibrators are configured with C1QC antigens; the functionalized magnetic microspheres are suspensions coated with C1QC nucleic acid aptamers; the reporter probe is a horseradish peroxidase-modified C1QC antibody; the luminescent substrate is luminal; the enzyme-linked substrate is a two-component TMB-H2O2; the enzyme-linked stop solution is H2SO4; the sample diluent is DPBS; and the washing solution is TBST (0.1%).

[0035] 2) Key points of the technology used

[0036] ① Step 1: Based on the surface plasmon resonance technology (SPR), an aptamer that can pair with the C1QC protein antibody was identified. It can bind to two different sites of the pan-cancer early screening serum marker C1QC: the C1QC-based nucleic acid aptamer Bio-QC_Apt and the protein antibody Anti_QC-HRP (Santa Cruz);

[0037] ② Step 2: The selected solid phase carrier material - magnetic nanospheres (MBs) has a particle size of 2.8 μm and a layer of carboxyl (-COOH) on the surface. The amino-containing streptavidin (SA) is fixed on the surface of the magnetic microspheres (MBs) through an amide reaction, and then blocked with an ethanolamine hydrochloride blocking agent. After washing and purification, the solid phase carrier material - streptavidin magnetic beads (SMBs) is obtained;

[0038] ③Step 3: Combine Biotin QC_Apt with the SMBs obtained in step 2, and bind to the biotin through the specific binding between biotin and streptavidin (KD < 10 -15 ), Bio-QC_Apt was fixed on the surface of SMBs, and then blocked with Biotin blocker. After the magnetic bead complex was washed and purified, the functionalized aptamer magnetic nanomaterial (SMBs@QC_Apt) was obtained;

[0039] ④ Step 4: Add the SMBs@QC_Apt complex obtained in step 3 to the sample to be tested, and react at room temperature with constant temperature shaking for 30 minutes to allow SMBs@QC_Apt to fully and specifically bind to C1QC in the sample;

[0040] ⑤ Step 5: Remove the supernatant from the C1QC-SMBs@QC_Apt complex obtained in step 4 by magnetic separation, then add the paired protein antibody (Anti_QC-HRP) modified with horseradish peroxidase in step 1, and react at room temperature for 30 minutes;

[0041] ⑥ Step 6: Remove the supernatant from the solid phase (SMBs@QC_Apt-C1QC-Anti_QC-HRP) sandwich complex obtained in step 5 by magnetic separation, and repeat washing three times with 350 μL of TBST washing buffer solution to obtain a novel aptamer / antibody sandwich system;

[0042] ⑦ Step 7: Remove the supernatant of the novel aptamer / antibody sandwich system described in step 6 by magnetic separation, then mix the solid phase with the luminescent substrate solution, incubate in the dark for 2 minutes, mix well, and detect the luminescent signal CL value on a chemiluminescence instrument within 5 minutes;

[0043] ⑧Step 8: Remove the supernatant of the novel aptamer / antibody sandwich system described in step 6 through magnetic separation, then add TMB-H2O2 substrate solution to each well, develop color at room temperature in the dark, and control the reaction time within 5-10 minutes. When the first 3-4 wells of the standard wells have an obvious blue gradient and the gradient of the last 3-4 wells is not obvious, add H2SO4 enzyme-linked stop solution to stop, and then measure the absorbance OD value at 450nm on a full-wavelength multifunctional microplate reader.

[0044] 3) Working principle

[0045] Using streptavidin magnetic microspheres as separation carriers, a new ligand / antibody sandwich biosensor was constructed on the surface of functionalized aptamer magnetic nanomaterials (SMBs@QC_Apt). Horseradish peroxidase (HRP) was used as a signal amplification marker to modify the Anti_QC protein antibody. HRP can catalyze the substrate Luminal / TMB-H2O2 to produce chemiluminescence (CL) / absorbance (OD) signal changes. The amount of C1QC in the sample captured by QC_Apt was positively correlated with Anti_QC-HRP, realizing the quantitative and qualitative detection of C1QC. First, SMBs@QC_Apt is added to the sample to be tested. Since QC_Apt specifically captures C1QC in the sample, a complex of SMBs@QC_Apt-C1QC is initially formed. Then, the paired antibody Anti_QC-HRP is added to make Anti_QC-HRP bind to another site of C1QC on the surface of the magnetic microsphere to form a complex sandwiched by SMBs@QC_Apt-C1QC-Anti_QC-HRP (Aptamer / C1QC / Antibody), which is then fixed on the surface of the magnetic microsphere. Anti_QC-HRP is positively correlated with the amount of C1QC captured by SMBs@QC_Apt, that is, the higher the amount of C1QC in the sample, the higher the amount of Anti_QC-HRP fixed on the surface of the magnetic microsphere. Finally, the amount of HRP on the surface of the magnetic microspheres was detected by adding the luminescent substrate Luminal or the enzyme-linked substrate TMB-H2O2, thereby quantifying the Anti-QC fixed on the surface of the microspheres and indirectly realizing the detection of C1QC. When there is no C1QC, the CLO / OD0 signal value is weak relative to the luminescence intensity (background). When a series of C1QC standards of different concentrations are added, as the amount of C1QC increases, the signal value gradually increases, and the purpose of quantifying the C1QC content in clinical serum samples is achieved through the C1QC enzyme-linked detection standard curve.

[0046] Technical advantages of the present invention

[0047] 1) So far, the stability and modification flexibility of antibody production are difficult to overcome. The development of aptamer probes to replace capture antibodies is also an innovation of this project. Aptamers are a type of ssDNA or RNA molecules that can fold into a specific three-dimensional structure and recognize target molecules in a similar way to antibodies through complementary structures. They have the advantages of enhanced stability to high temperatures and extreme pH, long half-life, easy modification, small batch-to-batch differences, no immunogenicity, artificial synthesis and lower cost.

[0048] 2) In view of the limitations of antibody-antigen immune response, high detection cost, poor stability / sensitivity, and time-consuming diagnosis in ELISA or CLIA detection, our team used C1QC nucleic acid aptamer ultrasensitive probe to develop C1QC novel enzyme-linked antibody-aptamer sandwich (ELAAS) and chemiluminescence aptasensor (CLAS) detection technologies with independent intellectual property rights. As an innovation of traditional ELISA and CLIA, it is suitable for large-scale detection of serum samples with complex matrices, with higher accuracy, lower cost, and detection time shortened to 30 minutes.

[0049] 3) Compared with ELISA and CLIA in which antibodies are coated on the bottom of microplates as carriers, the present invention uses magnetic microspheres coated with aptamers as carriers to be evenly dispersed in the solution, which can give full play to the surface area effect of magnetic nanoparticles, provide more binding sites, accelerate the binding efficiency of aptamers and target substances, and improve the detection speed and sensitivity. In addition, the effect of magnetic field separation is added to achieve one-step separation of samples and effective enrichment of target substances, more thorough washing, reduced matrix interference, and improved signal-to-noise ratio.

[0050] 4) Compared with traditional liquid biopsy screening methods, there are problems such as limited sensitivity and specificity of tumor markers and detection methods, low compliance, and insufficient accessibility. Our team has developed new sandwich-mediated liquid biopsy technologies ELAAS and CLAS based on aptamers / antibodies. In the diagnosis of pan-cancer C1QC early screening markers, it can achieve the initial screening of multiple cancers in one go. Combined with other marker combinations, it can screen tumor molecular typing, providing a new means for early cancer screening, and strive for a larger clinical intervention window for early patients and improve survival rates.

[0051] 5) This technology is also the world's first to be applied to the C1QC multi-cancer early screening strategy. Compared with traditional cancer screening such as tumor markers and imaging, the pan-cancer marker C1QC combined with ELAAS or CLAS technology screening can capture early cancer signals in a wider range, which can greatly increase the possibility of early cancer detection and reduce missed detection due to individualization and differences in molecular biological characteristics of different tumors. On the basis of greatly improved overall detection performance, it also has the advantages of accessibility such as non-invasiveness, low detection costs, and simple sampling, which can greatly improve the screening compliance of high-risk populations, which is of great significance for improving patient survival rates, improving patient prognosis and healthy sustainable development.

[0052] 6) Provide ELAAS and CLAS new liquid biopsy technologies for the detection of pan-cancer early screening marker C1QC. The equipment includes precise full-wavelength multifunctional microplate reader and chemiluminescence analyzer. It is easy to operate, highly sensitive, semi-automatic, with a wide linear response range, environmentally friendly and rapid quantitative detection. In addition, this technology can also achieve the advantages of simultaneous screening of multiple cancers such as DLBC, GBM, LGG, KIRC, OV, PAAD, SARC, SKCM, STAD, TGCT and THYM in addition to NSCLC screening.

[0053] Terminology

[0054] Certain embodiments of the present invention are now described in detail. The present invention is intended to cover all substitutions, modifications and equivalent technical solutions, which are all included in the scope of the present invention as defined in the claims. It should be appreciated by those skilled in the art that many methods and materials similar or equivalent to those described herein can be used to practice the present invention. The present invention is by no means limited to the methods and materials described herein. In the event that one or more of the combined documents, patents and similar materials are different from or contradictory to the present application (including but not limited to defined terms, term applications, described technologies, etc.), the present application shall prevail.

[0055] It should be further appreciated that certain features of the invention, which for clarity are described in multiple separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which for brevity are described in a single embodiment, may also be provided separately or in any suitable sub-combination.

[0056] Unless otherwise specified, all technical terms used in the present invention have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. All patents and publications related to the present invention are incorporated herein by reference in their entirety.

[0057] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0058] In the following, all numbers disclosed herein are approximate, regardless of whether the words "about" or "approximately" are used. The value of each number may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15% or 20%. Whenever a number having a value of N is disclosed, any number having a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15% or N+ / -20% is explicitly disclosed, where "+ / -" means plus or minus. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 Optimization of the optimal combination ratio of SMBs and Bio-QC_Apt.

[0060] Figure 2 The sandwich SPR sensorgrams of Bio-QC_Apt13 and Anti_QC-HRP were monitored by BIAcore 8k.

[0061] Figure 3 Bio-QC_Apt13 captured C1QC and Anti_QC-HRP in the serum sample to form a sandwich SPR sensor graph.

[0062] Figure 4 T-test based on aptamer chemiluminescent sensor (CLAS).

[0063] Figure 5 Dose-dependent calibration graph of different concentrations of C1QC standard and absorbance at 450 nm determined based on ELAAS.

[0064] Figure 6 Evaluation of ELAAS assay sensitivity.

[0065] Figure 7 Photographs of the colorimetric response of the ELAAS detection system in the presence of different concentrations of C1QC.

[0066] Figure 8 The C1QC content in clinical serum samples was detected by ELAAS system. DETAILED DESCRIPTION

[0067] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0068] The reagents used in the present invention can be purchased from the market or prepared by the method described in the present invention. 1. Development of functionalized aptamer magnetic nanomaterials (SMBs@QC_Apt)

[0069] 1.1 Synthesis and renaturation of capture probe (Bio-QC_Apt)

[0070] The biotin-modified (5′-biotin) aptamer (Bio-QC_Apt) was provided by Intech Zhongkang (Xiamen) Biotechnology Co., Ltd. (aptamer sequence ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTG GTGTGTGGGTATATTTCACGGTAGCACGCATAGG, SEQ ID NO: 1, QC_Apt). Centrifuge at 12000r / min for 5min before opening the lid, then add Dulbecco's phosphate buffer (DPBS) sample diluent in a fume hood to make the final concentration of Bio-QC_Apt stock solution 100μM. Vortex and oscillate before use, dilute to the target concentration of 500nM, place 500μL in an EP tube, heat at 95℃ in a metal bath for 10min, then vortex vigorously for 30s, centrifuge for 30s, centrifuge the tube wall to the bottom of the tube, balance at room temperature for 2h~3h, and set aside.

[0071] 1.2 Preparation of Streptavidin magnetic beads (SMBs)

[0072] 1.2.1 Washing

[0073] 100 mg of carboxyl-modified (-COOH) magnetic nanoparticles (MBs, 2.8 μM) were washed three times with DPBS buffer and the beads were dispersed in DPBS buffer before adding the activation reagent.

[0074] 1.2.2 Activation

[0075] Take the prepared N-hydroxysuccinimide (NHS, 10 mg / mL) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, 10 mg / mL), slowly thaw at 4°C, mix 1000 μL of NHS and EDC in equal volumes, add to the magnetic beads in the previous step to activate the carboxyl groups on the surface of MBs, incubate at room temperature in the dark, rotate for 30 minutes. Fish the magnetic beads with a magnet, remove the supernatant, and do not wash.

[0076] 1.2.3 Coupling

[0077] Add 10 mg of streptavidin (SA) to the magnetic microspheres activated in the previous step (the optimization of the ratio of protein and carboxyl magnetic beads can be found in patent: CN202310601030.7), incubate on a rotary mixer at room temperature for 45 minutes, and dehydrate and condense the amino group (-NH2) on SA with -COOH through the aminocarboxyl reaction to covalently fix them on the surface of MBs to obtain the conjugate SMBs.

[0078] 1.2.4 Closure

[0079] Take 200 μL of a mixed blocking agent containing 1 mol / L ethanolamine hydrochloride and 3 mg / mL BSA at a final concentration and add it to the SMBs magnetic microspheres after coupling in the previous step. Incubate on a rotating mixer at room temperature for 15 minutes to block the excess unamino binding sites on the surface of the magnetic microspheres.

[0080] 1.2.5 Purification

[0081] The coupled and blocked SMBs magnetic microspheres were placed on a magnetic separator to fish the magnetic beads, the supernatant was removed, and the brown precipitate at the bottom of the centrifuge tube was retained. Then, the mixture was washed five times with 500 μL of DPBST (0.05% Tween 20) to remove free SA, ethanolamine hydrochloride and BSA. The immobilized SMBs brown particles were resuspended in 10 mL of resuspension buffer (0.01 M DPBS buffer (pH = 7.4) containing 5% BSA, 5% Sucrose, 1% PEG 20000 and 0.05% Tween-20, and then stored in a 4°C refrigerator until use.

[0082] 1.3 Optimization and characterization of the fixed amount of biotin aptamer (Bio-QC_Apt)

[0083] 1.3.1 Cleaning

[0084] Take 600 μL of the SMBs purified in 1.2 above, wash them 4 times with 1000 μL DPBS, fish the magnetic beads with a magnet, remove the supernatant, and replace the buffer of the magnetic bead binding system.

[0085] 1.3.2 Fixed

[0086] Take 6 1.5mL centrifuge tubes and add 100μL of SMBs respectively. Then, add 50pmol, 60pmol, 70pmol, 80pmol, 90pmol, and 100pmol of the renatured Bio-QC_Apt (heated at 95℃ for 10min, then equilibrated at room temperature for 3h, 50μL) solution to each centrifuge tube respectively, mix well, and incubate at room temperature for 45min.

[0087] 1.3.3 Preparation of SMBs@QC_Apt

[0088] The free supernatant (50 μL) was retained and washed 4 times with 200 μL DPBS to remove the free Bio-QC_Apt, and then incubated with 200 μL Biotin (Thermo Fisher Scientific) blocking solution on a rotating mixer at room temperature for 15 min to block the excess unbound sites on the SMBs surface. Washed 4 times with 200 μL DPBS, the magnetic beads can be temporarily stored in DPBS buffer for the last time to prevent the magnetic beads from drying and inactivation, and the DPBS buffer can be sucked away before adding the sample to prepare the functionalized aptamer magnetic nanomaterial (SMBs@QC_Apt).

[0089] 1.3.4 Characterization

[0090] Take the free supernatant obtained in (1.3.3) and characterize it by agarose gel electrophoresis to detect the effect of Bio-QC_Apt immobilization on SMBs. Preparation of 2.5% agarose gel: Take 2.5g agarose and dissolve it in 100mL 1×TBE electrophoresis buffer (pH 8.5), microwave boiling and pouring gel. The running buffer solution is 1×TBE, the electrophoresis voltage is 130V, and the running time is 60min.

[0091] 1.3.5 Results and Discussion

[0092] The experimental results are shown in Figure 1 As shown, the first well is 50pmol of Bio-QC_Apt in the positive control group; the 2nd to 7th wells are all loaded with the free Bio-QC_Apt in tubes 1 to 6; the 8th well is the negative control group DPBS. The optimal fixation ratio SMBs:Bio-QC_Apt (mg / pmol) is selected to ensure that the immobilization of Bio-QC_Apt on the surface of SMBs reaches saturation without wasting excess aptamers, and to ensure that the QC_Apt with Biotin is fixed on the SA site on the surface of SMBs. Therefore, the best fixation effect is achieved when the SMBs:Bio-QC_Apt ratio is 1mg:50pmol, which is the optimal Bio-QC_Apt labeling amount.

[0093] 2. Identification of aptamer / antibody sandwich constructs

[0094] 2.1 Modification and pre-treatment of signal amplification antibody (Anti_QC)

[0095] This platform purchased commercial Santa Cruz HRP-modified C1QC protein antibody (Anti_QC-HRP) as the recognition element (Aptamer-C1QC-Antibody) for sandwich pairing with the aptamer, and the tube was centrifuged for 5 seconds before opening the lid. Slowly open the tube lid in the clean bench, add DPBS sample diluent, dilute at 1:600, and prepare 100 μL / well according to the pre-calculated total amount required for each experiment before dilution, vortex and oscillate thoroughly, and set aside.

[0096] 2.2 Feasibility verification of aptamer / antibody sandwich method

[0097] Based on the surface plasmon resonance (SPR) technology for verifying intermolecular interactions, the interaction between the paired aptamer Bio-QC_Apt and the HRP-modified protein antibody Anti_QC-HRP and C1QC in the C1QC standard or serum sample (1:100 dilution) was identified to verify whether Bio-QC_Apt and Anti_QC-HRP have different recognition sites for C1QC. The streptavidin-immobilized sensor chip SA-Chip (for a detailed preparation scheme, refer to the invention patent: Clinical prospects of pan-cancer marker C1QC and its application in tumor detection) was used to set up the epitope analysis program according to the operating instructions of the manufacturer's SOP manual, and the Aptamer / C1QC / Antibody sandwich interaction test was performed.

[0098] 2.3 Results and Discussion

[0099] The molecular interaction instrument BIAcore 8k was used to monitor the Aptamer-C1QC-Antibody sandwich structure in real time to verify that Bio-QC_Apt and Anti_QC-HRP competed for different sites on C1QC. The results are shown in Figure 2 As shown. The capture behavior of QC_Apt on C1QC was studied. The 5`-end biotinylated (Biotin) QC_Apt was fixed on a streptavidin sensor chip (SA-Chip). The results are shown in the figure. QC_Apt specifically binds to the C1QC protein standard, and the response value increases by more than 1200 RU values. Then the second analyte Anti_QC-HRP protein antibody is injected through the same channel. The response signal jumps to the second platform, and the response value increases by more than 450 RU values, indicating that Anti_QC-HRP and Bio-QC_Apt have different epitopes that can simultaneously recognize the C1QC standard, forming a sandwich. Similarly, to confirm whether Bio-QC_Apt can specifically capture C1QC in complex serum matrix samples, the same injection procedure was used. The results are shown in Figure 3As shown, Bio-QC_Apt specifically captures C1QC in serum samples, and the response value increases. Then the second analyte Anti_QC-HRP protein antibody is injected through the same channel, and the response signal jumps to the second platform, forming a sandwich. It is worth noting that Figure 2 and Figure 3 There is basically no dissociation in the Dissociation stage, which once again proves that Bio-QC_Apt as a capture probe captures the sandwich complex formed by C1QC-Anti_QC-HRP under the conditions of injecting Washing buffer in the Dissociation stage without dissociation, and has good affinity, providing a gold standard for the validation of new sandwich methods in subsequent application development.

[0100] 3. Establishment of a novel sandwich-mediated detection system of aptamers / antibodies

[0101] 3.1 Reagent preparation

[0102] 1) Before use, bring all reagents and samples to room temperature. If they cannot be used within a certain period of time, take out only the reagents required for this test and store the rest under the specified conditions.

[0103] 2) C1QC standard (liquid): Dissolve on ice, then take out the required amount, let stand at room temperature for about 10 minutes, and store the rest at -20°C. Standard dilution gradient: 60, 20, 10, 5, 2.5, 1.25, 0.625, 0 μg / mL,

[0104] 3) The capture probe SMBs@Bio-QC_Apt was thoroughly mixed with a vortex mixer before use, and 10 μL / tube was prepared according to the pre-calculated total amount required for each experiment.

[0105] 4) Washing buffer 1×TBST contains 0.1% tween-20, 10×TBS1L formula: Tris: 24.2 g, NaCl: 80 g, pH 7.6.

[0106] 5) Anti-C1QC antibody was diluted 1:600 ​​before use for ELISA / luminescence assay. Before dilution, 100 μL / tube was prepared based on the pre-calculated total volume required for each experiment.

[0107] 6) All substrate solutions were purchased from commercial reagents. We used Anti-C1QC with HRP modification, enzyme-linked substrate: Proteintech, Cat No.SA00001-0, two-component TMB (3,3',5,5'-tetramethylbenzidine) colorimetric kit, luminescent substrate: Thermo, Cat No.32134, Pierce TMECL Plus Western Blotting Substrate, use according to the product protocol.

[0108] 3.2 Sample processing and requirements

[0109] 3.2.1 Whole blood

[0110] Place the whole blood sample collected in the separation tube at room temperature for 2 hours or at 4°C overnight, then centrifuge at 3000g for 20 minutes at 2-8°C, take 2μL of supernatant serum and add 998μL of sample diluent (DPBS) for testing. Store the remaining supernatant at -20°C or -80°C, and try to store it in aliquots and freeze it to avoid repeated freezing and thawing.

[0111] 3.2.2 Plasma

[0112] Collect the specimen using EDTA or heparin as anticoagulant, centrifuge the specimen at 2-8℃ 3000g for 20min within 30min after collection, take 2μL of supernatant serum and add 998μL of sample diluent (DPBS) for testing. Store the remaining supernatant at -20℃ or -80℃. Note*: Hemolysis of the specimen will affect the test results, so hemolyzed specimens are not suitable for this test.

[0113] 3.3 Operation steps

[0114] 3.3.1 Chemiluminescent aptamer sensor (CLAS)

[0115] 10 μL / well of functionalized aptamer magnetic nanomaterial (SMBs@QC_Apt) was placed in an all-white chemiluminescent plate, and then 100 μL of the sample solution to be tested was added, and the reaction was kept constant at room temperature for 20 minutes to allow SMBs@QC_Apt to specifically capture C1QC in the sample; the supernatant was removed by magnetic separation, and then 100 μL of Anti_QC-HRP paired antibody was added to the magnetic microspheres, and the reaction was kept constant at room temperature for 30 minutes; the supernatant was removed by magnetic separation, and each well was washed 3 times with 350 μL TBST (Tween-20, 0.1%); finally, the magnetic microspheres were suspended in 100 μL of Luminal substrate solution, mixed evenly, and the CL value was determined in a chemiluminescent microplate detector within 5 minutes.

[0116] 3.3.2 Enzyme-linked antibody-aptamer sandwich assay (ELAAS)

[0117] 1) Set up standard wells and sample wells. Capture probe SMBs@Bio-QC_Apt, 10μL / tube, add 100μL of different concentrations of standard (see reagent preparation 2) dilutions in sequence. Add 100μL of the sample to be tested to the remaining wells and incubate on a rotary mixer at room temperature for 20 minutes.

[0118] 2) Separate the magnetic beads on a magnetic rack, discard the liquid, and do not wash.

[0119] 3) Add 100 μL of Anti-C1QC antibody working solution to each well (prepare before use, see Reagent Preparation 5) and incubate on a rotating mixer at room temperature for 20 min.

[0120] 4) Separate the magnetic beads on a magnetic rack, discard the liquid in the EP tube, and wash each well three times with 350 μL of 1×TBST (0.1%).

[0121] 5) Add 100 μL of TMB-H2O2 substrate solution to each well and color develop at room temperature in the dark (the reaction time is controlled within 5-10 minutes, and the reaction can be terminated when the first 3-4 wells of the standard wells have an obvious blue gradient and the gradient is not obvious in the last 3-4 wells).

[0122] 6) Add 100 μL of stop solution to each well to stop the reaction. The blue color immediately turns yellow. The order of adding the stop solution should be as consistent as possible with the order of adding the substrate solution. Separate the magnetic beads with a magnetic stand. At this time, transfer the supernatant of the EP tube to the ELISA plate. If the color is uneven, gently shake the ELISA plate to mix the solution evenly. After ensuring that there are no water droplets on the bottom of the ELISA plate and no bubbles in the wells, immediately use an ELISA reader to measure the absorbance value (OD value) of each well at a wavelength of 450 nm.

[0123] 4. Potential of new detection technology in the detection of pan-cancer marker C1QC

[0124] 4.2 Evaluation based on CLAS

[0125] This time, the non-small cell lung cancer serum samples (NSCLC 04) and normal human serum (Normal 16) collected in our previous study were diluted 100 times, and the C1QC in NSCLC 04 and Normal 16 was detected by magnetic separation and immunoassay chemiluminescent aptamers. This method was used to detect clinical samples while using sample diluent / binding buffer (DPBS) as a negative control, SMBs@QC_Apt plus substrate (Luminal) as a blank control (detection background signal), and C1QC protein standard (12ng / mL) as a positive control for comparative detection. The test was performed using the 3.3.1 operation steps, and the data was analyzed by GraphPadPrism8. The results are shown in the figure. Figure 4 shown.

[0126] 4.1 Analysis based on ELAAS

[0127] The non-small cell lung cancer serum samples (NSCLC 03) and normal human serum (Normal16 / 24) collected in our previous study were diluted 100 times and tested according to the operation steps in 3.3.2. In order to evaluate the detection sensitivity of the enzyme-linked antibody-aptamer sandwich method, the C1QC protein standard with various concentration gradients was diluted with the sample diluent DPBS to 60, 20, 10, 5, 2.5, 1.25, 0.625, and 0 μg / mL, respectively, to establish the C1QC enzyme-linked detection standard curve. The sample was injected in the order of the above steps to obtain the OD value at each standard concentration, and the linear standard curve within the concentration range of the C1QC saturation curve was established. The experiment was repeated 3 times, and the data were analyzed by GraphPadPrism8. The results are shown in the figure. Figure 5 shown.

[0128] 4.3 Results and Discussion

[0129] Based on the novel sandwich chemiluminescence method based on aptamer / antibody developed by us, we evaluated whether C1QC had significant difference in NSCLC compared with normal serum samples. We developed a chemiluminescent aptamer based on magnetic separation and immunoassay to detect C1QC in non-small cell lung cancer (NSCLC 04) and normal human serum (Normal 10), and tested negative control: sample diluent / binding buffer (DPBS), blank control: SMBs@QC_Apt+Luminal (detection background signal), positive control: C1QC protein standard (120μg / mL), and the results are as follows Figure 4 As shown. The aptamer sensor showed that the C1QC detected in tumor serum samples was significantly different from that in normal serum samples (P<<0.05), proving that the pan-cancer marker C1QC has clinical predictive value in NSCLC tumor detection. Benefiting from the capture of the functionalized aptamer magnetic nanocomposite and the signal amplification effect of the paired antibody, the chemical sensor with the aptamer / antibody sandwich structure showed extremely high sensitivity for the detection of C1QC in clinical serum samples, providing a rapid, high-throughput, effective and objective method for the prediction, molecular typing, malignancy grading and prognosis evaluation of C1QC.

[0130] In order to test the detection sensitivity of the novel sandwich ELAAS of aptamer / antibody, the concentration gradient of C1QC was from 0 to 60 μg / mL and the binding saturation curve was drawn at OD. The results are shown in Figure 5 As shown, the relative response unit showed a good linear relationship with the C1QC concentration in the range of 0 μg / mL to 10 μg / mL. Figure 6 As shown, y = 0.0249x + 0.1497, R 2=0.9901, where y is the OD relative response unit, and x is the gradient diluted C1QC. The detection limit LOD of this ELAAS for C1QC is 98 ng / mL, which enables our detection method to detect and quantify the content of C1QC in real samples. Figure 7 The colorimetric response photos of the detection system in the presence of different concentrations of C1QC are shown. The C1QC concentration gradient from 0 to 10 μg / mL shows a gradient colorimetric difference until the colorimetric signal is saturated at 20 to 60 μg / mL. Based on the feasibility of the new aptamer / antibody sandwich method ELAAS to diagnose C1QC in clinical serum samples, we studied the colorimetric response of ELAAS in 100-fold diluted human serum. The non-small cell lung cancer clinical sample NSCLC03 and the normal human serum sample Normal 16 / 24 were tested on the basis of the same sample loading, and then Figure 6 The standard curve was used to determine the content of C1QC in clinical samples. The results were as follows Figure 8 As shown in the figure, the C1QC content in normal human serum samples was significantly lower than that in clinical samples of non-small cell lung cancer (P<<0.05). This assay shows the application prospect of C1QC in clinical non-small cell lung cancer. The use of ELAAS to directly detect C1QC in real serum samples has both specificity and good response sensitivity.

[0131] The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein within the content, spirit and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention.

Claims

1. A method for detecting pan-cancer marker C1QC using an enzyme-linked antibody-aptamer sandwich method, using a functionalized aptamer magnetic nanomaterial as a capture probe, wherein the nucleotide sequence of the aptamer of the functionalized aptamer magnetic nanomaterial is SEQ ID NO: 1, characterized in that: The method comprises: a. Add the functionalized aptamer magnetic nanomaterials to the C1QC standard wells of different concentrations, rotate and mix, incubate for 10-30 min, and set them as standard wells; add the functionalized aptamer magnetic nanomaterials to the wells of the samples to be tested, rotate and mix, incubate for 10-30 min, and set them as sample wells; b. Separate the magnetic beads in the fishing standard well and the sample well by magnetic stand, discard the liquid, and do not wash; c. Add Anti-C1QC antibody working solution to each well, rotate to mix, and incubate for 10-30 min; d. Separate the magnetic beads in the fishing standard wells and the sample wells with a magnetic stand, discard the liquid, and wash with TBST; e. Add TMB-H2O2 substrate solution to each well, and add stop solution after color development for 5-10 minutes in the dark; f. Use a magnetic stand to separate the magnetic beads in the standard wells and the sample wells to be tested, transfer the supernatant to the ELISA plate and mix evenly, and use an ELISA reader to measure the absorbance value of each well at a wavelength of 400-500 nm.

2. The method according to claim 1, characterized in that The method comprises: a. Add the functionalized aptamer magnetic nanomaterials to the C1QC standard wells with different concentrations, rotate and mix, and incubate for 20 minutes to set as the standard wells; add the functionalized aptamer magnetic nanomaterials to the wells of the tested sample, rotate and mix, and incubate for 20 minutes to set as the wells of the tested sample; b. Separate the magnetic beads in the fishing standard well and the sample well by magnetic stand, discard the liquid, and do not wash; c. Add Anti-C1QC antibody working solution to each well, rotate to mix, and incubate for 20 min; d. Separate the magnetic beads in the fishing standard wells and the sample wells with a magnetic stand, discard the liquid, and wash with TBST; e. Add TMB-H2O2 substrate solution to each well, and add stop solution after color development for 5-10 minutes in the dark; f. Use a magnetic stand to separate the magnetic beads in the standard wells and the sample wells to be tested, transfer the supernatant to the ELISA plate and mix evenly, and measure the absorbance of each well at a wavelength of 450 nm using an ELISA reader.

3. A method for detecting a pan-cancer marker C1QC using a chemiluminescent aptamer sensor, using a functionalized aptamer magnetic nanomaterial as a capture probe, wherein the nucleotide sequence of the aptamer of the functionalized aptamer magnetic nanomaterial is SEQ ID NO: 1; characterized in that: The method comprises: i. Place the functionalized aptamer magnetic nanomaterial in a white chemiluminescent plate, then add the sample solution to be tested and react at room temperature for 10-30 min; ii. Remove the supernatant by magnetic separation, then add Santa Cruz HRP-modified C1QC protein antibody to the magnetic microspheres, and react at room temperature with constant temperature shaking for 20-40 min; iii. Remove the supernatant by magnetic separation to obtain magnetic microspheres, and wash with TBST; iv. Suspend the magnetic microspheres in the Luminal substrate solution, mix well, and measure the CL value in a chemiluminescent microplate detector within 5-10 min.

4. The method according to claim 3, characterized in that The method comprises: i. Place the functionalized aptamer magnetic nanomaterial in a white chemiluminescent plate, then add the sample solution to be tested and react at room temperature for 20 min; ii. Remove the supernatant by magnetic separation, then add Santa Cruz HRP-modified C1QC protein antibody to the magnetic microspheres, and react at room temperature with constant temperature shaking for 30 minutes; iii. Remove the supernatant by magnetic separation to obtain magnetic microspheres, and wash with TBST; iv. Suspend the magnetic microspheres in the Luminal substrate solution, mix well, and measure the CL value in a chemiluminescent microplate detector within 5 minutes.

5. The method according to any one of claims 1 to 4, characterized in that: The preparation method of the functionalized aptamer magnetic nanomaterial comprises: fully and evenly mixing a biotin aptamer and streptavidin magnetic beads, incubating at room temperature, retaining the supernatant, washing with DPBS to remove free biotin aptamers, adding a biotin blocker, incubating at room temperature, and washing with DPBS to obtain the functionalized aptamer magnetic nanomaterial; the nucleotide sequence of the biotin aptamer is SEQ ID NO:

1.

6. The method according to claim 5, characterized in that The biotin aptamer was diluted with DPBS to a target concentration of 400-600 nM and renatured by heating in a metal bath at 90-100°C for 8-15 min, followed by vigorous vortexing for 20-40 s and equilibration at room temperature for 2 h~3 h.

7. The method according to claim 6, characterized in that The biotin aptamer was diluted with DPBS to a target concentration of 500 nM and renatured by heating in a 95°C metal bath for 10 min, followed by vigorous vortexing for 30 s and equilibration at room temperature for 2 h to 3 h.

8. The method according to claim 6, characterized in that The denatured biotin aptamer and the streptavidin magnetic beads washed with DPBS were fully mixed; after incubation at room temperature for 40-50 minutes, the supernatant was retained; the free biotin aptamer was removed by washing with DPBS; after adding a biotin blocker, the beads were incubated at room temperature for 10-20 minutes to obtain a functionalized aptamer magnetic nanomaterial; the beads were washed with DPBS again to obtain the functionalized aptamer magnetic nanomaterial; the nucleotide sequence of the biotin aptamer is SEQ ID NO:

1.

9. The method according to claim 8, characterized in that The denatured biotin aptamer and the streptavidin magnetic beads washed with DPBS were fully mixed; after incubation at room temperature for 45 minutes, the supernatant was retained; the free biotin aptamer was removed by washing with DPBS; after adding a biotin blocker, the beads were incubated at room temperature for 15 minutes to obtain a functionalized aptamer magnetic nanomaterial; the beads were washed with DPBS again to obtain the functionalized aptamer magnetic nanomaterial; the nucleotide sequence of the biotin aptamer is SEQ ID NO:

1.

10. The method according to claim 5, characterized in that The streptavidin magnetic beads are obtained by washing, activating, coupling, blocking and purifying carboxyl-modified magnetic nanoparticles.

11. The method according to claim 10, characterized in that The washing comprises washing the carboxyl-modified magnetic nanoparticles with DPBS buffer; The activation is to mix equal volumes of prepared 8-15 mg / mL NHS and 8-15 mg / mL EDC, and add them to the carboxyl-modified magnetic nanoparticles dispersed in DPBS buffer after washing, so as to activate the carboxyl groups on the surface of the carboxyl-modified magnetic nanoparticles; 1000 μL of NHS and EDC are used for every 100 mg of carboxyl-modified magnetic nanoparticles; The coupling is to add the activated carboxyl-modified magnetic nanoparticles to streptavidin and incubate them on a room temperature rotating mixer to generate an aminocarboxyl reaction, so that the amino groups on the streptavidin and the carboxyl groups on the magnetic nanoparticles are dehydrated and condensed to form a covalent bond, thereby being fixed on the surface of the magnetic nanoparticles; 10 mg of streptavidin is used for every 100 mg of carboxyl-modified magnetic nanoparticles; The blocking is to add a mixed solution of 0.8-1.2 mol / L ethanolamine hydrochloride and 2-4 mol / L BSA to the coupled magnetic nanoparticles, and incubate on a rotary mixer at room temperature to block the excess binding sites on the surface of the magnetic nanoparticles that are not amino groups; for every 100 mg of carboxyl-modified magnetic nanoparticles, 200 μL of a mixed solution of 1 mol / L ethanolamine hydrochloride and 3 mg / mL BSA is used; The purification is carried out on a magnetic separator, by fishing the blocked magnetic nanoparticles and washing with DPBST.

12. The method according to claim 11, characterized in that The washing comprises washing the carboxyl-modified magnetic nanoparticles with DPBS buffer; The activation is to mix equal volumes of prepared 10 mg / mL NHS and 10 mg / mL EDC, and add them to the carboxyl-modified magnetic nanoparticles dispersed in DPBS buffer after washing, so as to activate the carboxyl groups on the surface of the carboxyl-modified magnetic nanoparticles; 1000 μL of NHS and EDC are used for every 100 mg of carboxyl-modified magnetic nanoparticles; The coupling is to add the activated carboxyl-modified magnetic nanoparticles to streptavidin and incubate them on a room temperature rotating mixer to generate an aminocarboxyl reaction, so that the amino groups on the streptavidin and the carboxyl groups on the magnetic nanoparticles are dehydrated and condensed to form a covalent bond, thereby being fixed on the surface of the magnetic nanoparticles; 10 mg of streptavidin is used for every 100 mg of carboxyl-modified magnetic nanoparticles; The blocking step is to add a mixture of 1 mol / L ethanolamine hydrochloride and 3 mg / mL BSA to the coupled magnetic nanoparticles, and incubate on a rotary mixer at room temperature to block the excess binding sites on the surface of the magnetic nanoparticles that are not amino groups; for every 100 mg of carboxyl-modified magnetic nanoparticles, 200 μL of a mixture of 1 mol / L ethanolamine hydrochloride and 3 mg / mL BSA is used; The purification is carried out on a magnetic separator, by fishing the blocked magnetic nanoparticles and washing with DPBST.

Images