A kit and method for breeding wool traits of Qinghai Tibetan sheep

Abstract

The present invention provides a kit and method for breeding wool traits of Qinghai Tibetan sheep, belonging to the field of SNP detection. The present invention provides a screening kit for sheep with long braid length, which includes a reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome. The present invention also provides a screening method for sheep with long braid length. The kit and method of the present invention effectively screen sheep with long braid length, quickly determine sheep populations with excellent braid length traits, are of great significance for improving the wool performance of Tibetan sheep, and have very good application prospects.

Description

Technical Field

[0001] The invention belongs to the field of SNP technology, and particularly relates to a kit and a method for breeding wool traits of Qinghai Tibetan sheep. Background Art

[0002] Tibetan sheep, also known as Tibetan sheep or Tibetan-line sheep, are one of my country's three original sheep breeds. Due to their wide distribution and diverse geographical and climatic characteristics, they are divided into distinct types. Three types are distinguished in Qinghai Province: plateau (grassland), valley, and Oula. Plateau-type Tibetan sheep, the main breed of Tibetan sheep and the largest in number, have predominantly white back hair, a heterogeneous coat with long fibers and a high content of bimodal hair. The straight length of the side braids in adult males is 28.72 ± 3.94 cm, and in adult ewes is 25.81 ± 5.54 cm. Plateau-type Tibetan sheep, as the main breed of Tibetan sheep, are a high-altitude livestock species with unique resource value. Tibetan wool, widely known as "Xining wool," is a source of high-quality carpet wool. The Tibetan carpet industry is a highly competitive, export-oriented industry in Qinghai, currently exported to over 40 countries and regions.

[0003] Plateau Tibetan sheep wool is renowned for its long, uniform fibers, strength, and excellent resilience. It is a high-quality raw material for carpets and jacquard rugs, and its luster increases with age, significantly surpassing wool fabrics from other regions. However, with the sluggish wool market and the booming mutton sheep industry, the Tibetan sheep industry has gradually shifted towards meat production, weakening the selection and breeding of carpet wool traits. Research has seriously lagged behind, and the genetic characteristics of wool production have long been poorly explored and sustainably bred. Tibetan wool quality has deteriorated to varying degrees, primarily manifested in shortened wool length and an increased proportion of dead hair. This has led to the loss of high-quality germplasm resources, hindering the development of distinctive local sheep breeds. Molecular marker-based germplasm discovery and molecular breeding techniques, with their high selection accuracy, short breeding time, and low cost, have become the mainstream breeding methods currently and in the future. Therefore, the discovery of key genes or molecular markers provides valuable genetic data for establishing a molecular breeding system for the long-haired Tibetan sheep breed, providing practical guidance.

[0004] Fibroblast growth factor receptors (FGFRs) belong to the immunoglobulin gene superfamily. Their extracellular domains have a structure with three or two immunoglobulin-like functional domains. FGFR3 is a receptor with three immunoglobulin-like functional domains. Studies have found that a single amino acid mutation in the transmembrane domain of FGFR3 is the cause of some congenital hereditary dwarfism (Shiang R, Thompson LM, Zhu YZ, et al. Mutations in the transmembrane domain of FGFR3 cause the most common genetic form of dwarfism, achondroplasia. Cell, 1994, 78(2):335-342). FGFR3 RNA is distributed in the pre-keratinocytes around the hair bulb. The hair growth process is regulated by fibroblast growth factor (FGF), and the FGF family and its specific cell surface receptor FGFR form a large and complex family. After binding to the receptor cells, it triggers receptor activation and biological response (Olsen SK, Garbi M, Zampieri N, et al. Fibroblast growth factor (FGF) homologous factors share structural but not functional homology with FGFs. Journal of Biological Chemistry, 2003, 278 (36): 34226-34236).

[0005] The UniProt accession number of the FGFR3 gene is Q61851.

[0006] There are no reports that the mutation at position 117456167 of the FGFR3 gene is associated with the length of wool braids. Summary of the Invention

[0007] The purpose of the present invention is to provide a new SNP of FGFR3 gene and its application in screening sheep with long hair braids.

[0008] The present invention provides a gene, which is a sheep FGFR3 gene in which the 117456167th site of chromosome 6 of the sheep reference genome is mutated to C.

[0009] The present invention also provides a kit for detecting the length trait of sheep wool braids, which comprises a reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome.

[0010] Furthermore, the reagent includes a related reagent for detecting T>C at position 117456167 of chromosome 6 of the sheep reference genome.

[0011] Furthermore, the reagent is a sequencing reagent, a PCR detection reagent, a reagent for a restriction fragment length polymorphism method, or a reagent for single-stranded conformation polymorphism analysis.

[0012] Furthermore, the reagent is a competitive allele-specific PCR detection reagent, preferably including primers shown in SEQ ID NOs. 1 to 2.

[0013] The present invention also provides use of a reagent for detecting site 117456167 of chromosome 6 of a sheep reference genome in preparing a reagent for detecting the wool braid length trait of sheep or screening sheep with long wool braid length.

[0014] Furthermore, the reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome includes a related reagent for detecting T>C at the 117456167th site of chromosome 6 of the sheep reference genome.

[0015] Furthermore, the reagent for detecting site 117456167 of chromosome 6 of the sheep reference genome is a sequencing reagent, a PCR detection reagent, a reagent for restriction fragment length polymorphism method or a reagent for single-stranded conformation polymorphism analysis.

[0016] Furthermore, the reagent for detecting site 117456167 of chromosome 6 of the sheep reference genome is a competitive allele-specific PCR detection reagent, preferably including primers shown in SEQ ID NOs. 1 to 2.

[0017] The present invention also provides a method for detecting the length of sheep wool braids, comprising the following steps:

[0018] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0019] (2) Detection of position 117456167 on chromosome 6 of the sheep reference genome;

[0020] Preferably, the sheep are Tibetan sheep, and more preferably, the sheep are plateau Tibetan sheep.

[0021] Furthermore, in the method, if the detection result of site 117456167 of chromosome 6 of the sheep reference genome is CT or CC, the sheep to be tested is a sheep with a long braid length.

[0022] The present invention discovered a single-nucleotide polymorphism (SNP) marker in the FGFR3 gene that affects the length of Tibetan sheep's wool braids, further clarified the molecular marker of braid length, and provided a new molecular marker for the construction of a Tibetan sheep wool trait breeding system. The present invention first discovered that the polymorphism at site 117456167 in the FGFR3 gene, located on chromosome 6 of the sheep reference genome, has a very strong correlation with the length of sheep (especially Tibetan sheep) braids. This site can be used as a molecular genetic marker for the braid length trait of sheep. The braid length trait of sheep can be screened by detecting this SNP site, and can be used to quickly screen for high-quality sheep populations with long braid lengths, thereby providing a valuable genetic resource for sheep braid length trait improvement, which is beneficial to improving the quality of wool, accelerating the breeding process of sheep with long braid lengths, and also beneficial to improving the accuracy of sheep selection for braid length.

[0023] The key to this invention lies in the discovery that a polymorphism at locus 117456167 in the FGFR3 gene, located on chromosome 6 of the sheep reference genome, is strongly correlated with the length of wool plaits in sheep (particularly Tibetan sheep). By detecting locus 117456167 on chromosome 6 of the sheep reference genome, sheep with long wool plaits can be screened. Any method and reagent capable of detecting locus 117456167 on chromosome 6 of the sheep reference genome can be used to screen sheep with long wool plaits, and the potential for transformation is very broad.

[0024] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0025] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the overall technical flow chart for single nucleotide polymorphism detection of the sheep FGFR3 gene.

[0027] Figure 2 This is the electrophoresis diagram of the quality inspection of the Tibetan sheep sample genomic DNA (in the figure: 095-108 is the sample number, M is the schematic diagram of the marker band, and the right side is the positive and negative controls respectively).

[0028] Figure 3 Electrophoresis diagram of PCR products.

[0029] Figure 4The typing results for position 117456167 of chromosome 6 of the Tibetan sheep sample (CC, CT, TT genotypes) (in the figure: CC is a blue single peak, CT is a blue-red double peak, and TT is a red single peak) DETAILED DESCRIPTION

[0030] In order to understand the present invention more clearly, the present invention will be further described with reference to the following examples and accompanying drawings. The examples are only used to illustrate and are not intended to limit the present invention in any way.

[0031] The experimental methods without specific conditions specified in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the manufacturer; the various chemical reagents used in the examples are commercially available, and the primers used are synthesized by contract.

[0032] Example 1: Kit and method for screening sheep with long braid length according to the present invention

[0033] 1. The components of the Sanger kit of the present invention include:

[0034] Primers were designed using the FGFR3 gene fragment at position 117456167 of chromosome 6 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template using the primer design tool Primer5 software:

[0035] (1) Sanger reaction primers:

[0036] FGFR3-Primer1-F (forward primer, SEQ IN NO. 1):

[0037] TGCTGAAGACTCAACGAGGC

[0038] FGFR3-Primer1-R (reverse primer, SEQ IN NO. 2):

[0039] TCCAGCCCCATATTCATCAG

[0040] (2) Other reagents for Sanger reaction: PCR Master Mix and water.

[0041] 2. Detection method

[0042] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0043] (2) Use the Sanger kit to detect the genotype of site 117456167 of chromosome 6 of the sheep reference genome.

[0044] Example 2: Verification of the correlation between SNP sites and Tibetan sheep wool length traits

[0045] (1) Extraction of genomic DNA

[0046] Plateau Tibetan sheep were selected as experimental materials. Ear edge tissue the size of a mung bean was collected using ear picking forceps and preserved in 75% alcohol for subsequent genomic DNA extraction.

[0047] (2) Extraction of genomic DNA

[0048] DNA was extracted from the ear margin tissue of Tibetan sheep using a genomic DNA kit produced by Beijing Tiangen Biochemical Technology Co., Ltd. ( The DNA was extracted using the TIANamp Genomic DNA Kit in strict accordance with the operating instructions.

[0049] (3) Sample DNA quality testing

[0050] The concentration of the extracted genomic DNA was measured using the NanoDrop 8000 ultra-micro spectrophotometer from Thermo Scientific. The results showed that the sample concentrations were all above 100 ng / μL, and the 260 / 280 values ​​were between 1.8 and 2.0. A good DNA electrophoresis result should be: ① The main band is bright and clear, without dragging, and the main band size is around 10 kb; ② If the main band becomes wider and darker, it indicates that the DNA is slightly degraded. If it becomes a diffuse DNA band, it indicates that the DNA is severely degraded; ③ If there is no band in the electrophoresis, it indicates that the total amount and concentration of the extracted DNA are extremely low, which may cause PCR amplification failure. The electrophoresis results show that the genomic DNA bands are clear and free of impurities ( Figure 2 ), indicating that the extracted genomic DNA was of good integrity and met the standards of subsequent experiments.

[0051] (4) Sanger primer design

[0052] Primers were designed using the FGFR3 gene fragment at position 117456167 of chromosome 6 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template using the primer design tool Primer5 software:

[0053] FGFR3-Primer1-F (forward primer F1, SEQ IN NO. 1):

[0054] TGCTGAAGACTCAACGAGGC;

[0055] FGFR3-Primer1-R (reverse primer, SEQ IN NO. 2):

[0056] TCCAGCCCCATATTCATCAG;

[0057] (5) Sanger amplification

[0058] PCR amplification was performed using the extracted genomic DNA as a template and the synthesized forward primer FGFR3-Primer1-F and reverse primer FGFR3-Primer1-R as the experimental primer set. The specific reaction system and reaction procedure are as follows:

[0059] The reaction system was 30 μL: 1.0 μL of genomic DNA (20 ng / μL), 15 μL of 2× Taq PCR Master Mix, 2.0 μL of upstream primer (concentration 5 pmol / μL), 2.0 μL of downstream primer (concentration 5 pmol / μL), and 10 μL of water.

[0060] The reaction procedure was as follows: ① pre-denaturation at 95.0°C for 5 min, 1 cycle; ② denaturation at 95.0°C for 30 sec, annealing at 60°C for 30 sec, annealing / extension at 72°C for 30 sec, 35 cycles; ③ final extension at 72.0°C for 5 min.

[0061] (6) PCR product electrophoresis identification

[0062] After PCR amplification, 2 μL of PCR product was taken for agarose gel electrophoresis (1% concentration). The amplified fragment was the same size as the target fragment and there was no non-specific amplified band ( Figure 3 ) to proceed to the next step.

[0063] (7) Sanger sequencing

[0064] According to the results of PCR product electrophoresis, PCR products that meet the target fragment size were subjected to Sanger sequencing using the ABI 3730xL DNA Analyzer sequencer.

[0065] (8) SNP typing results

[0066] Genotyping was performed based on the sequencing peak graph, and the genotype of position 117456167 of chromosome 6 was determined based on the results. The typing results are as follows: Figure 4 shown.

[0067] (9) Association analysis between Tibetan sheep FGFR3 genotype and wool braid length

[0068] The genotype effect value of the gene was estimated using the GLM statistical model of SPSS software. The statistical model was: Yijk = μ + Gi + eijk

[0069] Among them, Yij is the phenotypic value of the trait, μ is the population mean of the trait, Gi is the genotype effect value, and eijk is the residual effect.

[0070] (10) Analysis of the significance of differences between FGFR3 genotype and braid length in Tibetan sheep

[0071] The experiment measured the length of wool braids of 108 plateau Tibetans, and performed correlation analysis on the genotype at position 117456167 of chromosome 6.

[0072] The experimental results were expressed as mean ± standard deviation, and the significance analysis was performed using SPSS29.0 statistical software ANOVA, with P < 0.05 as the standard for significant difference and P < 0.01 as the standard for extremely significant difference.

[0073] Sanger typing results showed that among the 108 individuals, there were 42 with TT genotype, 52 with CT genotype, and 14 with CC genotype.

[0074] Table 1 Association analysis between FGFR3 genotype and braid length trait

[0075]

[0076] Note: Data in the same row with different capital letters indicate extremely significant differences (P<0.01).

[0077] The results (Table 1) show that the genotype at position 117456167 of chromosome 6 of the sheep reference genome is significantly correlated with the length of the plateau Tibetan wool braid. As can be seen from Table 1, the three genotypes associated with the FGFR3 gene mutation site are different in terms of braid length and are extremely significantly correlated with braid length. The braid length of the CC genotype is extremely significantly longer than that of the TT and CT genotypes (P < 0.01), and the braid length of the CT genotype is extremely significantly longer than that of the CC genotype (P < 0.01). Therefore, screening individuals containing C at position 117456167 of chromosome 6 of the sheep reference genome, especially those with the homozygous CC genotype, can effectively establish a long-wool Tibetan sheep population, further clarify the molecular markers of braid length, and establish a molecular breeding system for excellent braid length in sheep, thereby improving the braid length of the population. Therefore, Tibetan sheep with long braids can be screened by detecting the 117456167 site on chromosome 6 of the sheep reference genome, thereby effectively establishing a sheep population with long braids.

[0078] In summary, the present invention provides a kit and method for effectively screening sheep (particularly Tibetan sheep) for long braid length. The present invention provides a kit for screening sheep for long braid length, which includes a reagent for detecting locus 117456167 of chromosome 6 of the sheep reference genome. The present invention also provides a method for screening sheep for long braid length, which can quickly identify sheep populations with excellent braid length traits. This method is of great significance for improving the braid length trait of Tibetan sheep and has very good application prospects.

Claims

1. Use of a reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome in the preparation of a reagent for detecting the sheep wool braid length trait, characterized in that: The version of the sheep reference genome is ARS-UI_Ramb_v2.0; The sheep are plateau Tibetan sheep; When the genotype of the 117456167th locus is CC, the braid length trait is long.

2. The use according to claim 1, characterized in that: The reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome includes a related reagent for detecting T>C at the 117456167th site of chromosome 6 of the sheep reference genome.

3. The use according to claim 1 or 2, characterized in that: The reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome is a sequencing reagent, a PCR detection reagent, a reagent for a restriction fragment length polymorphism method, or a reagent for single-stranded conformation polymorphism analysis.

4. The use according to claim 3, characterized in that: The reagent for detecting the 117456167th site of chromosome 6 of the sheep reference genome is a competitive allele-specific PCR detection reagent.

5. The use according to claim 4, characterized in that: The reagent for detecting site 117456167 of chromosome 6 of the sheep reference genome includes primers shown in SEQ ID NOs. 1-2.

6. A method for detecting the length of sheep wool braids, characterized in that: The steps include: (1) Extracting total genomic DNA from the sheep sample to be tested; (2) Detection of site 117456167 of chromosome 6 of the sheep reference genome; The sheep are plateau Tibetan sheep; The version of the sheep reference genome is ARS-UI_Ramb_v2.0; When the genotype of the 117456167th locus is CC, the braid length trait is long.

Images