An siRNA targeting AGT gene expression, its conjugate and use
By designing specific sequences and modified siRNAs and conjugates, the stability and side effects of siRNAs in inhibiting AGT gene expression are solved, and effective treatment and prevention of diseases such as hypertension are achieved.
Patent Information
- Application Number
- CN202410502939.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-16
- Filing Date
- 2024-04-25
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2044-04-25
AI Technical Summary
In the prior art, siRNA has poor stability when inhibiting AGT gene expression, is easily degraded by nucleases, and has side effects such as off-target effects, immune stimulation and cytotoxicity, making it difficult to effectively prevent and treat related diseases such as hypertension.
A siRNA was designed that contains specific sense strands and antisense strands, which differ by no more than 4 nucleotides, are 17-30 nucleotides in length, are partially complementary, and improve stability by modifying nucleotides, and form siRNA conjugates for targeting AGT gene expression, combining pharmaceutically acceptable conjugated molecules.
It improves the stability of siRNA in the blood, reduces cytotoxicity and immunostimulation, significantly inhibits AGT gene expression, has good antihypertensive effect, and is suitable for preventing and treating related diseases such as hypertension.
Smart Images

Figure QLYQS_1 
Figure BDA0004809262200000031 
Figure BDA0004809262200000041
Abstract
Description
Technical Field
[0001] The present invention relates to an siRNA for inhibiting angiotensinogen (AGT) gene expression, a conjugate thereof, a pharmaceutical composition, and use thereof in preventing and / or treating diseases related to abnormal blood pressure. Background Art
[0002] Angiotensinogen (AGT) is an important component of the renin-angiotensin system (RAS) in the human body. The entire RAS plays a key role in regulating blood pressure in animals. AGT is synthesized and secreted in the liver, and then angiotensin I is produced by the enzyme renin (REN), and then converted into angiotensin II by angiotensin-converting enzyme (ACE). Most angiotensin II can bind to type I angiotensin II receptors, causing vasoconstriction and increasing blood pressure. This molecule also stimulates the production of the hormone aldosterone, which triggers Na + The kidneys absorb ions and water, which leads to an increase in blood volume and further increases in blood pressure.
[0003] Hypertension is a serious condition that significantly increases the risk of heart, brain, and kidney disease, among other illnesses. According to the World Health Organization, an estimated 1.28 billion adults aged 30-79 worldwide suffer from hypertension. Only 42% of hypertensive patients receive diagnosis and treatment, and 21% have their blood pressure effectively controlled. Hypertension is a leading cause of premature death worldwide. Furthermore, according to a report in The Lancet (2019;394:1145-58), hypertension caused 2.54 million deaths in my country in 2017, ranking first among all risk factors for death.
[0004] Currently, first-line medications used clinically for the treatment of hypertension are divided into five major categories: angiotensin-converting enzyme inhibitors, angiotensin II receptor blockers, beta-adrenergic receptor blockers, dihydropyridine calcium channel blockers, and diuretics. These five antihypertensive drug classes have distinct mechanisms of action. Depending on the patient's age, severity of hypertension, and risk of related clinical complications, the average patient will receive one of these treatments. If one treatment option is inadequate, a combination of two or even three treatment options may be used. For high-risk patients, a combination of two or even three treatment options may be used. If all three treatment options fail to effectively control blood pressure, the condition is termed refractory hypertension. Refractory hypertension is a common and challenging problem in hypertension treatment. The development of effective, safe, stable, and long-acting antihypertensive drugs holds significant clinical value.
[0005] The present application provides a small interfering RNA (siRNA) preparation targeting AGT, which can specifically bind to AGT mRNA, destroy the normal translation template function of AGT mRNA, thereby preventing it from translating AGT protein, inhibiting the RAS pathway from the source, and is used to treat / prevent related diseases caused by the RAS pathway, such as hypertension, including refractory hypertension and uncontrollable hypertension.
[0006] Compared to traditional drugs, siRNA has poor stability and is susceptible to nuclease degradation when administered systemically. Furthermore, efforts are needed to further enhance its activity while avoiding side effects such as off-target effects, immune stimulation, and cytotoxicity. Therefore, developing more candidate siRNAs that are stable in the blood, exhibit good biological activity, have low cytotoxicity, and can effectively inhibit AGT gene expression over a long period of time is an urgent task. Furthermore, the development of drugs that can effectively prevent and / or treat hypertension-related diseases using these candidate siRNAs that inhibit AGT gene expression requires clinical research and is commercially viable. Summary of the Invention
[0007] The present invention provides an siRNA for inhibiting AGT gene expression, characterized in that: the siRNA comprises a sense strand and an antisense strand; wherein the antisense strand comprises at least 17 consecutive nucleotides that differ by no more than 4 nucleotides from the nucleotide sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:68, and the antisense strand is 17 to 30 nucleotides in length; the sense strand is 17 to 30 nucleotides in length and is at least partially complementary to the antisense strand.
[0008] The term "at least partially complementary" means that the two sequences are completely complementary, or have no more than 5, 4, 3 or 2 mismatched base pairs overall, while retaining the ability to hybridize under relevant conditions.
[0009] In some embodiments of the present invention, the antisense strand differs from any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:68 by no more than 4 nucleotides; in some embodiments of the present invention, the antisense strand differs from any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:68 by no more than 3 nucleotides; in some embodiments of the present invention, the antisense strand differs from any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:68 by no more than 2 nucleotides; in some embodiments of the present invention, the antisense strand differs from any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:68 by no more than 1 nucleotide; in some embodiments of the present invention, the antisense strand is any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:68.
[0010] In some embodiments of the present invention, the sense strand and the antisense strand have no more than 3 nucleotide mismatches; in some embodiments of the present invention, the sense strand and the antisense strand have no more than 2 nucleotide mismatches; in some embodiments of the present invention, the sense strand and the antisense strand have no more than 1 nucleotide mismatch; in some embodiments of the present invention, the sense strand and the antisense strand are fully complementary.
[0011] Preferably, the sense strand has at least 15, 16, 17, 18, 19, 20 or 21 nucleotides of complementarity with the antisense strand.
[0012] In some embodiments of the present invention, the antisense strand is 19 to 27 nucleotides in length; and the sense strand is 19 to 25 nucleotides in length.
[0013] In some embodiments of the present invention, the antisense strand is 19 to 23 nucleotides in length; and the sense strand is 19 to 21 nucleotides in length.
[0014] In some embodiments of the present invention, the antisense strand is 23 nucleotides in length and the sense strand is 21 nucleotides in length. In some embodiments of the present invention, the antisense strand is 21 nucleotides in length and the sense strand is 21 nucleotides in length. In some embodiments of the present invention, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length. In some embodiments of the present invention, the antisense strand is 19 nucleotides in length and the sense strand is 19 nucleotides in length.
[0015] In some embodiments of the present invention, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, an overhang of 1, 2, 3, or 4 nucleotides. In some embodiments of the present invention, the overhang can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments of the present invention, the overhang is present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA.
[0016] In some embodiments of the present invention, the 3' end of the antisense strand of the siRNA has an overhang of 2 nucleotides.
[0017] In some embodiments of the invention, the siRNA has blunt ends. In some embodiments of the invention, the siRNA has at least one blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand).
[0018] In some embodiments of the invention, the siRNA has two blunt ends.
[0019] In some embodiments of the present invention, the 3' end of the antisense strand of the siRNA has an overhang of 2 nucleotides.
[0020] In some embodiments of the present invention, the nucleotide sequence (5'→3') of the siRNA is selected from the sequence of duplex 1 to duplex 68;
[0021]
[0022]
[0023]
[0024]
[0025] Preferably, the sequence of the siRNA is selected from the sequence of duplex 35, duplex 37, duplex 38, duplex 39, duplex 42, duplex 44, duplex 45, duplex 49, duplex 53, duplex 54, duplex 55, duplex 56, duplex 58, duplex 59, duplex 61, duplex 62, duplex 63, duplex 64, duplex 65, duplex 66, duplex 67 or duplex 68.
[0026] In some embodiments of the present invention, the siRNA contains at least one modified nucleotide.
[0027] In some embodiments of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.
[0028] In some embodiments of the present invention, the modified nucleotide is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-split nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides (LNA), unlocked nucleotides (UNA) or glycerol nucleotides (GNA), but the present invention is not limited thereto.
[0029] In some embodiments of the present invention, the siRNA modified nucleotide sequence is selected from:
[0030] 1) The nucleotides at positions 7, 9, 10, and 11 on the 5' end of the sense strand are 2'-fluoro nucleotides, and there is at least one 2'-fluoro nucleotide at the remaining positions; and / or
[0031] 2) The 2nd, 6th, 8th, 9th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one 2'-fluoro nucleotide at the remaining positions; and / or
[0032] 3) The 2nd, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one glycerol nucleotide at the remaining positions;
[0033] 4) The 6th, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and there is at least one 2'-deoxynucleotide at the remaining positions.
[0034] In some embodiments of the present invention, the siRNA modified nucleotide sequence is selected from:
[0035] 1) The nucleotides at positions 7, 9, 10, 11, and 15 on the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and / or
[0036] 2) the 2nd, 6th, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining nucleotides are 2'-methoxy nucleotides; and / or
[0037] 3) the 2nd, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, the 6th position is a glycerol nucleotide, and the remaining positions are 2'-methoxy nucleotides; and / or
[0038] 4) the 2nd, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, the 4th nucleotide is a glycerol nucleotide, and the remaining positions are 2'-methoxy nucleotides; and / or
[0039] 5) the 2nd, 8th, 9th, 10th, 14th, and 16th nucleotides at the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5th position is a glycerol nucleotide, and the remaining positions are 2'-methoxy nucleotides; and / or
[0040] 6) The nucleotides 2, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, the 7th position is a glycerol nucleotide, and the remaining positions are 2'-methoxy nucleotides;
[0041] 7) Nucleotides 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, nucleotides 2, 5, 7, and 12 are 2'-deoxy nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0042] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0043] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0044] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0045] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0046] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0047] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 3, 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0048] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0049] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 3, 4, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein position 2 at the 5' end of the sense strand is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.
[0050] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 4, 5, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein position 2 at the 5' end of the sense strand is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.
[0051] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 4, 6, 7, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein position 2 at the 5' end of the sense strand is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides.
[0052] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0053] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0054] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 6, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, position 7 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0055] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, position 6 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0056] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, position 4 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0057] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, position 5 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0058] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 8, 9, 10, 14, and 16 of the 5' end of the antisense strand are 2'-fluoro nucleotides, position 7 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, 11, and 15 of the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0059] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, position 6 is a glycerol nucleotide (GNA), and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0060] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 5, 7, and 12 of the 5' end of the antisense strand are 2'-deoxynucleotides, position 14 is a 2'-fluoro nucleotide, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides in length, wherein positions 9, 10, and 11 of the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0061] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein positions 2, 5, 7, and 12 of the 5' end of the antisense strand are 2'-deoxynucleotides, positions 6, 8, 9, 10, 14, and 16 are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 of the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0062] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 5, 7, and 9 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0063] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0064] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides in length, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0065] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides in length, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0066] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides in length, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0067] In some embodiments of the present invention, the antisense strand of the siRNA is 19 nucleotides in length, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, and 18 at the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.
[0068] In some embodiments of the present invention, the modified nucleotide is a nucleotide in which the phosphate group is modified with a phosphorothioate group, that is, a non-bridging oxygen atom in the phosphodiester bond is replaced with a sulfur atom, thereby replacing the phosphodiester bond with a phosphorothioate diester bond.
[0069] In some embodiments of the present invention, the 5' and 3' ends of the sense strand independently contain 1 or 2 phosphorothioate linkages; and / or the 5' and 3' ends of the antisense strand independently contain 1 or 2 phosphorothioate linkages.
[0070] In some embodiments of the present invention, at least one of the nucleotides between the 1st and 2nd positions at the 5' end of the sense chain, between the 2nd and 3rd positions at the 5' end of the sense chain, between the 1st and 2nd positions at the 3' end of the sense chain, between the 2nd and 3rd positions at the 3' end of the sense chain, between the 1st and 2nd positions at the 3' end of the antisense chain, between the 2nd and 3rd positions at the 3' end of the antisense chain, between the 1st and 2nd positions at the 5' end of the antisense chain, and between the 2nd and 3rd positions at the 5' end of the antisense chain is connected by a thiophosphate group; preferably, at least four of the nucleotides are connected by thiophosphate groups; in some embodiments of the present invention, at least six of the nucleotides are connected by thiophosphate groups; in some embodiments of the present invention, all eight of the nucleotides are connected by thiophosphate groups.
[0071] In some embodiments of the present invention, the nucleotides at positions 1 and 2, and the nucleotides at positions 2 and 3 at the 5' end of the sense strand are linked by phosphorothioate groups.
[0072] In some embodiments of the present invention, the nucleotides at positions 1 and 2 and the nucleotides at positions 2 and 3 of the 5' end of the sense strand are linked by phosphorothioate groups, and the nucleotides at positions 1 and 2 and the nucleotides at positions 2 and 3 of the 3' end are linked by phosphorothioate groups.
[0073] In some embodiments of the present invention, the nucleotides at positions 1 and 2 and the nucleotides at positions 2 and 3 at the 3' end of the antisense strand are linked by phosphorothioate groups, and the nucleotides at positions 1 and 2 and the nucleotides at positions 2 and 3 at the 5' end are linked by phosphorothioate groups.
[0074] In some embodiments of the present invention, the nucleotides between the 1st and 2nd positions at the 5' end of the sense chain, the nucleotides between the 2nd and 3rd positions at the 5' end of the sense chain, the nucleotides between the 1st and 2nd positions at the 3' end of the antisense chain, the nucleotides between the 2nd and 3rd positions at the 3' end of the antisense chain, the nucleotides between the 1st and 2nd positions at the 5' end of the antisense chain, and the nucleotides between the 2nd and 3rd positions at the 5' end of the antisense chain are all linked by phosphorothioate groups.
[0075] In some embodiments of the present invention, the sense strand may include one or more blocking residues or moieties, referred to as "blocking residues." A "blocking residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of the siRNA. In some embodiments of the present invention, the blocking residue is present at the 5' end, the 3' end, or both the 5' end and the 3' end of the sense strand.
[0076] In some embodiments of the present invention, an inverted abasic residue (iab) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments of the present invention, the 5' end and / or 3' end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.
[0077] In some embodiments of the invention, one or more inverted abasic residues (iab) are added to the 3' end of the sense strand. In some embodiments of the invention, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments of the invention, one or more inverted abasic residues can be inserted between the linker-targeting ligand portion and the nucleotide sequence of the siRNA sense strand. In some embodiments of the invention, one or more inverted abasic residues are included at or near one or more ends of the siRNA sense strand.
[0078] In some embodiments of the invention, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments of the invention, one or more inverted abasic residues may be inserted between the linker-targeting ligand portion and the nucleotide sequence of the siRNA sense strand.
[0079] Inverted abasic residues can be linked via phosphate, phosphorothioate, or other internucleoside linkages.
[0080] In some embodiments of the present invention, the first nucleotide at the 5' end of the antisense strand is selected from the following structures:
[0081]
[0082] Wherein, Basse is base A, U, G, C, T or other nucleotide bases.
[0083] In some embodiments of the present invention, the first nucleotide at the 5' end of the antisense strand is selected from the following structures:
[0084]
[0085] Wherein, Basse is base A, U, G, C, T or other nucleotide bases.
[0086] In some embodiments of the present invention, the first nucleotide at the 5' end of the antisense strand is a (E)-vinyl phosphate-modified nucleotide.
[0087] In some specific embodiments of the present invention, the modified nucleotide sequence of the siRNA is selected from modified duplex 1 to modified duplex 228.
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105] The present invention also provides a siRNA conjugate obtained by conjugating the above siRNA with a conjugation molecule.
[0106] In the present invention, unless otherwise specified, "conjugation" refers to the covalent attachment of two or more chemical moieties; "conjugate" refers to a compound formed by covalent attachment of chemical moieties; and "siRNA conjugate" refers to a compound formed by covalent attachment of one or more chemical moieties to an siRNA. It should be noted that each chemical moiety can be attached to the siRNA directly or via a linker.
[0107] In the present invention, unless otherwise specified, the “-” in “linker-targeting ligand” means that the linker and the targeting ligand are covalently linked.
[0108] In some embodiments of the invention, the targeting ligand is attached to the siRNA via a linker to form a conjugate molecule.
[0109] In some embodiments of the present invention, the siRNA of the present invention can be conjugated with a pharmaceutically acceptable conjugate molecule to obtain an siRNA conjugate. In some embodiments of the present invention, the siRNA is covalently conjugated to the conjugate molecule. To reduce the potential impact of conjugation on siRNA activity, the conjugation site of the siRNA to the conjugate molecule can be at the 3' end or 5' end of the siRNA sense strand, or at the 5' end of the antisense strand. In some embodiments, the conjugation site of the siRNA to the conjugate molecule can also be within the internal sequence of the siRNA.
[0110] The pharmaceutically acceptable targeting ligand can be a targeting ligand conventionally used in the field of siRNA administration, such as, but not limited to, one or more of the following targeting ligands or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); or receptor ligands expressed by hepatocytes, such as asialoglycoproteins, asialoglycosylated residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as epinephrine), growth factors, transferrin, etc.
[0111] In some embodiments of the present invention, the targeting ligand is N-acetylgalactosamine.
[0112] In some embodiments of the invention, the targeting ligand is directly linked to the 3' end of the siRNA sense strand.
[0113] In some embodiments of the invention, the targeting ligand is directly linked to the 5' end of the sense strand of the siRNA.
[0114] In some embodiments of the present invention, the targeting ligand is linked to the 3' end of the sense strand of the siRNA via a linker. In some embodiments of the present invention, the targeting ligand is linked to the 5' end of the sense strand of the siRNA via a linker.
[0115] In some embodiments of the present invention, the targeting ligand is N-acetylgalactosamine, which is linked to the 3' end of the siRNA sense strand via a linker.
[0116] In some embodiments of the present invention, the targeting ligand linker portion is GalNAc(L96) having the following structure:
[0117]
[0118] In some embodiments of the invention, GalNAc(L96) is linked to the 3' end of the sense strand of the siRNA.
[0119] In some embodiments of the invention, GalNAc(L96) is linked to the 5' end of the sense strand of the siRNA.
[0120] In some embodiments of the invention, GalNAc(L96) is linked to the inverted abasic residue (iab) at the 3' end of the siRNA sense strand.
[0121] In some embodiments of the invention, GalNAc(L96) is linked to the inverted abasic residue (iab) at the 5' end of the siRNA sense strand.
[0122] In some embodiments of the present invention, the targeting ligand linker portion is Ser(GN) having the following structure:
[0123]
[0124] In some embodiments of the invention, Ser(GN) is linked to the 3' end of the sense strand of the siRNA. In some embodiments of the invention, Ser(GN) is linked to the 5' end of the sense strand of the siRNA.
[0125] In some embodiments of the present invention, Ser(GN) is attached to both the 3' end and the 5' end of the sense strand of the siRNA.
[0126] In some embodiments of the present invention, the siRNA conjugate is selected from the group consisting of Conjugate 1 to Conjugate 308;
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150] The present invention also provides a pharmaceutical composition comprising any of the above-mentioned siRNAs and / or any of the above-mentioned siRNA conjugates and a pharmaceutically acceptable carrier.
[0151] In some embodiments of the present invention, the pharmaceutical composition contains one siRNA as described in the first aspect. In other embodiments of the present disclosure, the pharmaceutical composition contains at least two siRNAs as described in the first aspect (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) as active ingredients. Preferably, the at least two siRNAs as described in the first aspect each target a different target sequence in the AGT gene, thereby being expected to act simultaneously against different target sequences and bring about a synergistic effect. Here, the so-called "different target sequences" refers to the absence of overlap between target sequences, or the number of overlapping consecutive nucleotides between target sequences is less than 5 (for example, the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs as described in the first aspect can be present in any different ratios. Preferably, the at least two siRNAs as described in the first aspect are present in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs as described in the first aspect are present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments of the present invention, the at least two siRNAs as described in the first aspect are present in the same molar ratio.
[0152] The present invention also provides use of any of the above siRNAs and / or any of the above siRNA conjugates and / or the above pharmaceutical compositions in the preparation of a medicament for treating and / or preventing pathological conditions or diseases associated with overexpression of the AGT gene.
[0153] Furthermore, the pathological condition or disease is a disease associated with abnormal blood pressure.
[0154] The siRNA, siRNA conjugate and pharmaceutical composition provided by the present invention have good stability, excellent AGT gene inhibition activity, satisfactory cytotoxicity and immunostimulation, and can significantly reduce blood pressure levels.
[0155] In the present invention, "siRNA" refers to an oligonucleotide molecule containing RNA or RNA-like (e.g., chemically modified RNA) that can reduce or inhibit the translation of messenger RNA (mRNA) in a sequence-specific manner. siRNA can act through an RNA interference mechanism (e.g., by inducing mRNA degradation through interaction with the mRNA interference pathway mechanism (RNA-induced silencing complex RISC) of mammalian cells), or other arbitrary mechanisms or pathways. Although it is believed that the term siRNA drug used in the present invention mainly acts through the RNA interference mechanism, the siRNA drug is not limited to or restricted to any specific pathway or mechanism of action. siRNA drugs include, but are not limited to, single-stranded antisense oligonucleotides, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer enzyme substrates. The siRNA drug of the present invention is composed of an oligonucleotide chain that is at least partially complementary to the target mRNA. In some embodiments, the siRNA drug of the present invention is double-stranded and consists of an antisense chain and a sense chain that is at least partially complementary to the antisense chain.
[0156] The term "sequence" or "nucleotide sequence" refers to the order or sequence of nucleobases or nucleotides, expressed in alphabetical order using standard nucleotide nomenclature.
[0157] In the present invention, unless otherwise specified, capital letters C, G, U, A, and T represent the base composition of nucleotides, including modified and unmodified nucleotides; lowercase letter m indicates that the nucleotide adjacent to the right of the identifier m is a 2'-methoxy nucleotide; lowercase letter f indicates that the nucleotide adjacent to the right of the identifier f is a 2'-fluoro nucleotide; lowercase letter d indicates that the nucleotide adjacent to the right of the identifier d is a 2'-deoxy nucleotide; gn indicates that the nucleotide adjacent to the right of the identifier gn is a glycerol nucleotide (GNA); the identifier * indicates that the two nucleotides adjacent to the left and right of the identifier * (or between the nucleotide and the linker-targeting ligand portion) are linked by phosphorothioate groups; eVP indicates that the nucleotide adjacent to the right is a (E)-vinyl phosphate-modified nucleotide; iab indicates an inverted abasic residue; GalNAc(L96) indicates that the linker-targeting ligand portion GalNAc(L96) is conjugated to the site. Ser(GN) indicates that the linker-targeting ligand portion Ser(GN) is conjugated to the site.
[0158] In the present invention, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or generally have no more than 5, 4, 3, or 2 mismatched base pairs, while retaining the ability to hybridize under relevant conditions. In addition, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for the purpose of determining complementarity. In the present invention, when meeting the above hybridization ability requirements, "complementary" sequences may also include or be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairs or Hoogstein base pairs. Correspondingly, in the present invention, unless otherwise specified, "mismatch" means that the bases at corresponding positions in the siRNA duplex molecule are not paired in a complementary form.
[0159] In the present invention, unless otherwise specified, "a difference in nucleotide sequence" refers to a change in the base type of the nucleotide at the same or corresponding position compared to the original nucleotide sequence. For example, if one nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., a difference in nucleotide sequence is considered to exist at that position. It should be noted that if the nucleotide at the same or corresponding position differs only in the presence or type of modification compared to the original nucleotide sequence, a difference in nucleotide sequence is not considered to exist at that position.
[0160] The term "sense strand" refers to the strand on the RNA molecule that carries the nucleotide sequence encoding protein amino acid information, which is called the sense strand, also known as the coding strand, sense strand or positive strand, and the other nucleotide sequence that is complementary to it is the antisense strand.
[0161] The term "antisense strand" refers to a nucleotide sequence in the mRNA expressed by the target gene that is substantially reverse complementary or essentially reverse complementary to a nucleotide sequence having the same length as the antisense strand.
[0162] In the present invention, unless otherwise specified, the term "pharmaceutically acceptable" means that the carrier, vehicle, diluent, excipient and / or the salt / ester / hydrate formed therefrom are generally chemically or physically compatible with other ingredients constituting a pharmaceutical dosage form and physiologically compatible with the receptor.
[0163] In the present invention, unless otherwise specified, the term "inhibit" refers to the down-regulation of target gene expression due to siRNA-mediated degradation of target gene mRNA. The "down-regulation" refers to a decrease in target gene expression by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, relative to the absence of siRNA treatment. A 100% decrease in target gene expression means no detectable level of target gene expression.
[0164] In the present invention, the siRNA may further contain modified nucleotides as needed, provided that the modified nucleotides do not significantly weaken or abolish the siRNA's ability to inhibit AGT gene expression. Currently, there are a variety of methods available in the art for modifying siRNA, including backbone modifications (e.g., phosphate group modifications), ribose group modifications, and base modifications (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).
[0165] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.
[0166] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. DETAILED DESCRIPTION
[0167] It is known to those skilled in the art that the siRNA of the present invention can be obtained by conventional siRNA preparation methods in the art (e.g., solid phase synthesis and liquid phase synthesis), wherein both solid phase synthesis and liquid phase synthesis are commercially available. It is also clear to those skilled in the art that modified nucleotide groups can be introduced into the siRNA of the present invention by using nucleotide monomers with corresponding modifications. Methods for preparing nucleotide monomers with corresponding modifications are well known to those skilled in the art, and commercial monomers are also available on the market.
[0168] Example 1: siRNA synthesis
[0169] For the sense and antisense chains of the siRNA of the present invention, CPG was used as a solid phase carrier; GalNAc(96)-modified CPG was used as the starting cycle for the synthesis of the sense chain, and universal CPG was used as the starting cycle for the antisense chain.
[0170] Using a YB-192S synthesizer and a phosphoramidite triester solid phase synthesis method, starting with a solid phase support, nucleoside monomers were sequentially connected in the 3'-5' direction to perform sequence synthesis on a synthesis scale of 0.2 μmol.
[0171] Phosphoramidite monomers were linked via a four-step chemical reaction cycle of deprotection, coupling, oxidation / sulfurization, and capping. The phosphoramidite monomers were prepared in a 0.05 M acetonitrile solution, the activator was 0.3 M BTT in acetonitrile, the deprotection reagent was a 3% trichloroacetic acid / dichloromethane solution, the oxidation reagent was a 0.05 M iodine / pyridine / tetrahydrofuran / water solution (v / v / v = 2 / 1 / 7), the capping reagent A was acetic anhydride / acetonitrile solution (v / v = 2 / 8), the capping reagent B was pyridine / nitromethylimidazole / tetrahydrofuran (v / v / v = 10 / 16 / 74), and the sulfation reagent was a 0.05 M DDTT in pyridine / acetonitrile solution (v / v = 4 / 6).
[0172] After solid-phase synthesis, transfer the support to a 2 mL centrifuge tube, add 0.8 mL of concentrated aqueous ammonia, and seal the tube for reaction at 55°C for 16 hours. After cooling to room temperature, transfer the solution to a 2 mL centrifuge tube, concentrate, and spin dry. Dissolve the solution in 0.2 mL of anhydrous DMSO, then add 0.25 mL of triethylamine trihydrofluoride and react at 65°C for 2 hours. After the reaction, cool to room temperature and precipitate with ethanol to obtain the crude product.
[0173] The crude product was purified using reverse-phase HPLC, and the fractions were collected and lyophilized. Ethanol precipitation was performed by adding 0.3 mL of 1 M sodium acetate solution and 0.9 mL of ethanol to replace the sequence with the sodium salt. Desalination was then performed using a 3KD ultrafiltration tube to remove excess free salts.
[0174] The sense chain and the antisense chain were prepared into an aqueous solution of a certain concentration, the sense chain / antisense chain were mixed according to a molar ratio (1:1.05), incubated at 95°C for 5 minutes, then naturally cooled to room temperature, and freeze-dried to obtain the target product.
[0175] Example 2: In vitro activity detection
[0176] Cell culture and transfection
[0177] Cell culture: Hep3B cells (ATCC) were cultured in MEM complete medium (Gibco, supplemented with 10% FBS) at 37°C in a 5% CO2 environment until nearly confluent. The cells were then trypsinized and plated in a 96-well plate with 2.0 × 10 5 Hep3B cells and 1.0 mL of MEM complete medium (Gibco, supplemented with 10% FBS) were cultured at 37° C. in a 5% CO 2 environment for 16-24 hours before transfection.
[0178] Cell transfection: 0.15 μL of lipofectamine RNAiMax (Invitrogen) was added to 4.85 μL of opti-MEM per well, followed by 5.0 μL of siRNA. The mixture was added to a PCR tube and incubated at room temperature for 5 minutes. The siRNA mixture was then added to the cells and cultured for 24 hours before RNA extraction. Single-dose experiments were performed at 10 nM and 0.1 nM or 0.1 nM and 0.01 nM siRNA duplex concentrations. IC 50 Test experiments were performed at 10 nM, 1.0 nM, 0.1 nM, 0.01 nM, 0.001 nM, 0.0001 nM and 0.00001 nM siRNA duplex concentrations.
[0179] RNA extraction
[0180] Use the total RNA isolation kit (Omega, cat: R6834-02): collect cells, wash with 1% PBS, and then add an appropriate lysis buffer (containing 2% β-mercaptoethanol) to lyse the cells. Follow the subsequent steps according to the instructions of the RNA isolation kit. Finally, add 30 μL of RNase-free water, let it stand for 2 minutes, and then centrifuge at 14,000g for 2 minutes to collect RNA.
[0181] cDNA synthesis
[0182] cDNA synthesis was performed using the Quanshijin gDNA removal cDNA synthesis kit (Beijing Quanshijin Biotechnology Co., Ltd., Beijing, China, Cat#AE311-03). 1 μg of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (LongGene, A600) according to the manufacturer's instructions.
[0183] Real-time fluorescence quantitative PCR
[0184] The synthesized cDNA and mixed master solution (including primers, qPCR premix and ultrapure water) were added to a 384-well plate (Biocon Biotechnology Cat# PC-0040-9U). The final real-time fluorescence quantitative PCR system contained 0.25 μM of upstream and downstream primers of the target gene (AGT) or internal reference gene (GADPH) and 1× SYBR Green premix (Applied Biosystem Cat# A25742).
[0185] Use the ΔΔCt assay in ABIQuantStudio TM Real-time fluorescence PCR was performed in a 6-well real-time fluorescence PCR system. Each duplex was tested for 3-4 independent transfections, and each transfection was performed in triplicate.
[0186] Human / Cynomolgus Monkey Liver Primary Cells
[0187] Free uptake: thaw frozen human or cynomolgus monkey liver primary cells, count the viable cells, and adjust the density (6×10 5 Add 10 μL of 10× compound to the collagen-coated cell culture plate and aliquot 90 μL (5.4×10 4 The cell suspension (1000 cells / well) was transferred to a 96-well collagen-coated plate. The cell plate was incubated in a 37°C, 5% CO2 incubator for 48 hours. Single-dose experiments were performed at 10 nM and 0.1 nM siRNA duplex concentrations. 50 Experiments were tested at 10 nM, 3.33 nM, 1.11 nM, 0.37 nM, 0.12 nM, 0.041 nM, 0.014 nM and 0.0046 nM siRNA duplex concentrations.
[0188] cDNA synthesis: After 48 hours of free uptake, remove the culture medium and lyse the cells for RNA extraction. Use according to the kit instructions. Total RNA was extracted using the QIAGEN-74182 RT Kit, and cDNA was synthesized using the FastKing RT Kit (with gDNase) (Tiangen-KR116-02) according to the manufacturer's instructions.
[0189] Real-time fluorescence quantitative PCR: The synthesized cDNA and mixed master mix (including primers, qPCR premix, and ultrapure water) were added to a 384-well plate. The final real-time fluorescence quantitative PCR system contained 0.25 μM each of the upstream and downstream primers of the target gene (AGT) or internal reference gene (GADPH), 0.125 μM of the probe, and 1× Universal Probe Master premix (Roche, Cat. No. 04914058001).
[0190] The ΔΔCt assay was performed in ABI QuantStudio TM 6 Real-time fluorescence PCR was performed in a real-time fluorescence PCR system. Each duplex was tested for 3-4 independent transfections, and each transfection was assayed in triplicate. The in vitro activity test results of some siRNA conjugates are shown in the table below. Among them, PC a (sense chain: GUCAUCCACAAUGAGAGUAdCdA; antisense chain: UGUACUCUCAUUGUGGAUGACGA) and PC c (sense chain: mG*mU*mCmAmUmCfCmAfCfAfAmUmGmAmGmAmGmUmAmCmAGalNAc(L96); antisense chain: mU*fG*mUmAmCgnTmCmUmCmAmUmUmGfUmGfGmAmUmGmAmC*mG*mA), which are known to have an AGT gene inhibitory effect, were used as positive controls.
[0191] Table 1. Single-dose test results of duplex Hep3B
[0192]
[0193]
[0194] Table 2. IC in duplex Hep3B 50 Detection
[0195] Duplex number <![CDATA[IC 50 (pM)]]> Duplex number <![CDATA[IC 50 (pM)]]> Duplex 35 0.427 Duplex 37 1.313 Duplex 39 0.396 Duplex 42 0.748 Duplex 44 0.595 PC a 0.393
[0196] Table 3. Single-dose test of conjugates in Hep3B
[0197]
[0198]
[0199] Table 4. Free uptake activity of primary cynomolgus monkey liver cells at a single dose
[0200]
[0201] Table 5. Single-dose free uptake activity of human primary liver cells
[0202]
[0203]
[0204] Table 6. Hep3B cell transfection IC 50
[0205] Conjugate number <![CDATA[IC 50 (pM)]]> Conjugate 30 30.84 Conjugate 31 5.585 Conjugate 116 1.305 PC c 9.288
[0206] Table 7. IC free uptake by human primary liver cells 50
[0207] Conjugate number <![CDATA[IC 50 (nM)]]> Conjugate 10 0.770 Conjugate 30 0.363 Conjugate 31 0.262 Conjugate 86 0.578 Conjugate 116 0.199 PC c 0.148
[0208] The above experimental results indicate that the siRNA or siRNA conjugate of the present invention has an excellent effect of inhibiting the expression of the AGT gene in cells.
[0209] Example 3 Detection of hAGT activity in mice
[0210] 6-8 week old male hAGT humanized mice (provided by Jiangsu Jicui, T054372). The mice were not fasted before group administration, and blood was collected to separate serum for ELISA (abcam#) detection of hAGT. The mice were randomly divided into 4 groups according to hAGT levels, with 6 mice in each group, defined as day 0. On Day 1, PBS, PC c, conjugate 30, conjugate 31 and conjugate 116 were subcutaneously injected, with a drug dose of 3 / 10 mpk. After administration, blood was collected on day 8, day 15, day 22, day 29, day 36, and day 43 for separation of serum and hAGT detection by ELISA. The serum protein concentration of each group at each time point was compared with the serum protein concentration of the PBS group at that time point. The detection results of different conjugates are shown in Table 8.
[0211] Table 8. Changes in hAGT protein expression before and after administration of siRNA conjugates
[0212]
[0213] The above experimental results show that the siRNA conjugate of the present invention has a significant inhibitory effect on AGT gene expression in mice.
[0214] In summary, the siRNA and siRNA conjugates of the present invention have excellent inhibitory effects on AGT gene expression in cells and also have significant inhibitory effects on AGT gene expression in mice, and may become new siRNA drugs for inhibiting AGT gene expression.
Claims
1. An siRNA conjugate, characterized in that: The siRNA conjugate is selected from conjugate 30 and conjugate 31. The sense strand of conjugate 30 is mA*mG*mGmGmUmCfUmCfAfCfUmUmUmCfCmAmGmCmA*mA*mUGalNAc (L96), and the antisense strand is eVPmA*fU*mUmGmCfUmGfGfAfAmAmGmUfGmAfGmAmCmCmCmU*mC*mC; the sense strand of the conjugate 31 is mA*mG*mGmGmUmCfUmCfAfCfUmUmUmCfCmAmGmCmA*mA*mUGalNAc(L96), and the antisense strand is eVPmA*fU*mUmGmCgnTmGfGfAfAmAmGmUfGmAfGmAmCmCmCmU*mC*mC, where m indicates that a nucleotide adjacent to the right of the label m is a 2'-methoxy nucleotide, f indicates that a nucleotide adjacent to the right of the label f is a 2'-fluoro nucleotide, gn indicates that a nucleotide adjacent to the right of the label gn is a glycerol nucleotide (GNA), the label * indicates that there is a phosphorothioate linkage between two nucleotides adjacent to the left and right of the label * or between a nucleotide and the linker-targeting ligand moiety, eVP indicates that a nucleotide adjacent to the right of it is an (E)-vinyl phosphate-modified nucleotide, GalNAc(L96) means that the linker-targeting ligand moiety GalNAc(L96) is conjugated at this position, and the structure of GalNAc(L96) is .
2. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the siRNA conjugate according to claim 1 and a pharmaceutically acceptable carrier.
3. Use of the siRNA conjugate according to claim 1 and / or the pharmaceutical composition according to claim 2 in the preparation of a medicament for treating and / or preventing a pathological condition or disease associated with overexpression of the AGT gene.
4. The use according to claim 3, wherein: The pathological condition or disease is a disease associated with abnormal blood pressure.
Citation Information
Patent Citations
Treatment of eye disorders characterized by an elevated intraocular pressure by sirnas
CN101076590A
Nucleic acid targeting angiotensinogen and application thereof
CN114763547A