A dCAPS molecular marker for identifying fructose content of apple fruit and application thereof
By constructing a high-density genetic map and developing dCAPS molecular markers, the fructose content of apples was identified using agarose gel electrophoresis. This solved the problem of time-consuming and laborious selection of fruit sugar and acid content in traditional apple breeding, and achieved efficient and accurate fructose content identification and accelerated the breeding process.
Patent Information
- Application Number
- CN202410506473.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-25
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2044-04-25
AI Technical Summary
Traditional apple breeding relies on phenotypic selection to determine the sugar and acid content of the fruit. This method is highly susceptible to environmental influences, time-consuming, and labor-intensive, making it difficult to achieve efficient and accurate variety selection.
We constructed a high-density genetic linkage map, combined it with whole-genome resequencing, and explored key genes regulating fruit sugar and acid content. We developed dCAPS molecular markers, used agarose gel electrophoresis to identify apple fructose content, and distinguished different genotypes by specific primers and restriction endonuclease digestion.
It enables rapid and accurate identification of apple fructose content, reducing field workload, shortening the breeding cycle, and improving breeding efficiency and product quality.
Smart Images

Figure CN118406787B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development for fruit quality traits and molecular marker-assisted breeding technology, specifically involving SNP and dCAPS molecular markers closely linked to fructose content in apple fruits and their applications. Background Technology
[0002] Organic acids and soluble sugars are important components of the sensory quality of ripe fruit. The concentrations of soluble sugars and organic acids in ripe fruit depend on the balance between biosynthesis, degradation, and vacuolar storage. Furthermore, different soluble sugar components, such as sucrose, fructose, and glucose, impart different sweetnesses to apples. Similarly, the acidity of citric acid, malic acid, and tartaric acid varies considerably. Therefore, the flavor of fruit depends on the types, content, and relative proportions of soluble sugars and organic acids; maintaining a relative balance of sugar and acid content is crucial for cultivating an ideal apple variety.
[0003] The sugar and acid content of fruit is a complex quality trait, easily influenced by genetics, hormones, external environment, and human cultivation practices. Current research on the types and contents of sugar and acid in existing apple varieties shows that fructose is the main soluble sugar in apples, accounting for approximately 44-75% of the total sugar, while malic acid is the main organic acid, accounting for about 90% of the total organic acid content. Traditional breeding methods for selecting apples based on sugar and acid content mainly rely on phenotypic selection. The accuracy of these selections is greatly affected by the environment, and the long growth cycle of apples makes traditional methods time-consuming and labor-intensive. Therefore, constructing high-density genetic maps, combining them with years of fruit phenotypic data, and accurately mapping QTLs for fruit traits to identify key genes regulating target traits and their linked SNP loci, combined with marker-assisted breeding, can significantly improve breeder efficiency, reduce field workload, lower breeding costs, further improve product quality, and promote the development of related industries.
[0004] dCAPS markers are molecular markers derived from CAPS (Cellular Enzyme Amplification Polymorphic Sequence) markers. If the SNP marker is located at a specific restriction enzyme site, samples with different SNPs at that site can be distinguished by digesting the amplified product; this is the CAPS marker. If there is no restriction enzyme site at the SNP, a mismatched sequence can be introduced into the amplification primers (since primers are often designed to be very long, exceeding 30 bp, a few mismatches will not affect PCR amplification). This allows the product to bind to the SNP site after PCR amplification, introducing a new restriction endonuclease site, which can also lead to the digestion of the mismatched primers, thereby distinguishing genotypes; this is the dCAPS marker.
[0005] Apple (Malus × domesticica) is ecologically adaptable and widely cultivated, making it an important economic crop. my country ranks first in the world in both apple cultivation area and yield. Fruit sugar and acid content is a crucial quality trait of apples, influencing their economic value and being key to industry upgrading. This invention utilizes whole-genome resequencing to construct a high-density genetic linkage map using F1 hybrid segregating populations of 'Gala' (Malus domestica Borkh) and 'Xia Hongrou' (Malus sieversii). Combined with two years of agronomic trait data, QTL mapping for fruit sugar and acid content was performed, identifying key genes involved in the accumulation and regulation of sugar and acid in apple pulp. Furthermore, dCAPS molecular markers were developed, providing an important technical and material foundation for molecular design breeding of apples with efficient resource utilization. Summary of the Invention
[0006] The purpose of this invention is to propose a dCAPS molecular marker for identifying apple fructose content and its application. Based on the haplotype sequence of the target gene obtained by QTL mapping, a dCAPS molecular marker for identifying apple fructose content is obtained. Furthermore, this marker can clearly show differences using agarose gel electrophoresis, which is convenient for screening apple varieties with different sugar and acid contents.
[0007] The technical solution of this invention is as follows:
[0008] In a first aspect, this invention provides a gene, MdNADP-ME, that regulates the fructose and malic acid content of apple fruit. The results of a comparison of two haplotype sequences of the MdNADP-ME promoter in cultivated apple ('Gala') and wild apple ('Summer Red Flesh') are as follows: Figure 1 As shown, multiple single nucleotide polymorphisms (SNPs) were identified in the promoter region of the MdNADP-ME gene in cultivated and wild-type apples.
[0009] In a second aspect, the present invention provides an SNP molecular marker for apple fructose content, wherein the SNP molecular marker is located in the promoter region of the MdNADP-ME gene, specifically at the 15,484,856th base of the full-length sequence of chromosome 15 of the apple genome, and the SNP variation site is C / A.
[0010] A third aspect of the present invention provides a dCAPS molecular marker related to the fructose content of apple pulp, wherein the dCAPS molecular marker comprises an SNP site at position 15,484,856 of the full-length sequence of chromosome 15 of the apple genome GDDH13 v1.1, and the variant site of the SNP is C / A; the nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO:1: 5'-TCAATCACGCAAGTACTCTAAATTACTATTTGAAAAATTTTATTTAAA TTCATGTAACTTCTTTTTACACCTACTTAAATTTTAAATATTAATTGTCATT TTCACATGATTGTATAATTACTATTAAGCATAAAATAAAATTAATAATAAA ACTCAAATTTCTTAATAAATCCACCCACTATGATTAAACC A / C TA G CATCTCTCTTTATTTATCCATA-3'. The underlined G is the mutated base introduced by the primer, C is the reference genome and the corresponding base of 'Gala' at this SNP site, and A is the mutated base of 'Xia Hongrou' at this SNP site.
[0011] The primer sequences are as follows: SEQ ID NO:2 for the forward primer and SEQ ID NO:3 for the reverse primer.
[0012] Forward primer dCAPS-F: 5'-TCAATCACGCAAGTACTCTAAATTA-3' (SEQ ID NO:2)
[0013] Reverse primer dCAPS-R: 5'-TATGGATAAATAAAGAGAGATGCTA-3' (SEQ ID NO:3)
[0014] The primers were used to specifically amplify the genomic DNA of the apple samples. The resulting PCR product was 217 bp in size. After digestion with the restriction endonuclease FspBI (C / TAG restriction site), specific bands were obtained. If the digestion products were two fragments of 192 bp and 25 bp, the apple genotype was homozygous CC, indicating a high fructose content. If the digestion products were three fragments of 217 bp, 192 bp, and 25 bp, the apple genotype was heterozygous AC, indicating a low fructose content. If the digestion product was a single fragment of 217 bp, the apple genotype was homozygous AA.
[0015] This invention further protects a method for identifying the fructose content of apples, comprising the following steps:
[0016] 1) Extract genomic DNA from the apples to be tested;
[0017] 2) Amplify genomic DNA using the specific primers described above;
[0018] 3) The amplification product was digested with the restriction endonuclease FspBI;
[0019] 4) Electrophoresis: If the enzyme digestion product contains only two fragments, 192bp and 25bp, the apple being tested is a material with high fructose content and a homozygous CC genotype; if the enzyme digestion product contains three fragments, 217bp, 192bp and 25bp, the apple being tested is a material with low fructose content and a heterozygous AC genotype; if the enzyme digestion product contains only one fragment, 217bp, the apple being tested is a homozygous AA genotype.
[0020] Further, in step 2), the PCR reaction system is: 100–200 ng / μL apple genomic DNA, 1.0 μL, 2× Hieff 12.5 μL of PlusPCRMasterMix, 1 μL each of dCAPS forward and reverse primers, and 9.5 μL of ddH2O.
[0021] The PCR program was as follows: 94℃ pre-denaturation for 5 minutes; 94℃ for 30 seconds (denaturation), 60℃ for 30 seconds (annealing), 72℃ for 60 seconds / 1 kb (extension) for 30 cycles; and finally 72℃ for 10 minutes for extension.
[0022] The present invention has the following beneficial effects:
[0023] This invention utilizes SNP information related to fructose content in apple pulp from the promoter region of the MdNADP-ME gene to design a pair of specific primers. DNA fragments are amplified using these primers, and the PCR products are then digested with restriction endonucleases. The digested fragments are separated by agarose gel electrophoresis to identify different apple materials. A dCAPS molecular marker has been developed, which can be used to identify the important quality trait of fructose content in apple fruits during the seedling stage. This marker method not only saves on field breeding costs but also shortens the breeding cycle and accelerates the apple breeding process. Attached Figure Description
[0024] Figure 1 Comparison of MdNADP-ME promoter sequences in 'Gala', 'Xia Hongrou' and the reference genome 'Jin Guan';
[0025] Figure 2Analysis of fructose and malic acid content in offspring of hybrid populations with different genotypes at the MEp-799(A / C) locus;
[0026] Figure 3 dCAPS markers distinguish between two apple genotypes;
[0027] in Figure 3 a is a schematic diagram of the dCAPS principle. Figure 3 b represents the specific band obtained by restriction endonuclease;
[0028] Figure 4 Analysis of fructose and malic acid content in cultivars with different genotypes at the MEp-799(A / C) locus;
[0029] Figure 5 Agarose gel electrophoresis of dCAPS molecular marker digestion products from different genotype apple cultivars. Detailed Implementation
[0030] Example 1: Screening of SNP sites related to sugar and acid content in apple fruit and development of dCAPS molecular markers
[0031] 1) Materials
[0032] This invention uses mature fruits from the F1 generation of the hybrid 'Gala' and 'Xia Hongrou', with 92 and 122 plants respectively over two years.
[0033] 2) Fruit phenotypic determination
[0034] The experiment to determine the sugar and acid content of the fruit was conducted in Xuzhou in 2021 and 2022. Six whole, disease-free fruits at maturity were randomly selected from each offspring. The fruits were mixed evenly, and 0.5 g of the pulp sample was ground into powder. The pulp was extracted with 80% ethanol, freeze-dried under vacuum, and then dissolved in 10 mL of ultrapure water. The mixture was filtered through a 0.22 μm aqueous filter. The filtrate was placed in a 2 mL sample vial, and the sugar and acid content of the fruit was determined by high performance liquid chromatography. Three biological replicates were performed for each offspring, and the average value was taken.
[0035] 3) High-quality SNP site screening
[0036] SNP variant detection in the population was performed using the UnifiedGenotyper function of GATK software (https: / / www.broadinstitute.org / gatk / ). For the original VCF file, a hard filter was first applied using GATK software with the following parameters: QD < 2.0 || MQ < 40.0 || FS > 60.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0. Loci with a minor allele frequency (MAF) of less than 5% were then removed using VCFtools (v0.1.16) software for subsequent analysis. The specific parameters were: --max-missing0.9, --minQ20, --min-alleles2, --max-alleles2, --minDP5, --maxDP1000, --maf0.05. Only biallelic SNPs were retained for further analysis to reduce the complexity of the analysis.
[0037] Based on the input VCF, the segregation type of the marker is determined according to the genotypes of the parents, and then the offspring are genotyped. A Python script is written to filter the obtained genotype list as follows: 1) remove loci with a genotyping ratio of less than 30%; 2) remove loci with a heterozygous ratio of more than 10%; 3) perform a chi-square test on the genotype ratio of the marker loci according to the theoretical comparison, and loci with a p-value less than 0.001 are considered as severely segregating loci and are removed.
[0038] 4) Sequence analysis of the promoter of the glucose-acid content regulating gene MdNADP-ME
[0039] Four 1,500 bp upstream of the start codon ATG of the parental MdNADP-ME promoter haplotypes were cloned and named Gala-1 / 2 and XHR-1 / 2, respectively. These were compared with the 'Golden Crown' reference genome. NEWPlace was used to predict cis-regulatory elements in different haplotype sequences, revealing a unique cis-regulatory element, the MYB1AT element (WACCA), only present in the XHR-1 haplotype. Plant TFDB transcription factor binding prediction for the promoter haplotype sequences also showed a unique MYB family transcription factor at this site only in the XHR-1 haplotype (Table 1). The SNP causing this binding site difference is located 799 bp upstream of the MdNADP-ME gene ATG; it is homozygous "GG(CC)" in 'Gala' and heterozygous "GT(CA)" in 'Xia Hongrou', and is named MEp-799(C / A).
[0040] Table 1. Predicted cis-regulatory elements and transcription factor binding sites in the MdNADP-ME promoter regions of 'Gala' and 'Xia Hongrou'
[0041]
[0042]
[0043] 5) Analysis of the relationship between the MdNADP-ME promoter SNP site MEp-799 (A / C) variation and fructose and malic acid content.
[0044] Individuals were randomly selected from the hybrid progeny (C / C, 21 individuals; A / C, 21 individuals), and the fructose and malic acid contents of the selected individuals were analyzed. The results showed that in the hybrid population progeny, the fructose content of the A / C genotype was lower than that of the C / C genotype, and the malic acid content of the A / C genotype was higher than that of the C / C genotype (see...). Figure 2 ).
[0045] 6) Development of dCAPS molecular markers
[0046] Primers for the flanking sides of SNPs were designed using the dCAPSFinder2.0 online website (http: / / helix.wustl.edu / dcaps / dcaps.html) and 2×Hieff primers were used. PCR amplification was performed using PlusPCRMasterMix (Yisheng, Shanghai, China). Sanger sequencing was performed on the F1 progeny PCR amplicon using the Sanger sequencing platform. The purified PCR products were verified by enzyme digestion with FspBI restriction enzyme (Thermo Fisher Scientific, USA) (see [link to documentation]). Figure 3 ).
[0047] Example 2: Application of dCAPS molecular markers related to sugar and acid content in apple fruit
[0048] First, 20 cultivated apple germplasm materials with varying sugar and acid contents were selected (see Table 2). In 2023, the sugar and acid contents of mature fruits were determined in Nanjing. Five undamaged, intact fruits were selected from each germplasm, with three biological replicates per germplasm. The average value was taken as the result, and the phenotypic data of sugar and acid content in the pulp were finally obtained (see Table 2). Figure 4 ).
[0049] Table 220 Apple Cultivars
[0050]
[0051] The specific application method for identifying the sugar and acid content of apple fruits using dCAPS molecular markers is as follows: Young leaves from each line were collected, and genomic DNA was extracted using the CTAB method. The designed dCAPS primers were used to amplify the genomic DNA samples from the above populations. The PCR reaction system was: 1.0 μL of 100–200 ng / μL apple genomic DNA, 2× Hieff The PCR MasterMix was prepared in 12.5 μL, with 1 μL each of dCAPS forward and reverse primers and 9.5 μL of ddH2O. The PCR program was as follows: 94℃ pre-denaturation for 5 minutes; 94℃ for 30 seconds (denaturation), 60℃ for 30 seconds (annealing), 72℃ for 60 seconds / 1 kb (extension), for 30 cycles; and finally, 72℃ for 10 minutes for extension.
[0052] The PCR-purified product was digested with FspB I restriction enzyme (Thermo Fisher Scientific, USA), and specific bands were obtained by 3% agarose gel electrophoresis (see [link]). Figure 5 Of the 20 cultivated varieties, 7 had the A / C genotype and 13 had the C / C genotype. Fructose content analysis showed that individuals with the "A / C" genotype had lower fructose content, while individuals with the "C / C" genotype had higher fructose content (p≤0.05) (see...). Figure 4 a). However, there was no significant difference in malic acid content between the two genotypes (see [reference needed]). Figure 4 b). These results demonstrate a high correlation between fruit fructose content and the identified marker, suggesting that the marker can indicate the selection of fruit sugar and acid content.
Claims
1. A dCAPS molecular marker associated with fructose content in apple pulp, characterized by: The dCAPS molecular marker contains the SNP site at position 15,484,856 of the full-length sequence of chromosome 15 of the apple genome GDDH13 v1.1, with the SNP variant being C / A; the nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO:
1.
2. The application of the primer pair of the dCAPS molecular marker as described in claim 1 in the identification of fructose content in apple pulp, characterized in that, The dCAPS molecular marker primer pair was used to specifically amplify the genomic DNA of the apple to be tested. The obtained PCR amplification product was 217 bp in size. After digestion with restriction endonuclease FspBI, three specific bands were obtained. If the obtained digestion products were two fragments of 192 bp and 25 bp, the genotype of the apple material to be tested was homozygous CC, which is a material with high fructose content. If the obtained digestion products were three fragments of 217 bp, 192 bp and 25 bp, the genotype of the apple material to be tested was heterozygous AC, which is a material with low fructose content. If the obtained digestion product was a single fragment of 217 bp, the genotype of the apple material to be tested was homozygous AA. The primer pair consisted of a specific forward primer and a specific reverse primer. The specific forward primer is shown in SEQ ID NO:2; the specific reverse primer is shown in SEQ ID NO:
3.
3. A method for determining the fructose content of apples during the seedling stage, characterized in that, Includes the following steps: (1) Extract genomic DNA from the apple plants to be tested; (2) Using the genomic DNA of apple plants as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; (3) The amplification product was digested with the restriction endonuclease FspB I; (4) Electrophoresis: If the enzyme digestion product contains only two fragments of 192 bp and 25 bp, the genotype of the apple material to be tested is homozygous GG, which is a material with high fructose content; if the enzyme digestion product contains three fragments of 217 bp, 192 bp and 25 bp, the genotype of the apple material to be tested is heterozygous TG, which is a material with low fructose content; if the enzyme digestion product contains only one fragment of 217 bp, the genotype of the apple material to be tested is homozygous TT.