A recombinant antigen of Mycobacterium tuberculosis and a tuberculosis vaccine AEC based on this antigen

Abstract

The present invention discloses a recombinant antigen of Mycobacterium tuberculosis and a tuberculosis vaccine AEC based on this antigen, belonging to the technical field of biomedicine. In the present invention, the dominant antigen genes Rv1886c, Rv3875 and Rv0580c of three Mycobacterium tuberculosis are fused together to construct a new recombinant antigen of Mycobacterium tuberculosis, and a novel tuberculosis protein vaccine AEC containing three antigens is prepared based on this recombinant antigen. This vaccine can target multiple antigens of Mycobacterium tuberculosis, and the fusion of the three antigens Rv1886c, Rv3875 and Rv0580c can achieve better anti-tuberculosis immune protection. At the same time, the vaccine prepared in the present invention has a clear composition, a simple structure, is safe and specific, has higher safety advantages, and can be produced in a standardized manner, which is conducive to industrialization.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a recombinant antigen of Mycobacterium tuberculosis and a tuberculosis vaccine AEC based on this antigen. Background Art

[0002] Tuberculosis (TB) is a respiratory infectious disease caused by infection with Mycobacterium tuberculosis (M. tb). For centuries, TB has been one of the main causes of morbidity and mortality worldwide. M. tb is mainly transmitted through the respiratory tract and can affect multiple organs of the body, and the most common affected site is the lungs. Under the current anti-tuberculosis chemotherapy with limited efficacy, the prevalence of multi-drug resistant and extensively drug-resistant Mycobacterium tuberculosis is increasing. Bacillus Calmette-Guérin (BCG) is the only vaccine licensed for the prevention of human tuberculosis. BCG can effectively protect infants and young children from lethal tuberculous meningitis, but its protective effect on adults is poor.

[0003] M. tb encodes approximately 4,000 proteins. At present, there is a lack of comprehensive understanding of the immune recognition of these proteins in the human body. Therefore, how to reasonably select the antigens contained in tuberculosis vaccines has always been the main obstacle to the development of tuberculosis vaccines. Recombinant protein vaccines have attracted much attention due to their clear composition, simple structure, good safety and high specificity. With several recombinant protein vaccines showing remarkable efficacy and unique advantages in research and trials, they also show good preventive effects and application prospects in the field of new tuberculosis vaccines. Therefore, the present invention is proposed. Summary of the Invention

[0004] To solve the above technical problems, the present invention screened three antigen genes from the vesicles of Mycobacterium tuberculosis and the vesicles secreted by macrophages infected with Mycobacterium tuberculosis, constructed a novel recombinant antigen of Mycobacterium tuberculosis containing three antigens, and prepared a trivalent tuberculosis protein vaccine AEC targeting multiple antigens of Mycobacterium tuberculosis based on this antigen. In a mouse animal model, subcutaneous immunization with the trivalent protein vaccine can significantly inhibit the bacterial load in the lung tissue of mice and alleviate symptoms such as pneumonia caused by Mycobacterium tuberculosis infection. It can be seen that better anti-tuberculosis immune protection can be achieved by targeting the three Mycobacterium tuberculosis antigens screened by the present invention.

[0005] The first object of the present invention is to provide a recombinant antigen of Mycobacterium tuberculosis, which is formed by fusing antigens Rv1886c, Rv3875, and Rv0580c, and the amino acid sequences of the antigens Rv1886c, Rv3875, and Rv0580c are respectively shown in SEQ ID NO.1-3.

[0006] Furthermore, the fusion order of the Mycobacterium tuberculosis recombinant antigen is Rv1886c, Rv3875, Rv0580c in sequence, and it is directly linked by Rv1886c, Rv3875, and Rv0580c.

[0007] The second object of the present invention is to provide a method for preparing the Mycobacterium tuberculosis recombinant antigen, which is obtained by transforming a recombinant antigen-encoding gene into a cell or microorganism for expression.

[0008] Furthermore, the microorganism includes but is not limited to prokaryotes and eukaryotes.

[0009] Furthermore, the specific preparation steps include: synthesizing a recombinant antigen-encoding gene, ligating it to an expression vector to obtain a recombinant plasmid, introducing the recombinant plasmid into a host cell, and culturing the recombinant cell under appropriate conditions to express the recombinant antigen.

[0010] Furthermore, the host cell includes but is not limited to Escherichia coli.

[0011] Furthermore, in the above preparation method, after harvesting the recombinant antigen, there is also a step of purifying the antigen.

[0012] Furthermore, the purification includes: disrupting the bacterial cells, collecting the supernatant by (standing and / or centrifuging), dialysis, and centrifuging to collect the supernatant.

[0013] The third object of the present invention is to provide a nucleic acid encoding the Mycobacterium tuberculosis recombinant antigen.

[0014] The fourth object of the present invention is to provide a recombinant expression vector containing the nucleic acid.

[0015] Furthermore, the expression vector can be selected according to actual needs, such as according to the type of host cell.

[0016] The fifth object of the present invention is to provide a recombinant cell containing the recombinant expression vector.

[0017] Furthermore, the cell can be a eukaryotic cell or a prokaryotic cell.

[0018] The sixth object of the present invention is to provide the application of the Mycobacterium tuberculosis recombinant antigen, nucleic acid, recombinant expression vector or recombinant cell in the preparation of a vaccine for preventing tuberculosis.

[0019] Furthermore, the application is to administer a vaccine with a certain dose to the body at least once for disease prevention.

[0020] The seventh object of the present invention is to provide a tuberculosis vaccine, which contains the Mycobacterium tuberculosis recombinant antigen, nucleic acid, recombinant expression vector or recombinant cell.

[0021] Furthermore, the form of the tuberculosis vaccine includes, but is not limited to, recombinant vaccines.

[0022] Furthermore, the tuberculosis vaccine contains the recombinant antigen of Mycobacterium tuberculosis and pharmaceutically acceptable excipients.

[0023] Furthermore, the excipients include, but are not limited to, immune adjuvants, stabilizers, preservatives, etc.

[0024] Furthermore, the tuberculosis vaccine is an emulsifier, and the preparation of the emulsifier includes: using the recombinant antigen as one of the aqueous phase media, mixing with the oil phase, and emulsifying to obtain the emulsifier.

[0025] Furthermore, the immune adjuvant is also one of the aqueous phase media. In the examples of the present invention, the volume ratio of the recombinant antigen to the immune adjuvant is 1:1. Specifically: Preheat Freund's incomplete adjuvant at 37 °C before use. Draw the required volume of Freund's incomplete adjuvant into the syringe, connect the syringe to the double-hole adapter, and expel the air. Draw the water-soluble antigen into another syringe and expel the air. Connect the syringe with the antigen to one end of the double-hole adapter. Ensure that both syringes are securely fixed to the double-hole emulsifying adapter via Luer-lock. Gently push the piston to allow all the antigen solution to pass through the double-hole adapter and mix with the incomplete adjuvant. Alternate continuously to transfer the mixture from one syringe to the other. Continue emulsifying according to the above steps until a stable emulsifier is formed. This will take several minutes. Push out a small drop of the emulsifier into a beaker filled with water, and the small droplets should form stable oil beads on the water surface. Push all the emulsifier into one syringe. Remove the double-hole adapter and attach an injection needle. Optionally, remove the empty syringe and replace it with a 1 ml sterile syringe. At this time, the emulsifier can be transferred to the 1 ml syringe for injection.

[0026] The above technical solutions of the present invention have the following advantages compared with the prior art:

[0027] (1) Currently, due to the lack of understanding of the immune mechanism against M. tb infection and the antigens that cause immune responses, the development of tuberculosis vaccines has not made significant progress. Selecting suitable immunogenic antigens is the key point and difficulty in the research of tuberculosis vaccines. The present invention screens out the optimal combination of multiple antigens targeting Mycobacterium tuberculosis through a self-designed screening method, and the present invention verifies that fusing the three antigen combinations of Rv1886c, Rv3875, and Rv0580c can achieve better anti-tuberculosis immune protection.

[0028] (2) The recombinant protein vaccine of the present invention is composed of the combined application of recombinant antigen and immune adjuvant, with a clear composition, simple structure, being safe and specific, having higher safety advantages, and can be produced in a standardized manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1-2 The improvement results of the pathological damage of the lungs of M.tb-infected mice by Mφ-EVs, H37Rv-EVs, H37Rv-Mφ-EVs and BCG.

[0030] Figure 3-4 The screening results of the mycobacterial protein components and target antigens in H37Rv, H37Rv-EVs and H37Rv-Mφ-EVs by proteomic analysis.

[0031] Figure 5 The IFN-γ immune response results after immunizing mice with the individually screened antigens.

[0032] Figure 6 The schematic diagram of the construction of the pET32a-AEC vector by obtaining the fusion gene Rv1886c-Rv3875-Rv0580c (AEC) using the method of Overlap PCR.

[0033] Figure 7-8 The results of verifying protein expression by Coomassie Brilliant Blue staining and Western Blot.

[0034] Figure 9 The results of detecting the levels and affinities of specific IgG antibodies in the sera of mice immunized with PBS, 3 kinds of bivalent vaccines and the trivalent vaccine AEC by ELISA two weeks after the last immunization.

[0035] Figure 10 The results of cytokine ELISA determination of the supernatant of spleen cells stimulated in vitro two weeks after the last immunization.

[0036] Figure 11 The results of flow cytometry detecting the proportions of CD4+T and CD8+T cells secreting TNF-a, IFN-γ and IL-2 in mouse spleen cells.

[0037] Figure 12 For four weeks after the third immunization, using 2×10 7 The flowchart of challenging mice with 2×10

[0038] Figure 13-14 The results of HE staining and the results of lung tissue scoring. Detailed implementation mode

[0039] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not intended to limit the present invention.

[0040] Example 1 Screening of antigens

[0041] Centrifuge H37Rv in the logarithmic growth phase (OD600 = 0.6 - 0.8) at 3000g for 15 min, discard the supernatant, wash with 1×PBS, and resuspend with complete medium. Infect RAW264.7 cells with bacteria at an MOI of 10. After 6 h of infection, wash 3 times with 1×PBS, and add complete medium without exosomes to continue culturing. After 48 h of culturing, collect the cell supernatant, centrifuge at 3000g for 15 min, and remove cell debris to collect the supernatant.

[0042] Pass the obtained supernatant successively through a 0.45 μm filter membrane and a 0.22 μm filter membrane, then centrifuge at 100,000g for 90 min, resuspend the EVs precipitate with 1×PBS to obtain H37Rv-EVs (Mycobacterium tuberculosis-derived vesicles) and H37Rv-Mφ-EVs (Mycobacterium tuberculosis-infected macrophage-derived vesicles).

[0043] Immunize mice by subcutaneous injection of EVs. After the last immunization, challenge with 2×10 7 CFU of H37Ra to evaluate the immunoprotective effect of EVs in tuberculosis infection. Among them, the BCG vaccine was purchased from JingNuo Biotechnology. The results are shown in Figure 1-2 , and it was found that H37Rv-Mφ-EVs had the strongest ability to induce anti-tuberculosis immune responses, and H37Rv-Mφ-EVs could significantly reduce the pathological damage in the lungs of M. tb-infected mice, while effectively clearing bacteria and reducing the bacterial load in the lungs.

[0044] Therefore, we conjecture that the tuberculosis proteins simultaneously present in the EVs secreted by macrophages infected with Rv and the EVs secreted by Rv itself can be used as more effective vaccine target antigens. The specific steps are as follows: Analyze the tuberculosis protein components in H37Rv, H37Rv-EVs, and H37Rv-Mφ-EVs by proteomics. The results are shown in Figure 3 . Subsequently, screen out the overlapping tuberculosis proteins in H37Rv-EVs and H37Rv-Mφ-EVs. The results are shown in Figure 4 , and 3 antigens are screened out: Rv1886c, Rv3875, and Rv0580c.

[0045] Comparison of immune effects: After immunizing mice with individual antigens respectively, the IFN-γ immune responses of the spleen cells of the immunized mice against the antigens were detected from 543 to 632 pg / mL, indicating that all these 3 antigens had good immunogenicity ( Figure 5 ).

[0046] Example 2 Preparation and Application of Vaccine

[0047] (1) Design the primers for AEC (F1 / R1 - F4 / R4, see below). Using the inactivated H37Rv bacterial solution as a template, amplify the complete AEC fragment using the TaKaRa PCR kit. Perform 1% agarose gel electrophoresis and purify the DNA product using the Axygen gel extraction kit; insert it into the pET32a vector through homologous recombination to construct the pET32a - AEC vector (the construction schematic diagram is shown in Figure 6 ), and verify the sequence by sequencing. The amino acid sequences of Rv1886c, Rv3875, and Rv0580c are shown in SEQ ID NO.1 - 3.

[0048] F1: AGGAGATATACATATGATGACAGACGTGAGCCGAAAGATTC

[0049] R1: TTCCACTGCTGCTCTGTCATGCCGGCGCCTAACGAACTCTGC

[0050] F2: AGAGTTCGTTAGGCGCCGGCATGACAGAGCAGCAGTGGAATTT CG

[0051] R2: GCATACGACTGATCTGTCATTGCGAACATCCCAGTGACGT TGCCT

[0052] F3: ACGTCACTGGGATGTTCGCAATGACAGATCAGTCGTATGCGGT AG

[0053] R3: TTTTATCGCTCATATG

[0054] CTACGAATTGTCGGCCGGAGTCAACCGA

[0055] F4: GCATACGACTGATCTGTCATGCCGGCGCCTAACGAACTCT GC

[0056] R4: AGAGTTCGTTAGGCGCCGGCATGACAGATCAGTCGTATGCGGT AG

[0057] (2) Transform the plasmid with successful sequencing in step (1) into BL21 competent cells. Pick a single - colony and inoculate it into an Amp - resistant liquid medium, and culture it in a shaker at 37°C until OD600nm = 0.6 - 0.8; set the IPTG concentration gradients as 0.1, 0.5, 1M; culture it at 16°C for 12 h, 25°C for 8 h, and 37°C for 5 h respectively; detect the optimal induction temperature, time, and IPTG concentration for the protein.

[0058] (3) Induce a large amount of protein expression according to the optimal induction temperature, time, and IPTG concentration of the protein. Centrifuge the bacterial solution at 4°C and 3500 rpm for 30 min, discard the supernatant, add 50 mL of 1×PBS containing 100 mM PMSF to resuspend the bacteria, and disrupt the bacteria at 4°C for 15 min using a homogenizer; centrifuge at 4°C and 10,000 rpm for 15 min to separate the supernatant and precipitate, detect the distribution of the target protein by Coomassie Brilliant Blue staining, and verify the protein expression by Western Blot. The results are shown in Figure 7-8 , and it can be seen that the molecular weight of the fusion protein AEC is 70 kDa, and it mainly exists in the precipitate in the form of inclusion bodies.

[0059] (4) The target protein exists in the bacterial precipitate in the form of inclusion bodies; wash the precipitate with 0.5 M, 1 M, 2 M, and 4 M urea for 30 min respectively, centrifuge at 4°C to collect the precipitate; dissolve the bacterial precipitate with 8 M urea, place it at room temperature for 30 min, collect the supernatant, and place it in a dialysis bag. Dialyze it in 100-fold volume of PBS for 24 h, and change the PBS every 8 h during this period. Then centrifuge at 12,000 rpm for 20 min at 4°C to collect the supernatant.

[0060] (5) Embed and concentrate the supernatant in step 4 with PEG20000, filter and sterilize it, measure the protein concentration, and freeze it at -80°C for standby.

[0061] (6) Immunize mice by subcutaneous injection. The immunization protocol is to subcutaneously inject multiple points with 200 μL of the emulsion of the protein and Freund's incomplete adjuvant each time, and the protein immunization dose is 1.6 nM; immunize once every two weeks for a total of three times; collect serum two weeks after the third immunization to detect the antibody titer, and isolate spleen lymphocytes from the mouse spleen for flow cytometry analysis and cytokine detection.

[0062] Two weeks after the last immunization, ELISA was used to detect the specific IgG antibody levels and affinities in the sera of mice immunized with PBS, 3 bivalent vaccines, and the trivalent vaccine AEC. The IgG antibody levels and affinity indices of mice immunized with the vaccine AEC were significantly higher than those of the 3 bivalent vaccines ( Figure 9 ). Two weeks after the last immunization, the cell culture supernatant stimulated in vitro with spleen cells was measured by cytokine ELISA. The results showed that compared with the 3 bivalent vaccine groups, the ability of spleen cells of mice immunized with the vaccine AEC to secrete Th1-type cytokines TNF-α, IFN-γ, and IL-2 was significantly enhanced, and the vaccine AEC effectively promoted the expression of IL-17a, which was significantly higher than that of the bivalent vaccines ( Figure 10)。Flow cytometry was used to detect the proportions of CD4+T and CD8+T cells secreting TNF-a, IFN-γ and IL-2 in mouse spleen cells. The results showed that the percentages of functional CD4+T and CD8+T cells induced by the trivalent vaccine AEC were significantly higher than those of the three bivalent vaccines, indicating that the trivalent vaccine AEC effectively induced the generation of functional CD4+T and CD8+T cells that play an important protective role against tuberculosis infection. Figure 11 )。

[0063] (7) The mice were immunized with the vaccine by subcutaneous injection. Immunization was carried out every other week for a total of 3 times. Four weeks after the last immunization of the mice, the mice were challenged by intranasal instillation of 2×10 7 CFU of H37Ra. The H37Ra bacterial solution in the logarithmic growth phase was taken, centrifuged at 3000g for 15 min, the supernatant was discarded, and the bacterial cells were resuspended with PBST; the challenge method was to instill 30 μL of the bacterial suspension into each mouse by nasal drip. Six weeks after the challenge, the bacterial load in the lungs of the mice was counted and histopathological examination was performed. The HE staining results showed that the infiltration of inflammatory cells in the lungs of the mice immunized with the vaccine AEC was reduced compared with that of the three bivalent vaccine groups, and the vaccine AEC could effectively control the growth of bacteria in the lungs of the mice. Figure 13-14 )。

[0064] Obviously, the above embodiments are only examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A recombinant Mycobacterium tuberculosis antigen, characterized in that: The recombinant Mycobacterium tuberculosis antigen is formed by the fusion of antigens Rv1886c, Rv3875, and Rv0580c, the fusion order is Rv1886c, Rv3875, and Rv0580c, and Rv1886c, Rv3875, and Rv0580c are directly connected. The amino acid sequences of the antigens Rv1886c, Rv3875, and Rv0580c are shown in SEQ ID NO.1-3, respectively.

2. The method for preparing the recombinant Mycobacterium tuberculosis antigen according to claim 1, characterized in that: The recombinant antigen encoding gene is transformed into cells or microorganisms for expression.

3. The preparation method according to claim 2, characterized in that: The specific preparation steps include: synthesizing a recombinant antigen encoding gene, connecting it to an expression vector to obtain a recombinant plasmid, introducing the recombinant plasmid into a host cell, and culturing the recombinant cell to express the recombinant antigen.

4. A nucleic acid, characterized in that Encoding the recombinant Mycobacterium tuberculosis antigen according to claim 1.

5. A recombinant expression vector, characterized in that: Containing the nucleic acid according to claim 4.

6. A recombinant cell, characterized in that Contains the recombinant expression vector according to claim 5.

7. Use of the recombinant Mycobacterium tuberculosis antigen according to claim 1, the nucleic acid according to claim 4, the recombinant expression vector according to claim 5 or the recombinant cell according to claim 6 in the preparation of a vaccine for preventing tuberculosis.

8. A tuberculosis vaccine, characterized in that: The tuberculosis vaccine contains the recombinant Mycobacterium tuberculosis antigen according to claim 1, the nucleic acid according to claim 4, the recombinant expression vector according to claim 5 or the recombinant cell according to claim 6.

9. The tuberculosis vaccine according to claim 8, characterized in that The tuberculosis vaccine contains the Mycobacterium tuberculosis recombinant antigen and pharmaceutically acceptable excipients.

10. The tuberculosis vaccine according to claim 8, characterized in that The tuberculosis vaccine is an emulsifier, and the preparation of the emulsifier includes: taking the recombinant antigen as one of the aqueous phase media, mixing it with the oil phase, and emulsifying it to obtain the emulsifier.

Images