A method for breeding a new all-female germplasm of tamiichthys mica with cold resistance

Abstract

The application discloses a new-gender cultivation method of full-female Takifugu obscurus with cold resistance, and belongs to the field of aquaculture. The cultivation method of the application is characterized in that: the pseudo-male Takifugu obscurus is obtained by hormone-induced sex reversal of Takifugu obscurus combined with gender molecular markers, the full-female Takifugu obscurus is obtained by mating the pseudo-male Takifugu obscurus with normal female Takifugu obscurus, and finally, the individuals with cold resistance are screened in the full-female Takifugu obscurus by using cold resistance molecular markers, so that the new gender with cold resistance is obtained. The application can breed the fast-growing and cold-resistant full-female Takifugu obscurus new gender in batches in a short time by exploring the gender and cold resistance SNP molecular markers of Takifugu obscurus and comprehensively utilizing the two key elements. In addition, the full-female Takifugu obscurus with cold resistance obtained by the application provides an excellent female resource for the cultivation of new varieties of Takifugu obscurus, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of aquatic animal breeding, and more particularly relates to a new germplasm cultivation method of all-female Takifugu obscurus with cold resistance. BACKGROUND

[0002] As a traditional and precious edible fish in China, Takifugu obscurus, which is one of the three fresh fishes in the Yangtze River, has always conquered a large number of diners with its delicate and smooth taste. In recent years, with the continuous expansion of the breeding scale of Takifugu obscurus in China, the demand for fry is increasing. However, the related enterprises of Takifugu obscurus breeding and fry breeding do not pay attention to the update and breeding of parents, which causes the aging of parents, inbreeding and germplasm degradation. After several generations of breeding, the growth of fry is slow, the survival rate is low, and the feed utilization efficiency is low. In addition, the optimal growth temperature range of Takifugu obscurus is 23-32℃, the feeding rhythm decreases at 19℃, and death due to frostbite occurs at 13℃. At present, the minimum temperature tolerance of the new variety of Takifugu obscurus "Zhongyang No. 1" (national approval GS-01-003-2018) has reached 7-8 degrees, but for the expansion of the breeding area of Takifugu obscurus, the reduction of overwintering time and the improvement of economic benefit, the cold resistance needs to be further strengthened. Therefore, it is particularly important to cultivate new germplasm of Takifugu obscurus with fast growth and stronger cold resistance.

[0003] Among the fish of the genus Takifugu, Takifugu obscurus has obvious sexual dimorphism, that is, the growth rate of female individuals is faster than that of male individuals, and the female individuals that have reached sexual maturity are larger, with body weight and body length exceeding those of male individuals, and have higher feed conversion rate. However, the sex of Takifugu obscurus cannot be distinguished by appearance before sexual maturity, and only after sexual maturity, the fish can be identified by observing the sperm or eggs by pressing the abdominal part of the fish. This method is time-consuming and high in fish breeding cost. Another method is to dissect the gonad and observe the gonadal tissue section to identify the sex at the juvenile stage, but it causes irreversible damage to the fish and is generally only used for laboratory research. Both methods are difficult to meet the actual production needs. Therefore, developing a molecular marker for identifying the sex of Takifugu obscurus and cultivating all-female Takifugu obscurus can solve the problem of reduced growth rate of Takifugu obscurus. SUMMARY

[0004] The purpose of the present application is to provide a new germplasm cultivation method of all-female Takifugu obscurus with fast growth and 2-3℃ higher cold resistance temperature than the existing national approval cold-resistant Takifugu obscurus "Zhongyang No. 1" new variety.

[0005] The technical scheme of the present application is as follows:

[0006] (1) By screening sex-reversed pufferfish larvae through sex molecular markers, pseudo-male pufferfish were obtained and mated with normal female pufferfish to obtain all-female pufferfish.

[0007] (2) Individuals with cold-resistant traits are screened from the all-female dark-spotted pufferfish obtained in step (1) using cold-resistant trait molecular markers; the SNP site base sequence of the cold-resistant trait molecular marker is shown in SEQ ID NO.2. When a 150bp band is amplified by PCR and the genotype is detected as GG, it is an all-female cold-resistant dark-spotted pufferfish.

[0008] In step (1), the sex reversal is achieved through hormone induction.

[0009] The hormone induction method involves adding 17α-methyltestosterone to the feed.

[0010] The dosage of 17α-methyltestosterone is 30-60 mg / L, used to soak rotifers for feeding yolk sac larvae of 15-day-old pufferfish; 30-60 mg / L of Artemia for feeding 15-40-day-old pufferfish larvae; and 30-60 μg / g added to feed for feeding 40-100-day-old pufferfish.

[0011] In step (1), the SNP site base sequence of the sex molecular marker is shown in SEQ ID NO.1. When the PCR amplification result is two bands of 250bp and 330bp, the individual is a normal female fish or a pseudo-male fish; when the PCR amplification result is a 330bp band, the individual is a normal male fish.

[0012] The primer sequences used for PCR amplification are shown in SEQ ID NO.3-4.

[0013] The PCR amplification procedure was as follows: Step 1: 95℃ pre-denaturation for 3 minutes; Step 2: 95℃ denaturation for 30 seconds; Step 3: 51.5℃ annealing for 30 seconds; Step 4: 72℃ extension for 30 seconds; Step 2-4 were repeated 35 times; Step 5: 72℃ extension for 5 minutes.

[0014] In step (1), artificial spawning is induced when the pseudo-male fish mates with a normal female dark-spotted pufferfish. Specifically, the female fish is injected for the first time with HCG 180U / kg + ovulation induction LRH-A2 0.8μg / kg, and the dosage of the pseudo-male fish is halved. 24 hours later, the female fish is injected with HCG 360U / kg + ovulation induction LRH-A2 1.6μg / kg, and the dosage of the pseudo-male fish is halved.

[0015] The primer sequences used for PCR amplification in step (2) are shown in SEQ ID NO.5-6.

[0016] Wherein, the program used in step (3) is step1 94℃ pre-denaturation for 4 minutes, step2 94℃ denaturation for 30 seconds, step3 51.5℃ annealing for 1 minute, step4 72℃ extension for 40 seconds, step2-4 cycle 30 times, step5 72℃ extension for 10 minutes.

[0017] Beneficial effects: compared with the prior art, the application has the following outstanding advantages: the sex marker and cold tolerance trait marker of the developed dark striped puffer can accurately determine the genetic sex and cold resistance ability, has the characteristics of fast speed, simple operation and low cost, and in actual operation, only a small amount of tail fin tissue is needed to extract DNA to batch identify the genetic sex and cold resistance ability of fish, high-efficiency screening of individuals with excellent traits can speed up the breeding process of new varieties of dark striped puffer with fast growth and cold resistance, improve breeding efficiency and trait improvement progress, thereby improve the coverage rate of breeding of dark striped puffer, improve the industrial competitiveness and promote the stable and sustainable development of the industry. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is the technical roadmap of the application.

[0019] Figure 2 is the cold tolerance SNP sequencing peak chart.

[0020] Figure 3 is the dark striped puffer genetic sex identification chart.

[0021] Figure 4 is the full female cold-resistant dark striped puffer and ordinary dark striped puffer comparison chart.

[0022] Figure 5 is the cold resistance ability experiment chart of full female cold-resistant dark striped puffer. DETAILED DESCRIPTION

[0023] The technical solutions of the application will be further described below in combination with the drawings.

[0024] Example 1: A method for breeding a full female new variety of dark striped puffer with cold resistance traits

[0025] (1) Hormone-induced sex reversal of dark striped puffer larvae:

[0026] Hormone induction method: the 15-day-old T. nudus larvae were fed with rotifers, and the rotifers were collected and soaked in 17α-methyltestosterone with a concentration of 30 mg / L for 1 hour before feeding. The 15-40-day-old larvae were fed with specially prepared Artemia nauplii. The preparation method of Artemia nauplii was as follows: 1.5% saline was prepared, and Artemia eggs were hatched in the saline at 25℃ under light conditions. After 1-2 days, the nauplii were transferred to 17α-methyltestosterone with a concentration of 30 mg / L for 1 hour before feeding. After 40 days, 17α-methyltestosterone was mixed in the feed for feeding. After 100 days, the addition was stopped, and the conventional feeding mode was used. The preparation method and dosage were as follows: a certain amount of powder was dissolved in pure ethanol, and when used, it was mixed with herring meal and water to form a dough. The concentration of 17α-methyltestosterone in the feed dough was 30 μg / g. The feed dough was placed in a cool and ventilated place until the ethanol evaporated, and then fed. The feed was fed twice a day in the morning and afternoon. After 100 days, the gender was detected by gender molecular markers to facilitate the statistical incidence of sex reversal in the later stage. After two years, the individuals with sex gland development to the end of phase VI (i.e., the cloaca could flow reproductive fluid) were captured during the breeding season. The cloaca was observed for whether it could flow sperm by professional method, and the genetic sex was detected by gender molecular markers to select pseudo-male fish (genetic sex was female, and the individual showed physiological performance as male) for standby.

[0027] Development of the above-mentioned gender molecular markers:

[0028] The SNP site for identifying the genetic sex of T. obscurus was obtained by genome analysis of male and female individuals in T. obscurus population (GenBank accession number: PRJNA449558), which was used to determine the genetic sex of broodstock in later stage. The base sequence of the SNP site is shown in SEQ ID NO. 1 (CGTTCTTTCCTGGAGGAGAAGCGGCGTCTACTATCTGCCCTGCTGCTGAGGGAG ATCTGGATGTGCTGCTCTGATTTCAGTCATCTAACGGTGGGCAGGGTGTGAAGGTTGTGTGTAACACGCACGACATTTCCCCCATAGTTTGTTTTTCGGATCCTGTTTACGGGCGGTGATGCTCCTCCACGGATTCAGTTGCCATATGATGCTGAGCTGGCCGCCAATGTCTCCATAAAAAGCCTCATTTTGTTAGAGTGTGACATGGTCATGACACCTTACAAATATAAAAACACTGGTGTATTGCCCATTTCTTCCTCCGGAGGGGGAATTTTAGACTTTTCTCGTTCAGAAAAAGACATTAATTTGGAGAGAGAGCGAGGTATTGGCCTCTTCTGCTTACCCTCCAACAGAAGACGATGCCGGAACCTCATCAGGACGAGGGCTGCAGATCACTACCACTGCAGACCAGATAGTCTGAATTATGGAATAAGTATCCCCCATTCCTACCTCCCAGGACGACATACGTTCTCCCTCTTTACAGTTATTTAATAA). The sex marker PCR primer pair of T. obscurus was designed according to the SNP site of T. obscurus genetic sex, and the base sequences of the primer pair are as follows: SEQ ID NO. 3 F (5'-3'): TCCTGGAGACGCTTGTCG, SEQ ID NO. 4 R (5'-3'): AGTGTGTCGTGATGTAAGG, which base pairs with the DNA molecule of SEQ ID NO. 1.The specific detection steps are: cutting a small amount of fish fin tissue to extract DNA, the PCR amplification reaction system is: 2x Rapid Taq Master Mix 10 μL, 0.8 μL of upper and lower primers, 7.4 μL of sterile water, 1 μL of template DNA, and the amplification procedure steps are: step 1 95°C pre-denaturation for 3 minutes, step 2 95°C denaturation for 30 seconds, step 3 51.5°C annealing for 30 seconds, step 4 72°C extension for 30 seconds, step 2-4 cycle 35 times, step 5 72°C extension for 5 minutes, after gel electrophoresis of the amplification product, the individual showing two bands is a normal female fish or a genotypic female, i.e. a pseudo male fish, and the individual showing one band is a genotypic male, i.e. a normal male fish; the results are shown as follows. Figure 3 As shown in the figure.

[0029] (2) The pseudo male fish (XX♂) of Takifugu obscurus obtained by screening through the gender molecular marker is mated with the normal female Takifugu obscurus (XX♀) to obtain all-female Takifugu obscurus:

[0030] The suitable pseudo male fish 5 tails (genetic sex is female, and the individual with physiological performance as male) selected in step (1) are artificially induced to spawn and inseminated with 5 normal female fish, the fertilized eggs are hatched by constant pressure water supply and flowing water oxygenation, the constant water temperature is 25-28°C, and all-female Takifugu obscurus fry can be obtained after the larvae are hatched, and a total of 143 larvae are obtained for subsequent experiments. The induced spawning drugs and doses are as follows: the female fish is injected with human chorionic gonadotropin HCG (Ningbo Second Hormone Factory) 180 U / kg + ovulation-promoting LRH-A2 (Ningbo Second Hormone Factory) 0.8 μg / kg for the first time, and the pseudo male fish is injected with half the dose; the parent fish is injected for the second time after 24 hours, the female fish is injected with HCG 360 U / kg + LRH-A2 1.6 μg / kg, and the pseudo male fish is injected with half the dose.

[0031] (3) The molecular marker of cold resistance is used to screen individuals with cold resistance traits in all-female Takifugu obscurus:

[0032] Development of cold resistance trait marker:

[0033] The population cooling experiment of Takifugu obscurus was carried out. The Takifugu obscurus used in the experiment came from Nantong Zhongyang Group Co., Ltd. in Jiangsu Province and was cultured in a pond. The feeding time, amount and location were the same in the pond. Before the low temperature stress experiment, the fish was cultured in a circulating system for one week. The low temperature stress experiment was first controlled by the culture system, and the water temperature was reduced by 1℃ per hour. When the water temperature reached 13℃, the cooling rate was slowed down, and we continued to cool by adding ice blocks in the circulating system. The water temperature was reduced from 13℃ to 6.8℃, which took 5.5 hours. The intolerance of Takifugu obscurus individuals to low temperature was judged by their loss of balance on the water bottom, and the time and imbalance temperature required for each fish to lose balance were recorded. The tail fin of Takifugu obscurus was cut off about 1 cm, and the genomic DNA in the tail fin tissue was extracted. Multiple ordinary PCR primers were designed, including primer base pair sequence as follows: SEQ ID NO. 5F (5'-3'): AATCGCTCTGAAGGACAAT, SEQ ID NO. 6R (5'-3'): CAGCCGTGTTTTACTTGAG, and amplification was carried out. The amplification procedure steps were as follows: step1 94℃ pre-denaturation for 4 minutes, step2 94℃ denaturation for 30 seconds, step3 51.5℃ annealing for 1 minute, step4 72℃ extension for 40 seconds, step2-4 cycle 30 times, step5 72℃ extension for 10 minutes, agarose gel electrophoresis detection, and the bright and single band was selected for bidirectional sequencing according to the peak graph of sequencing result Figure 2), the single peak or double peak at the single base can be determined by the peak diagram to determine the genotype of the individual: single peak is heterozygous, double peak is homozygous. The double peak is the potential target site, and the site is verified by fluorescence quantitative PCR and polymorphism analysis. According to the typing results of the site, the genotype frequency and gene frequency are counted for correlation analysis, and the SNP site of the cold tolerance trait of the T. nudus is obtained, and the base sequence is shown in SEQ ID NO. 2 (ACAAAAGTGACATTACGCTGCTTTTAAACCCTGACTGTTGGAAAATAAAGACATTTGTTGCCTTTTATCTGGAAAATTCTGATAATCTTACTGCGGCTCAAAGTTAAAAATCCTGCAACACATATTTATAAAGGCTTTGAAACACTAGAAAGGAGCTCTTCGTCCCAGAACTGCCTTCTTAATCGCTCTGAAGGACAATTAACTCTTGACCTAAAATAATTGTATTATTACAAGGTTCAACTTGCCTT[G / C]GCGGCCCTTAAATTTGGGCCCCGCGGCAGCAAAAGTCGCCCGTGAAAGACGACGCTGTAGCTTTTTCTGCAATCAGACTTTGTTTTTCTTGACACCTTTTTCTGTGTTGACACATTTTTGTATTTTATTTATTTTTTTCAAACGTCAGCTCAAGTAAAACACGGCTGCGCGTCAGCATTAAGGGGGAATATTTAGAAAGGGTATTAGTCTGCTGGTGCCAGATTACCCCTTACAGCTGGGGCAATTTGATA), and SEQ ID NO. 5 and SEQ ID NO. 6 are used as the SNP site of the cold tolerance trait of the T. nudus to screen the individual of the cold tolerance trait of the T. nudus;

[0034] The specific operation of screening individuals with cold tolerance is that a small amount of fish fin tissue is cut to extract DNA, and the PCR amplification reaction system is as follows: 2x Taq Plus Master Mix II 10 μL, 1 μL of each of the upper and lower primers, 6 μL of sterilized water, and 2 μL of template DNA, and the amplification procedure steps are as follows: step 1, 94°C pre-denaturation for 4 minutes, step 2, 94°C denaturation for 30 seconds, step 3, 51.5°C annealing for 1 minute, step 4, 72°C extension for 40 seconds, step 2-4, 30 times of cycles, step 5, 72°C extension for 10 minutes, after gel electrophoresis of the amplification product, the bright and clear band is cut, gene sequencing is performed, and the 250-251 positions of SEQ ID NO. 2 are GG, that is, the cold-tolerant female fish. The correlation analysis of the SNP site and the cold tolerance of all the fry is shown in Table 1.

[0035] Table 1 Correlation analysis of the SNP site of T. nudus and the cold tolerance

[0036]

[0037] The cold-tolerant female fish with the genotype GG is bred, and ordinary T. nudus (Zhongyang No. 1) is bred, each for 30 tails, and the breeding conditions are that 4-5% of the powder is fed to the fish each time, and the fish is fed twice a day. The body length and weight of the 50-100 day fish are measured, and the results are shown in Table 2.

[0038] Table 2 Comparison of the growth rate of the all-female cold-tolerant T. nudus and the ordinary T. nudus at the age of 50-100 days

[0039]

[0040] In winter, the 200-day-old all-female cold-tolerant T. nudus is placed in an outdoor water tank for one day, and still survives, and the water temperature is 5.2°C.

[0041] According to the above results, the growth rate of the all-female cold-tolerant T. nudus bred by the application is increased by 15%-30% compared with that of the ordinary T. nudus, the cold resistance is 5.2°C Figure 5 , which is 2-3 degrees higher than that of the existing national cold-resistant T. nudus “Zhongyang No. 1” (7-8°C) new variety.

[0042] The above only describes the preferred embodiments of the patent, and any equivalent changes and modifications made within the scope of the patent application should be covered by the patent.

Claims

1. A method for breeding all-female *Pufferfish obscurus* with cold-resistant traits, characterized in that, The following steps are included: (1) By screening sex-reversed pufferfish larvae through sex molecular markers, pseudo-male pufferfish were obtained and mated with normal female pufferfish to obtain all-female pufferfish. (2) Individuals with cold-resistant traits are screened from the all-female dark-spotted pufferfish obtained in step (1) using cold-resistant trait molecular markers; the SNP site base sequence of the cold-resistant trait molecular marker is shown in SEQ ID NO.

2. When a 150bp band is amplified by PCR and the genotype is detected as GG, it is an all-female cold-resistant dark-spotted pufferfish.

2. The method for cultivating all-female pufferfish with cold-resistant traits according to claim 1, characterized in that, The sex reversal described in step (1) is accomplished through hormone induction.

3. The method for cultivating a new all-female pufferfish with cold resistance according to claim 2, wherein the hormone induction method is to add 17α-methyltestosterone to the feed.

4. The method for cultivating all-female pufferfish with cold-resistant traits according to claim 3, characterized in that, The dosage of 17α-methyltestosterone is as follows: 30-60 mg / L for soaking rotifers to feed 15-day-old pufferfish yolk sacs; 30-60 mg / L for soaking Artemia to feed 15-40-day-old pufferfish larvae; and 30-60 μg / g added to feed to 40-100-day-old pufferfish.

5. The method for cultivating all-female pufferfish with cold-resistant traits according to claim 1, characterized in that, The SNP site base sequence of the sex molecular marker mentioned in step (1) is shown in SEQ ID NO.

1. When the PCR amplification result is two bands of 250bp and 330bp, the individual is a normal female fish or a pseudo-male fish. When the PCR amplification result is a 330bp band, the individual is a normal male fish.

6. The method for cultivating a new all-female pufferfish with cold-resistant traits according to claim 5, characterized in that, The primer sequences used for PCR amplification are shown in SEQ ID NO.3-4.

7. The method for cultivating all-female pufferfish with cold-resistant traits according to claim 5, characterized in that, The PCR amplification program was as follows: Step 1: 95℃ pre-denaturation for 3 minutes; Step 2: 95℃ denaturation for 30 seconds; Step 3: 51.5℃ annealing for 30 seconds; Step 4: 72℃ extension for 30 seconds; Step 2-4 were repeated 35 times; Step 5: 72℃ extension for 5 minutes.

8. The method for cultivating all-female pufferfish with cold-resistant traits according to claim 1, characterized in that, In step (1), artificial spawning was induced when the pseudo-male fish mated with a normal female dark-spotted pufferfish. Specifically, the female fish was injected with HCG 180U / kg + LRH-A2 0.8μg / kg for the first time, and the dosage of the pseudo-male fish was halved. 24 hours later, the female fish was injected with HCG 360U / kg + LRH-A2 1.6μg / kg, and the dosage of the pseudo-male fish was halved.

9. A method for cultivating all-female pufferfish with cold-resistant traits according to claim 1, characterized in that, The primer sequences used for PCR amplification in step (2) are shown in SEQ ID NO.5-6.

10. A method for cultivating all-female pufferfish with cold-resistant traits according to claim 1, characterized in that, The PCR amplification program used in step (2) is as follows: step 1: 94℃ pre-denaturation for 4 minutes, step 2: 94℃ denaturation for 30 seconds, step 3: 51.5℃ annealing for 1 minute, step 4: 72℃ extension for 40 seconds, step 2-4 cycles for 30 times, and step 5: 72℃ extension for 10 minutes.

Images