Application of genetically engineered mesenchymal stem cells in natural killer cell culture

Abstract

The present invention relates to the field of bioengineering, and in particular to the application of genetically modified mesenchymal stem cells in natural killer cell culture. The IL-15 gene-modified umbilical cord mesenchymal stem cells prepared by the present invention have a strong factor secretion ability, can be amplified with the proliferation of NK cells, and can continuously and stably secrete IL-15, effectively improving the in vitro amplification efficiency of NK cells, enhancing the tumor killing function of NK cells, and also avoiding the additional addition of cytokines during the NK cell amplification culture process, avoiding the pollution caused by frequent rehydration operations, and also greatly reducing the production cost.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to the application of mesenchymal stem cells modified by genetic engineering in the cultivation of natural killer cells. Background Art

[0002] Cancer is a huge "killer" that poses a serious threat to human health today, and liver cancer is the third most common cancer "killer" in the world.

[0003] Up to now, surgery is still the most effective means of treating liver cancer, but this is only for patients with early liver cancer. In the actual clinical diagnosis and treatment process, the patients diagnosed with liver cancer are often in the middle and late stages. At this time, only 10%-30% of patients can undergo radical resection. However, the five-year survival rate of patients after radical resection is only 70%-80%. Although liver transplantation may be the most ideal choice for patients without metastasis, liver transplantation itself is expensive, the matching requirements of transplanted liver are strict, and long-term medical maintenance is required after surgery. Liver transplantation is only suitable for a very small number of liver cancer patients. For most liver cancer patients who cannot receive radical surgical treatment, they can only use radiofrequency ablation, microwave ablation, cryotherapy, alcohol injection, hepatic artery embolization chemotherapy, radiotherapy and other methods for palliative treatment, and these therapies often have great side effects. While killing tumor cells, they also bring new harm to the patient's health. Some patients also choose to try antibody targeted drug treatment and traditional Chinese medicine treatment with milder side effects, but they can often only extend the patient's survival period by about half a year. Therefore, exploring new biological therapies for liver cancer is of great significance to liver cancer patients.

[0004] Mesenchymal stem cells (MSCs) are a type of adult stem cells. The International Society for Celluar Therapy (ISCT) defines the following basic biological characteristics of MSCs: spindle-shaped, adherent growth; cell surface markers CD73, CD90, CD105 positive rate ≥ 95%, CD11b (or CD14), CD19 (or CD79α), CD34, CD45, HLA-DR negative rate ≤ 2%; in vitro induction to differentiate into bone, cartilage and adipose tissue. MSCs are widely distributed in the human body. There are a large number of MSCs in human adipose tissue, peripheral blood, bone marrow, periosteum, skeletal muscle, dermis, skin, liver, and umbilical cord, placenta, and cord blood of newborns, so the ethical controversy caused by the use of embryonic stem cells can be well avoided. Studies have shown that the low immunogenicity, multi-differentiation potential, paracrine effect and homing effect of MSCs can well regulate the body's immune balance and the repair and regeneration of body tissues. In particular, the chemotaxis of MSCs allows them to migrate to the inflammatory focus of the body. The inflammatory response at the tumor lesion site is often very severe, so MSCs have broad application prospects in the treatment of tumor diseases.

[0005] NK cells, also known as natural killer cells, are a type of natural lymphocytes. NK cells account for 5-15% of adult peripheral blood lymphocytes. Compared with T and B lymphocytes, NK cells in peripheral blood have a shorter half-life, so they need to be continuously supplemented. NK cells develop from CD34+ hematopoietic progenitor cells in the bone marrow, and their maturation and differentiation are completed in peripheral lymphoid tissues. NK cells can kill aging and mutated cells in the body through a variety of mechanisms such as the release of granzymes and perforins. In addition, NK cells are also involved in a complex network of interactions among a variety of key immune cells, including dendritic cells, T cells, and B cells, and initiate adaptive immunity by synthesizing and releasing corresponding cytokines and chemokines. Compared with other immune cells, the main advantages of NK cells in tumor immunotherapy are: rapid tumor killing response, no cytokine release syndrome (CRS) and GvHD, and no neurotoxicity. At present, many medical institutions at home and abroad have carried out IIT projects on NK cell treatment of tumors and have achieved exciting clinical efficacy.

[0006] IL-15 is a pleiotropic cytokine that has been widely studied and proven to be extremely important for the survival, development, and function of NK cells. In the immune microenvironment of solid tumors, IL-15 is closely related to NK cell activation, which can maintain TRM cells and limit the progression of solid tumors. Studies have shown that the lack of IL-15 can lead to NK cell developmental dysfunction and fail to exert its tumor-killing effect. At present, the view that IL-15 is a potential therapeutic immunomodulatory agonist has been widely recognized, and a number of kits using IL-15 as a large-scale expansion of NK cells in vitro have been launched on the market. However, due to factors such as IL-15's short half-life in vivo, low bioavailability, insufficient tumor targeting, and severe toxic and side effects, its clinical application is limited.

[0007] For clinically difficult-to-treat solid tumors, their tumor microenvironment is often a hypoxic, acidic environment. Normal immune cells in the body (such as T cells and NK cells) often find it difficult to adapt to the hypoxic, slightly acidic environment of solid tumors, making it difficult for them to infiltrate into the solid tumors. Even if some immune cells successfully infiltrate into the solid tumors, it is difficult for them to exert their normal tumor-killing function.

[0008] In view of the problems in the existing technology: MSCs cannot effectively kill tumor cells in the body, there are quality differences between different batches of IL-15 produced by different manufacturers, the industrially produced IL-15 has a short half-life in vitro and in vivo and has great toxic side effects after entering the body, the IL-15 entering the body lacks targeting, too frequent factor supplementation operations increase the contamination risk of in vitro NK cell expansion, and NK cells cultured under traditional conventional culture conditions have limited killing effect on solid tumors. Summary of the invention

[0009] In view of this, the present invention provides an application of genetically modified mesenchymal stem cells in natural killer cell culture. The IL-15 gene-modified umbilical cord mesenchymal stem cells prepared by the present invention have a strong factor secretion ability and can be expanded with the proliferation of NK cells. They can continuously and stably secrete IL-15, effectively improving the in vitro expansion efficiency of NK cells, while also avoiding the additional addition of cytokines during the NK cell expansion culture process, avoiding the pollution caused by frequent rehydration operations, and also greatly reducing the production cost.

[0010] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0011] The present invention provides the use of IL-15 in culturing mesenchymal stem cells and / or natural killer cells.

[0012] The present invention also provides a method for culturing mesenchymal stem cells, which comprises obtaining a recombinant plasmid containing IL-15, transforming and / or transfecting a virus to obtain a lentivirus, and infecting the mesenchymal stem cells with the lentivirus.

[0013] In some embodiments of the present invention, in the above-mentioned culture method, the recombinant plasmid includes: IL-15 gene and lentiviral vector plasmid pHBLV-CMV-MCS-EF1-Zsgreen1-T2A-puro.

[0014] In some embodiments of the present invention, in the above culture method, the IL-15 has a sequence as shown in SEQ ID NO: 1: atgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgtttact tctaaacagtcattttctaactgaagctggcattcatgtcttcattttgggctgtttcagtgcagggcttcctaaaacagaagccaactgggtgaatgtaataagtg atttgaaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgttcaccccagttgcaaagtaacagcaatgaagtgctttc tcttggagttacaagttatttcacttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagtttgtcttctaatgggaatg taacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttcttga.

[0015] In some embodiments of the present invention, in the above-mentioned culture method, the transformation and / or transfection also includes auxiliary plasmids: psPAX2 (Hanbio Biopharmaceuticals) and PMG2.G (Hanbio Biopharmaceuticals).

[0016] In some embodiments of the present invention, in the above-mentioned culture method, the mass ratio of the recombinant plasmid, the ps PAX2 and the PMG2.G is 4:3:1.

[0017] The present invention also provides mesenchymal stem cells obtained by the above culture method.

[0018] The present invention also provides a method for culturing natural killer cells, wherein the natural killer cells are pretreated, mixed with the mesenchymal stem cells as claimed in claim 3, and cultured to obtain the natural killer cells.

[0019] In some embodiments of the present invention, in the above-mentioned culture method, the pretreatment includes an activation step.

[0020] In some embodiments of the present invention, in the above culture method, the oxygen concentration of the culture is 1-10%.

[0021] In some embodiments of the present invention, in the above culture method, the oxygen concentration of the culture is 2.5%.

[0022] In some embodiments of the present invention, in the above-mentioned culture method, the natural killer cells include: human umbilical cord blood natural killer cells.

[0023] The present invention also provides natural killer cells obtained by the above culture method.

[0024] The present invention also provides a product, comprising: the above-mentioned mesenchymal stem cells and / or the above-mentioned natural killer cells.

[0025] The present invention also provides the use of the above-mentioned mesenchymal stem cells, the above-mentioned natural killer cells and / or the above-mentioned products in preparing products for treating tumors and / or cancers.

[0026] In some embodiments of the present invention, in the above application, the tumor includes: a solid tumor.

[0027] The beneficial effects of the present invention include:

[0028] (1) The IL-15 gene-modified umbilical cord mesenchymal stem cells prepared by the present invention have a strong factor secretion ability and can be expanded with the proliferation of NK cells. They can continuously and stably secrete IL-15, effectively improving the in vitro expansion efficiency of NK cells, while also avoiding the additional addition of cytokines during the NK cell expansion culture process, avoiding the pollution caused by frequent fluid replenishment operations, and also greatly reducing the production cost.

[0029] (2) Compared with iPSC-derived NK and CAR-NK, this approach does not require expensive and complex genetic modification, does not change the genomic DNA of NK cells, and does not pose a risk of genetic mutation, thus ensuring the biological function of NK to the greatest extent possible.

[0030] (3) Compared with existing commercial NK amplification kits, this culture and amplification method can obtain more phenotypically mature NK cells within the same culture cycle.

[0031] (4) Animal experiments also showed that, compared with the control group, under hypoxic culture conditions, NK cells co-cultured with umbilical cord mesenchymal stem cells modified with the IL-15 gene showed a more significant tumor-killing effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0033] Figure 1 Shows plasmid map;

[0034] Figure 2 Shows the electrophoresis results of IL-15 coding gene amplification products;

[0035] Figure 3 Figure 2 shows the identification of Vector / hUC-MSCs and IL-15 / hUC-MSCs; wherein: A shows the expression of mesenchymal stem cell surface markers in hUC-MSCs after IL-15 lentivirus transfection; B shows the expression of reporter fluorescence in hUC-MSCs after IL-15 lentivirus infection; C shows the expression of reporter fluorescence in hUC-MSCs after empty vector (without IL-15 gene sequence) lentivirus infection;

[0036] Figure 4 Shows the detection of IL-15 / hUC-MSCs' ability to secrete IL-15;

[0037] Figure 5 Shows the proliferation of hUC-NK cells;

[0038] Figure 6 Shows the purity of hUC-NK cells;

[0039] Figure 7 Shows the in vitro tumor killing experiment of NK cells;

[0040] Figure 8 Shows the in vivo tumor killing experiment of NK cells. DETAILED DESCRIPTION

[0041] The invention discloses application of mesenchymal stem cells modified by genetic engineering in culturing natural killer cells.

[0042] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0043] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0044] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0045] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0046] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0047] In Examples 1 to 10 and the Effect Examples of the present invention, all the raw materials and reagents used can be purchased from the market.

[0048] The present invention will be further described below in conjunction with embodiments:

[0049] Example 1 IL-15 cDNA acquisition

[0050] 1) 400 mL of peripheral blood was collected from adult males, and NK cells were obtained by density gradient centrifugation using NK cell separation solution (produced by Tianjin Haoyang Company, NK2011H). The cells were counted using a cell counting plate and diluted to 5x10 with physiological saline. 6 / mL.

[0051] 2) Take 1 mL of the above cell suspension and place it in a sterile EP tube soaked in 1.5 mL DEPC water. After centrifugation, remove the supernatant. Add 1 mL of Trizol reagent (Beyotime, R0016) and shake thoroughly on a vortexer.

[0052] 3) Leave at room temperature for 5 minutes to allow the sample to fully lyse.

[0053] 4) Add 0.2 mL of chloroform to the above EP tube, shake vigorously for 15 seconds, and leave at room temperature for 2-3 minutes.

[0054] 5) Place the above EP tube in a centrifuge and centrifuge at 12000g / 4℃ for 15 min. Pipette the upper colorless aqueous phase containing total RNA into a new centrifuge tube.

[0055] 6) Add 0.5 mL of isopropanol to the EP tube, invert several times to mix, and allow to precipitate at room temperature for 10 min.

[0056] 7) Centrifuge at 12000g for 10 min at 4°C, retain the RNA precipitate at the bottom of the tube and discard the supernatant.

[0057] 8) Add 1 mL of 75% ethanol (prepared with DEPC water) solution to the above EP tube, and invert the EP tube several times to mix the RNA.

[0058] 9) Centrifuge at 7500g for 5 min at 4℃, carefully aspirate the supernatant, wait until the RNA is slightly dry, add 20μL DEPC water to dissolve it, and freeze at -70℃ for later use.

[0059] 10) Thaw RNA samples, gDNA EZearser Buffer (10×), and DEPC-treated Water (Beyotime, D7180M) at room temperature and immediately place on ice after thawing.

[0060] 11) Prepare a reaction mixture on ice according to the ingredients in the table below.

[0061] Table 1

[0062]

[0063] 12) Incubate in a water bath at 37°C for 2 min.

[0064] 13) Immediately place on ice.

[0065] 14) Add 6 μL DEPC-treated Water and 4 μL BeyoRT TM cDNA first-strand synthesis premix (5×), total volume 20 μL.

[0066] 15) Mix gently and then centrifuge to settle the liquid.

[0067] 16) Incubate at 42°C for 10 min.

[0068] 17) Incubate at 80°C for 10 min to inactivate reverse transcriptase and terminate the reverse transcription reaction.

[0069] Example 2 Construction of IL-15 expression vector

[0070] 1) The primer sequence of IL-15 was designed based on the two restriction sites (EcoR1 and BamH1) of the lentiviral vector plasmid pHBLV-CMV-MCS-EF1-Zsgreen1-T2A-puro (Hanheng Biotechnology) and the gene sequence of IL-15 in Gene Bank.

[0071] (IL-15Gene, ID:3600): Such as SEQ ID NO:1 shows: atgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgtttacttctaaacagtcattttctaactgaagctggcattcatgtcttcattttgggctgtttc agtgcagggcttcctaaaacagaagccaactgggtgaatgtaataagtgatttgaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgttcacc ccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttcacttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagttt gtcttctaatgggaatgtaacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttcttga.

[0072] Forward: 5'-TCCATCCAGTGCTACTTGTGT-3' (as shown in SEQ ID NO: 2)

[0073] Reverse: 5'-CTGCACTGAAACAGCCCAAAA-3' (as shown in SEQ ID NO: 3)

[0074] 2) All primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0075] 3) Melt Easy-Load at room temperature TM PCR Master Mix (Beyotime, D7251) was gently mixed by inverting and then centrifuged at low speed for a few seconds.

[0076] 4) Set up the PCR reaction system on an ice bath according to the table below:

[0077] Table 2

[0078]

[0079] 5) Mix by gently pipetting or vortexing, and centrifuge for a few seconds at room temperature to allow the liquid to accumulate at the bottom of the tube.

[0080] 6) Place the set PCR reaction tube on the PCR instrument and start the PCR reaction.

[0081] The setting of PCR reaction parameters can refer to the following example:

[0082] STEP 1 (initial denaturation): 94°C for 3 min

[0083] STEP2 (denaturation): 94℃30s

[0084] STEP3 (annealing): 60℃ 30s

[0085] STEP4 (Extension): 72℃1min

[0086] STEP5 (cycle): Go to STEP2 for 30 cycles

[0087] STEP6 (final extension): 72℃10min

[0088] STEP 7 (temporary storage): 4℃ forever

[0089] 7) The obtained product was detected by 1% agarose electrophoresis, and then purified and quantified using a DNA recovery kit (Beyotime, D0056) according to the instructions.

[0090] 8) Double-digest the IL-15 fragment and the lentiviral vector plasmid with EcoR1 and BamH1, respectively. pHBLV-CMV-MCS-EF1-Zsgreen1-T2A-puro. After the digestion product is purified, the linearized vector is mixed with the double-digested IL-15 fragment in a volume ratio of 1:3. In a 45°C water bath for 5 minutes, an ice bath for 3 minutes, 1 μL of T4 ligase and its buffer are added, and the cells are connected overnight at 22°C. Then, an appropriate amount of the ligation product is taken to transform Escherichia coli TOP10 competent cells, and ampicillin-resistant colonies are randomly selected, shaken, and the plasmid is extracted. The recombinant plasmid is named pHBLV-IL-15. The plasmid is identified by double digestion (EcoR1, BamH1). After the gene sequencing of the recombinant plasmid is correct, the plasmid is extracted in large quantities.

[0091] Example 3 Amplification of IL-15-carrying lentivirus

[0092] 1) In a 6-well plate, 1x10 5 293T cells were cultured in a 37°C, 5% CO2 incubator.

[0093] 2) When the cell confluence reaches 50%, pHBLV-IL-15, psPAX2 (Hanheng Biotech), and PMG2.G (Hanheng Biotech) are mixed in a ratio of 4:3:1 (a total of 2.4 μg DNA) in 20 μL of basic DMEM medium and gently mixed. TM (Beyotime, C0533) transfection reagent was diluted to 80 μL and placed at room temperature for 5 min. TM The diluent (total volume 100 μL) was gently mixed and placed at room temperature for 20 min.

[0094] 3) Add 100 μL of the above mixture to each well of a 6-well plate and gently shake the plate to mix the liquid evenly.

[0095] 4) While the above three plasmids were co-transfected into 293T cells, the corresponding empty plasmid pHBLV and auxiliary plasmids psPAX2 and PMG2.G were co-transfected into 293T cells as negative controls.

[0096] 5) Collect the supernatant in the cell culture plate 48h and 72h after transfection, filter with a 0.45μm syringe filter, and store at -80℃ for later use.

[0097] 6) In a 24-well plate, 5 x 10 4 293T cells were plated, and when the cell confluence reached 50% the next day, the harvested lentivirus was used to infect 293T cells at 10-105 (6 dilutions in total), with 100 μL added to each well, and 3 replicate wells were set for each dilution.

[0098] 7) Observe under an inverted fluorescence microscope 48 to 72 hours after virus infection, and select an appropriate dilution (0 to 50 fluorescent cells per field of view) to calculate the lentiviral infection titer based on the expression of green fluorescent protein. One luminous cell is one transduction unit (TU), and the specific calculation formula is as follows:

[0099]

[0100] Example 4 Acquisition and identification of hUC-MSCs

[0101] 1) With the informed consent of the pregnant women and the approval of the hospital's Medical Ethics Committee, the umbilical cord of healthy pregnant women was collected under sterile conditions. The collected umbilical cord samples were placed in physiological saline containing 0.1% double antibody, refrigerated at 4°C, and processed within 4 hours after collection.

[0102] 2) In a biosafety cabinet, soak the umbilical cord in 75% alcohol for 5 minutes for disinfection. Rinse the umbilical cord with sterile saline.

[0103] 3) Cut the umbilical cord into small pieces of about 2 cm, then use tweezers to clamp the edges of the umbilical cord and carefully tear off the outer membrane of the umbilical cord.

[0104] 4) Remove the outer membrane of the umbilical cord and carefully extract the two umbilical veins and one umbilical artery. The remaining tissue block is Wharton's jelly. Rinse the above tissue block with sterile saline for 3 times.

[0105] 5) Cut the Wharton's glue into pieces of about 0.5 cm 3 Small pieces were scattered in a T75 cell culture flask and placed in a cell culture incubator at 37°C and 5% CO2 for 1 hour to allow the tissue pieces to adhere closely to the culture flask.

[0106] 6) Human mesenchymal stem cell culture medium (Tianjin, Haoyang) was slowly injected into the culture flask until it adhered to the wall. When the culture medium submerged half of the tissue block, the addition of liquid was stopped.

[0107] 7) Carefully place the culture flask in an incubator and observe the cell growth status under an inverted microscope. Change the medium by half volume every 3 days, and change the medium with full volume after 7 days to remove non-adherent cells. Change the medium by half volume every 3 days thereafter. When the confluence of hUC-MSCs reaches 80%, perform routine digestion and subculture at a ratio of 1:3.

[0108] 8) hUC-MSCs cells cultured to the third generation were taken, digested, counted, and washed routinely, and then an appropriate amount of 0.01 M PBS was added to resuspend the cells. The expression of CD73, CD90, CD105, CD34, CD11b, CD19, CD45, and HLA-DR molecules on the cell surface were detected using the human mesenchymal stem cell detection kit (BD, Cat. No. 562245).

[0109] Example 5 IL-15 lentivirus infection of hUC-MSCs

[0110] 1) In a 6-well plate, 1x10 5 hUC-MSCs cells were cultured in a 37°C, 5% CO2 incubator.

[0111] 2) When the cell confluence reached 50%, hUC-MSCs cultured to the third generation were transfected with lentivirus carrying IL-15 and empty lentivirus, respectively. Polybrene (final concentration 5 μg / mL) and 20 μL of virus suspension were added, respectively, and cultured in an incubator at 37°C and 5% CO2.

[0112] 3) 24 hours after transfection, the virus-containing infection medium was discarded, and the cells were cultured with fresh mesenchymal stem cell complete medium. The lentiviral transfection was examined under an inverted fluorescence microscope.

[0113] 4) 48 hours after transfection, if hUC-MSCs emit green fluorescence under a fluorescence microscope, it indicates that the transfection is successful and conventional passaging can be performed.

[0114] 5) Treat the hUC-MSCs after passage with puromycin, and the final concentration of puromycin is 2-10 μg / mL. Puromycin selection is continued for 1 week to obtain stable cell lines of gene-modified umbilical cord mesenchymal stem cells IL-15 / hUC-MSCs and empty vector-modified umbilical cord mesenchymal stem cells Vector / hUC-MSCs.

[0115] Example 6 Detection of IL-15 secretion ability of hUC-MSCs modified with IL-15

[0116] 1) In a 6-well plate, 1x10 5 hUC-MSCs, Vector / hUC-MSCs, IL-15 / hUC-MSCs cells were inoculated in 3 replicate wells and cultured in a 37°C, 5% CO2 incubator.

[0117] 2) When the cell confluence reaches 80%, collect the culture supernatant.

[0118] 3) Elisa kits were used to detect the IL-15 content in the supernatant of the above-mentioned cell culture medium.

[0119] Example 7 Activation of human umbilical cord blood NK cells (hUC-NK)

[0120] 1) With the informed consent of the pregnant women and the approval of the hospital's Medical Ethics Committee, the umbilical cord blood of healthy pregnant women was collected under sterile conditions, refrigerated in a 4°C incubator, and processed within 6 hours after collection.

[0121] 2) Activate hUC-NK using NK cell activation kit (Haoyang, SACNK-KIT):

[0122] a. Reagent preparation

[0123] Preparation of culture flask coating solution: Add 1 tube of Reagent I and 1 tube of Reagent II to 18 mL of PBS.

[0124] Preparation of proliferation medium: Add 1 vial of Reagent V of this kit to every 1000 mL of immune cell serum-free medium.

[0125] Preparation of activation medium: After preparing the proliferation medium, take out 500 mL of proliferation medium and add 1 tube of reagent IV of this kit.

[0126] b. hUC-PBMC acquisition

[0127] Flask coating: Add coating solution to T175 flask and incubate at 37℃ for at least 2h.

[0128] Obtaining hUC-PBMC: Take out the centrifuge tube, add 20mL of Ficoll sample density separation solution, carefully add 15mL of anticoagulated blood slowly along the tube wall to the separation solution interface, and centrifuge at 600g for 30min. Carefully aspirate the top yellowish plasma layer and inactivate it for later use. Aspirate the white ring-shaped PBMC layer to a new centrifuge tube, add an equal volume of PBS to the above centrifuge tube and mix well, centrifuge at 600g for 10min. Discard the supernatant, add PBS to re-dissolve and wash, and centrifuge at 300g for 10min.

[0129] c. hUC-PBMC activation

[0130] The isolated PBMCs were prepared into 40 mL of cell suspension using immune cell serum-free medium without any factors, and a complete set of reagent VI (all 5 tubes were added), a tube of reagent IX and 5 mL of autologous plasma were added. All the above liquids were added to the culture bottle with the coating liquid discarded, and cultured in a saturated humidity 37°C, 5.0% CO2 incubator.

[0131] On the third day of culture, add 40 mL of NK activation medium, 5 mL of plasma, 1 tube of reagent IX, and 1 tube of reagent VI.

[0132] On the 5th day of culture, 70 mL of NK activation medium, 5 mL of plasma, 1 tube of reagent IX, and 1 tube of reagent VII were added.

[0133] On the 7th day of culture, the cells in the culture flask were completely blown off, and after adding the remaining autologous plasma and the remaining activation medium, equal amounts were transferred to 5 culture bags and marked as A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, and E-hUC-NK, respectively.

[0134] At this point, the activation culture of hUC-NK is completed.

[0135] Example 8 IL-15 modified hUC-MSCs expansion of hUC-NK

[0136] On the 9th day of culture, the five bags of cells A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, and E-hUC-NK were treated as follows:

[0137] A-hUC-NK, according to the instructions of the kit (Cat. No. - Tianjin Haoyang, TBDTMNK2013-S), the proliferation medium and cytokines were added every 2 days;

[0138] B-hUC-NK, count the immune cells in the bag, and add hUC-MSCs into the bag at a ratio of total immune cells: hUC-MSCs = 1000:1, and simultaneously supplement the proliferation medium twice that of A-hUC-NK. After that, only supplement the proliferation medium once every 4 days. If the bag is full, divide it into bags evenly;

[0139] C-hUC-NK, count the immune cells in the bag, and add hUC-MSCs into the bag at a ratio of total immune cells: vector / hUC-MSCs = 1000:1, and simultaneously supplement with 2 times the proliferation medium of A-hUC-NK. After that, only replenish the proliferation medium once every 4 days. If the bag is full, divide it into bags evenly;

[0140] D-hUC-NK, count the immune cells in the bag, and add hUC-MSCs into the bag at a ratio of total immune cell number: IL-15 / hUC-MSCs number = 1000:1, and simultaneously supplement the proliferation medium twice that of A-hUC-NK. After that, only replenish the proliferation medium once every 4 days. If the bag is full, divide it into bags evenly;

[0141] E-hUC-NK, count the immune cells in the bag, and add hUC-MSCs to the bag at a ratio of total immune cell number: IL-15 / hUC-MSCs number = 1000:1, and simultaneously supplement with 2 times the proliferation medium of A-hUC-NK, and culture in a hypoxic incubator with oxygen concentrations of 1%, 2.5%, 5.0%, and 10%, respectively, and marked as E1, E2, E3, and E4. After that, only the proliferation medium is supplemented once every 4 days. If the bag is full, it is evenly divided into bags;

[0142] The expansion culture was stopped on the 28th day of culture, and the total number of NK cells in the eight treatment groups of A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, and E4-hUC-NK were counted, and the proportion of NK cells in each treatment group was detected by flow cytometry.

[0143] Example 9 hUC-NK in vitro tumor killing experiment

[0144] 1) In a 96-well culture plate, 5x10 3Human SMMC-7721 hepatoma cells were cultured in a final volume of 100 μL / well. Five replicate wells were inoculated in each group and cultured overnight in a 37°C, 5% CO2 incubator.

[0145] 2) After overnight culture, 2x10 4 Each well was co-cultured with 50 μL A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK and E4-hUC-NK in a 37°C, 5% CO2 incubator. After 2 h of co-culture, 10 μL of CCK-8 reagent was added to each well. After 6 h of co-culture, the culture was terminated and the absorbance of each well at 450 nm was detected by a microplate reader.

[0146] Example 10 hUC-NK in vivo tumor killing experiment

[0147] 1) 48 6-week-old immunodeficient nude mice were subcutaneously injected with 1×10 7 Human SMMC-7721 cells.

[0148] 2) Five days after tumor inoculation, the tumor-bearing mice were randomly divided into 6 groups: blank control group, A-hUC-NK injection group, B-hUC-NK injection group, C-hUC-NK injection group, D-hUC-NK injection group, and E-hUC-NK injection group.

[0149] 3) The control group was injected with 200 μL of normal saline via the tail vein each time, and the A-hUC-NK group, B-hUC-NK group, C-hUC-NK group, D-hUC-NK group, E1-hUC-NK group, E2-hUC-NK group, E3-hUC-NK group, and E4-hUC-NK group were injected with 1×10 cells via the tail vein each time. 6 The treatment lasted for 3 weeks. During this period, the tumor length (a mm) and tumor width (b mm) were measured with a vernier caliper every 3 days. The tumor volume (V) was calculated according to the following formula: T )

[0150] V T =0.5×a×b 2 / 2.

[0151] Effect example

[0152] 1. IL-15 PCR product detection

[0153] After 1% agarose gel electrophoresis, the PCR product showed a clear band at about 500 bp in the lane, and the fragment size was consistent with the theoretical value of the IL-15 exon size ( Figure 2 ).

[0154] 2. Identification of hUC-MSCs, Vector / hUC-MSCs, and IL-15 / hUC-MSCs

[0155] Flow cytometry showed that the positive rates of cell surface antigens CD73, CD90, and CD105 of IL-15 / hUC-MSCs cells cultured continuously to the third generation were all >98%, and the positive rates of CD34, CD11b, CD19, CD45, and HLA-DR were all <2% ( Figure 3 -A), which meets the general standards of human umbilical cord mesenchymal stem cells. In addition, after puromycin screening, fluorescence microscopy revealed that both Vector / hUC-MSCs and IL-15 / hUC-MSCs cells could stably express green fluorescent protein ( Figure 3 -B. Figure 3 -C).

[0156] 3. Detection of IL-15 secretion ability of IL-15 / hUC-MSCs

[0157] The ability of hUC-MSCs, Vector / hUC-MSCs, and IL-15 / hUC-MSCs to secrete IL-15 was tested using a human IL-15 ELISA kit. It was found that IL-15 / hUC-MSCs had a strong ability to secrete IL-15 compared with hUC-MSCs and Vector / hUC-MSCs, and the level of IL-15 secreted by them was significantly different from that of the former two ( Figure 4 ).

[0158] Table 3 Detection of IL-15 / hUC-MSCs secretion ability of IL-15

[0159]

[0160] 4. Proliferation and purity of hUC-NK cells

[0161] After 28 days of culture, the cell counting results showed that the number of cells harvested from the A-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, and E4-hUC-NK treatment groups were significantly higher than those from the B-hUC-NK and C-hUC-NK groups; and the number of cells in the E2-hUC-NK group was significantly higher than that in the other groups.

[0162] Table 4

[0163]

[0164] The results of flow cytometry showed that the proportion of NK cells (CD3-CD56+) in the cells harvested from the A-hUC-NK, D-hUC-NK, and E2-hUC-NK treatment groups was significantly higher than that in the other groups (such as Figure 6 and Table 5);

[0165] The number of NK cells in the E2-hUC-NK group was significantly higher than that in the A-hUC-NK group and the D-hUC-NK group ( Figure 6 and Table 5).

[0166] Table 5 Purity of hUC-NK cells

[0167]

[0168] 5. In vitro tumor killing experiment

[0169] A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, E4-hUC-NK groups were used as tumor killer cells, and human SMMC-7721 liver cancer cells were used as target cells. The above tumor killer cells were co-cultured with SMMC-7721 cells, and after 72 hours, the proliferation of SMMC-7721 cells in each group was detected by CCK8 method. The results showed that compared with the blank control group, B-hUC-NK, and C-hUC-NK groups, A-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, and E4-hUC-NK groups were able to significantly inhibit the proliferation of SMMC-7721 cells, among which the tumor inhibition effect of E2-hUC-NK was significantly better than that of other groups (such as Figure 7 and Table 6).

[0170] Table 6 NK cell in vitro tumor killing experiment

[0171]

[0172] 6. In vivo anti-tumor experiment

[0173] A nude mouse model of SMMC-7721 subcutaneous transplanted tumor was established. The tumor-bearing mice were infused with normal saline, A-hUC-NK, B-hUC-NK, C-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, and E4-hUC-NK cells by tail vein infusion, respectively. Anti-tumor experiments were carried out, with infusion twice a week for 3 consecutive weeks. The results showed that compared with the normal saline, B-hUC-NK, and C-hUC-NK groups, the tumor volume growth of A-hUC-NK, D-hUC-NK, E1-hUC-NK, E2-hUC-NK, E3-hUC-NK, and E4-hUC-NK groups was significantly slowed down, and the tumor growth rate of E2-hUC-NK group was further slowed down compared with other groups, which had obvious anti-tumor effects (such as Figure 8 and Table 7).

[0174] Table 7 NK cell in vivo tumor killing experiment

[0175]

[0176]

[0177] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for culturing natural killer cells, characterized in that: Pre-treating natural killer cells, mixing with mesenchymal stem cells, and culturing to obtain the natural killer cells; The method for culturing mesenchymal stem cells comprises the following steps: obtaining a recombinant plasmid containing IL-15, co-transfecting it with an auxiliary plasmid into 293T cells to obtain a lentivirus, and infecting the mesenchymal stem cells with the lentivirus; The recombinant plasmid includes: IL-15 gene and lentiviral vector plasmid pHBLV-CMV-MCS-EF1-Zsgreen1-T2A-puro; The sequence of IL-15 is as SEQ ID NO:1 shows: atgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgtttacttctaaacagtcattttctaactgaagctggcattcatgtcttcattttgggctgtttc agtgcagggcttcctaaaacagaagccaactgggtgaatgtaataagtgatttgaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgttcacc ccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttcacttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagttt gtcttctaatgggaatgtaacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttcttga; The auxiliary plasmids are: psPAX2 and PMG2.G; The mass ratio of the recombinant plasmid, the psPAX2 and the PMG2.G is 4:3:1; The oxygen concentration of the culture is 2.5%; The pre-processing includes the steps of activation; The mesenchymal stem cells are derived from the umbilical cord of a newborn; The natural killer cells are derived from human umbilical cord blood.

Images