Role of GPRC5B protein in regulating beige fat activation

Abstract

The present invention belongs to the field of biomedical technology, and discloses the application of GPRC5B protein in regulating beige fat activation, and specifically discloses the application of GPRC5B inhibitors in the preparation of products for treating obesity. The present invention provides an application of the gene GPRC5B for regulating the browning of white fat. The present invention verifies from the cellular level and the individual mouse level that GPRC5B knockout causes white fat to show "multi-chamber" brown-like fat morphological characteristics, and promotes the expression of brown fat marker genes in white fat. The mechanism of action of the GPRC5B gene in regulating the browning of white fat is revealed to be that it binds to the Gαi protein, inhibits the downstream cAMP‑PKA signaling pathway, affects the expression of genes such as the brown fat marker gene UCP1, and then affects the browning of white fat.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and particularly relates to application of GPRC5B protein in regulating beige fat activation. Background Art

[0002] Obesity is mainly caused by an imbalance between energy intake and expenditure. Excess energy accumulates in fat cells, leading to excessive accumulation of body or local fat. The adipose tissue of mammals can be divided into three categories: white fat, brown fat, and beige fat. White adipose tissue (WAT) is the main fat organ in adults. It is mainly distributed in the viscera and subcutaneous tissues, and mainly stores excess energy in the body in the form of triglycerides. In addition to storing lipids, white adipocytes can also secrete hormones and play an important role in metabolic homeostasis, inflammation, and vascular homeostasis. Brown adipose tissue (BAT) is mainly distributed in the scapular region. It uncouples the process of mitochondrial oxidative phosphorylation through the rich uncoupling protein (UCP1) in the cells, thereby releasing energy in the form of heat energy, promoting the body's heat production and regulating the body's energy consumption. Under specific conditions, such as cold stimulation and activation of β3 adrenergic receptors, some brown-like fat cells related to heat production and highly expressing UCP1, namely beige fat cells, can appear in white adipose tissue. This transformation process is called white fat browning. Browning of white fat is an important way for the normal body to promote energy consumption and reduce fat. Converting energy-storing white fat into heat-producing beige fat through browning of white fat has become an important means to resist obesity. For a long time, scholars have been trying to activate BAT and white fat browning with small molecule drugs. However, to date, potential agonists that activate thermogenic fat activity, such as rosiglitazone and mirabegron, have all had different adverse reactions that hinder clinical transformation. Therefore, discovering safe and effective genes and signaling pathways that have the function of activating fat thermogenesis is a key issue that needs to be solved urgently. At present, it has been discovered that genes such as IL27, GPR3, and TNAP play an important role in regulating fat thermogenesis. However, the process of white fat browning involves many factors, and its specific molecular mechanism needs to be further clarified.

[0003] G protein-coupled receptors (GPCRs) are the largest class of membrane proteins in the human genome, consisting of a single polypeptide with an extracellular N-terminus, an intracellular C-terminus, and seven hydrophobic transmembrane domains. GPCRs mediate the response of cells to external stimuli, including light, odors, hormones, and growth factors, and play important biological functions in the life activities of the body. Therefore, GPCRs have always been an important potential target for drug development. Currently, about one-third of FDA-approved drugs exert their efficacy by targeting GPCRs. Gprc5b is a member of the G protein-coupled receptor family C and is highly expressed in tissues such as the central nervous system. Studies have shown that the loss of Gprc5b affects the body's insulin sensitivity; as well as physiological processes such as lipid metabolism and inflammatory response. At present, the role and biological function of Gprc5b in regulating the body's metabolic homeostasis are still unclear, and its ligands are still unclear.

[0004] At present, the incidence of obesity remains high, and the treatment methods for obesity, including diet, exercise therapy, drug therapy, and weight loss surgery, are not only difficult to maintain during implementation, but may also have adverse side effects on human organs such as the gastrointestinal tract, liver, and kidneys. Therefore, it is urgent to develop effective and safe treatment methods for obesity. Many studies have shown that adipose tissue plays a core role in the body's energy balance. White adipose tissue can be transformed into beige adipocytes associated with heat production, promoting heat production and regulating the body's energy consumption. This process is called white fat browning, which plays an important role in the body's resistance to obesity and response to exercise and dietary interventions. However, to date, potential agonists that activate thermogenic fat activity have all had different adverse reactions that hinder clinical translation. Therefore, in-depth research on the regulatory molecular mechanisms of the white fat browning process and the discovery of safe and effective genes and signaling pathways that promote white fat browning are of great scientific and clinical significance for revealing the pathophysiological processes of metabolic diseases such as obesity and exploring new disease prevention and control models. Summary of the invention

[0005] The first aspect of the present invention aims to provide the use of GPRC5B inhibitors.

[0006] The second aspect of the present invention aims to provide a siRNA.

[0007] The third aspect of the present invention aims to provide biological materials related to the siRNA of the second aspect of the present invention.

[0008] The fourth aspect of the present invention aims to provide a product.

[0009] The purpose of the fifth aspect of the present invention is to provide the use of the siRNA of the second aspect of the present invention, the biomaterial of the third aspect of the present invention or the product of the fourth aspect of the present invention in the preparation of a product for regulating the browning of white fat.

[0010] The sixth aspect of the present invention aims to provide the use of GPRC5B as a target in the development of drugs for preventing and treating obesity.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides the use of a GPRC5B inhibitor in (1) to (8):

[0013] (1) Preparation of products for treating obesity;

[0014] (2) regulating the browning of white fat;

[0015] (3) preparing products for regulating the browning of white fat;

[0016] (4) preparing products that increase the basal metabolic rate;

[0017] (5) Increase the expression of UCP1;

[0018] (6) preparing a product for increasing the expression of UCP1;

[0019] (7) Promote the proliferation of UCP1-positive cells;

[0020] (8) Prepare a product that promotes the proliferation of UCP1-positive cells.

[0021] In some embodiments of the present invention, the product regulates the browning of white fat by acting on GPRC5B to achieve the purpose of treating obesity.

[0022] In some embodiments of the present invention, the mechanism of regulating the browning of white fat is to inhibit the downstream cAMP-PKA signaling pathway through the binding of GPRC5B to Gαi protein, thereby affecting the expression of genes such as the brown fat marker gene UCP1, and thus regulating the browning of white fat.

[0023] In some embodiments of the present invention, the GPRC5B inhibitor is at least one of a substance that inhibits GPRC5B activity, a substance that degrades GPRC5B, a substance that reduces the expression level of GPRC5B, and a substance that knocks out the expression of GPRC5B.

[0024] In some embodiments of the present invention, the GPRC5B inhibitor is at least one of a1) to a4):

[0025] a1) siRNA, dsRNA, miRNA, sgRNA, ribozyme or shRNA targeting GPRC5B;

[0026] a2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme or shRNA targeting GPRC5B described in a2);

[0027] a3) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in a2);

[0028] a4) Small molecule drugs targeting GPRC5B;

[0029] a5) Blocking GPRC5B protein and / or GPRC5B protein intermediate GPRC5B inhibitory polypeptide.

[0030] In some embodiments of the present invention, the GPRC5B inhibitor is at least one of (9) to (11):

[0031] b1) siRNA targeting GPRC5B;

[0032] b2) a nucleic acid molecule encoding the siRNA targeting GPRC5B described in b1);

[0033] b3) An expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in b2).

[0034] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0035] In some embodiments of the present invention, the siRNA is a reverse complementary double-stranded RNA, wherein the sequence of one strand is shown in SEQ ID NO:1.

[0036] In some embodiments of the present invention, the product includes drugs and reagents.

[0037] In the previous work, the present invention found that GPRC5B regulates the browning process of white fat and affects the metabolic homeostasis of the body. Based on the existing findings, the present invention will systematically explain the biological role of GPRC5B in regulating the browning of white fat and the metabolic homeostasis of the body from the molecular, cellular, animal and population levels, reveal its molecular mechanism for regulating the browning of white fat, and verify the role of the lead compound targeting GPRC5B. It can not only broaden the understanding of GPRC5B, but also help to reveal the pathophysiological basis of metabolic diseases, discover new targets for metabolic diseases and develop new lead compounds, and provide new methods and ideas for the prevention and treatment of metabolic-related diseases.

[0038] The second aspect of the present invention provides an siRNA, which is a reverse complementary double-stranded RNA, wherein the sequence of one strand is shown in SEQ ID NO:1.

[0039] The third aspect of the present invention provides a biological material related to the siRNA of the second aspect of the present invention, which is c1) or c2):

[0040] c1) a nucleic acid molecule encoding the siRNA according to claim 6;

[0041] c2) An expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in c1).

[0042] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0043] The fourth aspect of the present invention provides a product, comprising the siRNA of the second aspect of the present invention or the biomaterial of the third aspect of the present invention.

[0044] In some embodiments of the present invention, the product has at least one of the following functions (1) to (5):

[0045] (1) Treatment of obesity;

[0046] (2) regulating the browning of white fat;

[0047] (3) Improve basal metabolic rate;

[0048] (4) increase the expression of UCP1;

[0049] (5) Promote the proliferation of UCP1-positive cells.

[0050] The fifth aspect of the present invention provides the use of the siRNA of the second aspect of the present invention, the biomaterial of the third aspect of the present invention or the product of the fourth aspect of the present invention in the preparation of a product for regulating the browning of white fat.

[0051] A sixth aspect of the present invention provides the use of GPRC5B as a target in the development of drugs for preventing and treating obesity.

[0052] In some embodiments of the present invention, the drug regulates the browning of white fat by acting on GPRC5B to achieve the purpose of preventing and treating obesity.

[0053] The beneficial effects of the present invention are:

[0054] The present invention provides an application of the gene GPRC5B for regulating the browning of white fat. The present invention verifies from the cellular level and the individual mouse level that GPRC5B knockout causes white fat to show "multi-chamber" brown-like fat morphological characteristics, and promotes the expression of brown fat marker genes in white fat. The mechanism of action of the GPRC5B gene in regulating the browning of white fat is revealed to be that it binds to the Gαi protein, inhibits the downstream cAMP-PKA signaling pathway, affects the expression of genes such as the brown fat marker gene UCP1, and then affects the browning of white fat. The present invention provides a new use of the GPRC5B gene in regulating the browning of white fat, and has practical value in preparing drugs that effectively alleviate and treat obesity. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 are the results of whole-genome sequencing analysis; A is the whole-genome sequencing result of the community population; B is the correlation between the SNP site in the GPRC5B gene region and BMI analyzed by the UKBiobank database.

[0056] Figure 2 The expression of GPRC5B in adipose tissue of obesity models; A is a high-fat diet-induced obesity model; B is an ob / ob obese mouse model; C is a db / db obese mouse model; and D is data from obese people; ** in the figure represents P < 0.01, and *** represents P < 0.005.

[0057] Figure 3 The effects of knocking out / overexpressing GPRC5B in primary fat cells on UCP1, a key target of browning of white fat; A shows the changes in GPRC5B mRNA expression in cells treated with GPRC5B small interfering RNA or control; B shows the changes in UCP1 mRNA expression in cells treated with GPRC5B small interfering RNA or control; C shows the changes in GPRC5B and UCP1 protein expression in cells treated with GPRC5B small interfering RNA or control; D shows the changes in GPRC5B mRNA expression in cells treated with GPRC5B overexpression plasmid or control; E shows the changes in UCP1 mRNA expression in cells treated with GPRC5B overexpression plasmid or control; F shows the changes in GPRC5B and UCP1 protein expression in cells treated with GPRC5B overexpression plasmid or control; ** in the figure represents P < 0.01, and *** represents P < 0.005.

[0058] Figure 4 The changes in body weight (A), liver (B), subcutaneous fat (C) and visceral fat (D) of mice after fat-specific knockout of GPRC5B; *** in the figure represents P < 0.005.

[0059] Figure 5Figure 2 shows the pathological sections of fat and the area of ​​adipocytes after adipose-specific knockout of GPRC5B. A shows the area of ​​adipocytes after adipose-specific knockout of GPRC5B. flox / flox Hematoxylin-eosin staining results of white adipose tissue of mice after high-fat feeding, scale bar is 60μm; B is GPRC5B AT-KO Hematoxylin-eosin staining results of white adipose tissue of mice after high-fat feeding, scale bar is 60μm; C is GPRC5B flox / flox Immunohistochemical staining results of UCP1 in white adipose tissue of mice after high-fat diet, scale bar is 60μm; D is GPRC5B AT-KO The results of UCP1 immunohistochemical staining of white adipose tissue of mice after high-fat feeding, the scale bar is 60μm; E is the average fat area statistics of the two groups of mice; F is the fat area statistics of the two groups of mice; *** in the figure represents P < 0.005.

[0060] Figure 6 The expression changes of thermogenesis and browning genes after fat-specific knockout of GPRC5B; A represents the expression of GPRC5B under high-fat diet conditions AT-KO Mice and GPRC5B flox / flox A shows the changes in the expression of thermogenic gene mRNA in white adipose tissue of mice; B shows the changes in the protein expression of UCP1 in white adipose tissue of two groups of mice; in the figure, ** represents P < 0.01, *** represents P < 0.005.

[0061] Figure 7 Figure 3. Changes in body weight (A), liver (B), subcutaneous fat (C) and visceral fat (D) of mice after in situ overexpression of GPRC5B in fat.

[0062] Figure 8 The figures are the pathological sections of fat and the statistics of adipocyte area after in situ overexpression of GPRC5B in adipose tissue; A is the hematoxylin-eosin staining result of white adipose tissue of mice with in situ overexpression of GFP in adipose tissue after high-fat feeding, and the scale bar is 60μm; B is the hematoxylin-eosin staining result of white adipose tissue of mice with in situ overexpression of GPRC5B in adipose tissue after high-fat feeding, and the scale bar is 60μm; C is the immunohistochemical staining result of UCP1 in white adipose tissue of mice with in situ overexpression of GFP in adipose tissue after high-fat feeding, and the scale bar is 60μm; D is the immunohistochemical staining result of UCP1 in white adipose tissue of mice with in situ overexpression of GPRC5B in adipose tissue after high-fat feeding, and the scale bar is 60μm; E is the average fat area statistics of the two groups of mice; F is the fat area statistics of the two groups of mice; In the figure, ** represents P < 0.01, and *** represents P < 0.005.

[0063] Fig. 9The expression changes of thermogenic and browning genes after in situ overexpression of GPRC5B in adipose tissue; A shows the expression changes of thermogenic gene mRNA in white adipose tissue of mice with in situ overexpression of GPRC5B in adipose tissue and mice with in situ overexpression of GFP in adipose tissue under high-fat diet feeding conditions; B shows the protein expression changes of UCP1 in white adipose tissue of the two groups of mice; In the figure, * represents P < 0.05, *** represents P < 0.005.

[0064] Fig.10 Figure 3 is the mechanism of GPRC5B regulating the browning of white fat; A is the result of molecular gel electrophoresis of GPRC5B-G protein complex; B is the fluorescence energy resonance transfer experiment; C is the change of cAMP content in white adipose tissue of GPRC5B fat-specific knockout mice and their control mice under high-fat diet feeding conditions; D is the change of cAMP content in white adipose tissue of GPRC5B fat in situ overexpression mice and their control mice under high-fat diet feeding conditions; E is the change of PKA signaling pathway in white adipose tissue of GPRC5B fat-specific knockout mice and their control mice under high-fat diet feeding conditions; F is the change of PKA signaling pathway in white adipose tissue of GPRC5B fat in situ overexpression mice and their control mice under high-fat diet feeding conditions; *** in the figure represents P < 0.005. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below through specific examples.

[0066] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0067] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0068] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0069] The primer sequences used in this example are as follows:

[0070] Cidea primer sequences: F: GGTGGACACAGAGGAGTTCTTTC (SEQ ID NO: 3); R: CGAAGGTGACTCTGGCTATTCC (SEQ ID NO: 4);

[0071] Pgc1α primer sequences: F: AAGTGGTGTAGCGACCAATCG (SEQ ID NO: 5); R: AATGAGGGCAATCCGTCTTCA (SEQ ID NO: 6);

[0072] Dio2 primer sequence: F: GGTGGTCAACTTGGTTCAGCC (SEQ ID NO: 7); R: AAGTCAGCCACCGAGGAGAACT (SEQ ID NO: 8);

[0073] Prdm16 primer sequences: F: ATCCACAGCACGGTGAAGCCAT (SEQ ID NO: 9); R: ACATCTGCCACAGTCCTTGCA (SEQ ID NO: 10);

[0074] UCP1 primer sequences: F: AGGCTTCCAGTACCATTAGGT (SEQ ID NO: 11); R: CTGAGTGAGGCAAAGCTGATTT (SEQ ID NO: 12);

[0075] GPRC5B primer sequences: F: GCTGTGGACTGGACCTTCTTC (SEQ ID NO: 13); R: GCTTCCTTTCCTTGTCCTTGA (SEQ ID NO: 14);

[0076] The wild-type C57BL / 6J mice, obese model mice, leptin-deficient mice (db / db), and leptin-deficient mice (ob / ob) used in this example were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0077] Example 1

[0078] In this example, the whole genome of the community population was sequenced, and the whole genome association study analysis was performed using clinical data. It was found that the GPRC5B gene region site rs114262543 was closely related to the abdominal visceral fat area; the whole genome association study data on BMI from the UK Biobank (ukb-b-19953) was used to screen for significant associations with BMI (P<5e -8 ) of SNPs, and found a cluster of SNPs (rs9938120) significantly associated with BMI in the GPRC5B gene region ( Figure 1 ).

[0079] Example 2

[0080] Eight-week-old C57BL / 6J mice were selected and fed with a high-fat diet (HFD) or normal diet (control) for 12 weeks. The diet used for high-fat modeling was purchased from Research Diets (D12496). The energy supply ratios of fat, carbohydrates and protein in the high-fat diet were 40%, 20% and 20%, respectively. The normal diet used in the high-fat model control group was from the Experimental Animal Center of South China Agricultural University. The energy supply ratios of fat, carbohydrates and protein in the normal diet were 12%, 67.4% and 20.6%, respectively. Before the modeling began, 8-week-old C57BL / 6 male mice were randomly divided into two cages according to their body weight. One cage was fed with HFD, and the other cage continued to be fed with normal diet. During the high-fat modeling period, the high-fat diet was replaced every 3 days to prevent the feed from being exposed to the air for a long time, affecting the taste, resulting in reduced food intake in mice and interfering with the establishment of the model. The body weight and blood glucose of the modeling mice were weighed weekly, and the expression level of GPRC5B in the subcutaneous adipose tissue of the two groups of mice was detected. The 8-week-old leptin receptor-deficient mouse (db / db) obesity model and the wild-type control mice of the same age were fed with ordinary diet for 4 weeks, and the expression level of GPRC5B in the subcutaneous adipose tissue of db / db mice was detected; the 8-week-old leptin-deficient mouse (ob / ob) obesity model and the wild-type control mice of the same age were fed with ordinary diet for 4 weeks, and the expression level of GPRC5B in the subcutaneous adipose tissue of ob / ob mice was detected. The leptin-deficient ob / ob mice and leptin receptor-deficient db / db mice in the spontaneous obesity model used in the experiment and their corresponding control mice were purchased from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd. The expression level of GPRC5B in the subcutaneous adipose tissue of normal and obese people was detected. The adipose tissue of the people came from patients who underwent adrenal surgery or weight loss surgery, and the patients were divided into normal and obese people according to the BMI of the surgical patients.

[0081] The results showed that the expression level of GPRC5B in the subcutaneous fat of high-fat diet (HFD)-induced obesity models, db / db mice, ob / ob mice, and obese humans was higher than that in the control group ( Figure 2 ).

[0082] Example 3

[0083] 3-week-old C57BL / 6J mice were selected to extract the vascular matrix components of mouse iWAT, and induced them to differentiate into mature brown adipocytes in vitro using drugs. The steps for extracting the vascular matrix components of iWAT were as follows: After the mice were anesthetized, the mice were killed after the eyeballs were removed and bleeding was performed. The mice were soaked in 75% alcohol for 5 minutes. After disinfection, they were placed on the prepared paper towels in the clean bench and repeatedly wiped to remove excess alcohol. The mice were placed with their backs facing up, and the line connecting the roots of the upper limbs of the mice was selected as the incision. The skin of the mice was cut open, and the skin was pulled open along the upper and lower sides of the incision with both hands. The iWAT symmetrical on both sides can be seen. The mice were suspended in the air, and the iWAT on both sides was pulled off with tweezers, and the lymph nodes were separated. The removed iWAT was placed in a pre-labeled 1.5mL EP tube according to the number, 100μL of the prepared collagenase working solution was added to the tube, and the tissue was cut with surgical scissors until the iWAT was in pieces. After the tissue was minced, 900 μL of collagenase working solution was added to the EP tube, and the tissue was gently blown. After the tissue was minced, the EP tube was sealed with a sealing film and placed in a 37°C water bath for digestion. To ensure that the adipose tissue was fully digested, the EP tube was vortexed for 30 seconds before being placed in the water bath. During the digestion process in the water bath, the tube was vortexed once every 10 minutes for a total of 30 minutes of digestion. In the clean bench, a 40 μm sterile cell filter was placed on the marked 50 mL centrifuge tube. First, 2 mL of high-glucose DMEM medium was used to wet the sterile cell filter, and then the digested tissue was slowly added from the cell filter to the centrifuge tube, and the sterile cell filter was rinsed with 1-2 mL of sugar DMEM medium to ensure that the digested tissue was transferred to the centrifuge tube. The 50 mL centrifuge tubes containing the iWAT cell suspensions of each group of mice were leveled with culture medium and centrifuged at 1000 g for 10 minutes. After centrifugation, a small amount of sediment can be seen at the bottom of the tube. Tilt the centrifuge tube at a small angle, insert the gun tip into the liquid surface along the side wall of the centrifuge tube to absorb the supernatant and the floating tissue in the supernatant, add 13mL of high-glucose DMEM medium (10% FBS) to the centrifuge tube respectively; vortex to mix, transfer the medium evenly to the 12-well plate, and add 1mL to each well. The cells after the plate are cultured in a 37℃, 5% CO2 incubator. After 6 hours, rinse with PBS twice. Be sure to clean the flocculent tissue and blood cells on the surface of the seed plate cells. Change the medium 48 hours after inoculation and perform differentiation experiments. Preparation of drugs for induced differentiation model: 3-isobutyl-1-methylxanthine (IBMX), take 0.5g of IBMX dry powder and dissolve it in 8.95mL DMSO to prepare 500x IBMX mother solution (storage concentration: 250mM), store it in a -80℃ refrigerator after aliquoting, and put it in a 4℃ refrigerator in advance when using it. When treating cells, add 2 μL of the stock solution per 1 mL of culture medium, which is 1× IBMX (working concentration: 0.5 mM).

[0084] Indomethacin (INDO) Take 0.5g of INDO dry powder and dissolve it in 22.3595mL DMSO to prepare 1000×INDO mother solution (storage concentration: 62.5mM), store it in a -80℃ refrigerator after aliquoting, and put it in a 4℃ refrigerator in advance when using it. When treating cells, add 1μL of mother solution to every 1mL of culture medium, which is 1×INDO (working concentration: 62.5μΜ).

[0085] Dexamethosone (DEX), take 20 mg of DEX dry powder and dissolve it in 10 mL of DMSO to make 1000×Dex mother solution (storage concentration: 2 mg / mL), store it in a -80℃ refrigerator after aliquoting, and put it in a 4℃ refrigerator in advance when using it. When treating cells, add 1μL of mother solution to every 1mL of culture medium, which is 1×DEX (working concentration: 2μg / mL).

[0086] Insulin: 100 mg of insulin powder was dissolved in 17.2189 mL of DMSO to prepare 1000×Insulin stock solution (storage concentration: 1 mM), and stored in a -80°C refrigerator after aliquoting. When used, it was placed in a 4°C refrigerator in advance. When treating cells, 1 μL of stock solution was added to each 1 mL of culture medium to prepare 1×Insulin (working concentration: 1 μM). Triiodothyronine (T3): 10 mg of T3 powder was dissolved in 15.3617 mL of 0.1 M NAOH solution to prepare 1 mM T3, and 1 μL of 1 mM T3 was added to 999 μL of DMSO to prepare 1000×T3 stock solution (storage concentration: 1 μM), and stored in a -80°C refrigerator after aliquoting. When used, it was placed in a 4°C refrigerator in advance. When treating cells, 1 μL of stock solution was added to each 1 mL of culture medium to prepare 1×T3 (working concentration: 1 nM).

[0087] Rosiglitazone (ROSI): 10 mg of ROSI dry powder was dissolved in 27.977 mL of DMSO to prepare 1000×ROSI stock solution (storage concentration: 1 mM), which was stored in a -80°C refrigerator and placed in a 4°C refrigerator before use. When treating cells, 1 μL of stock solution was added to each 1 mL of culture medium, which was 1×ROSI (working concentration: 1 μM).

[0088] The induced differentiation model was operated as follows: on the second day after the cells in the 12-well plate were confluent, differentiation solution (DMEM high glucose medium + 10% serum + 1% double antibody + 3-isobutyl-1-methylxanthine + indomethacin + dexamethasone + rosiglitazone) was added to the cells to induce differentiation, which was recorded as Day 0. After 3 days of differentiation, the maintenance solution (DMEM high glucose medium + 10% serum + 1% double antibody + insulin + triiodothyronine) was replaced every two days, and the cells were collected on the 8th day. On the sixth day of differentiation, small interfering RNA (siRNA, CTGGTGTTAGAGAGAAAGA (SEQ ID NO: 1)) was added to silence the GPRC5B expression level or a GPRC5B overexpression plasmid (sequence: >VB221108-1041vsvpAAV[Exp]-CMV>mGprc5b[NM_022420.2](ns):3xGGGGS:EGF P:WPRECTGCG (SEQ ID NO: 2)) was added to upregulate GPRC5B expression.

[0089] The results showed that knockdown of GPRC5B significantly upregulated the mRNA and protein levels of the thermogenic marker UCP1; while upregulation of GPRC5B during differentiation could downregulate the mRNA and protein expression of UCP1 ( Figure 3 ).

[0090] Example 4

[0091] This example is used to construct adipose-specific GPRC5B knockout mice (GPRC5B AT-KO ) and their control mice (GPRC5B flox / flox ) and were fed a high-fat diet for 12 weeks.

[0092] GPRC5B AT-KO Mouse construct workflow: GPRC5B flox / + Mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., and AdipoQ-Cre+ / - mice were provided by the research group. flox / + GPRC5B flox / + Female mice were crossed to obtain sufficient GPRC5B flox / flox Mice; AdipoQ-Cre+ / - mice were mated with wild-type C57BL / 6 mice to obtain sufficient AdipoQ-Cre+ / - mice. flox / flox Mice were mated with AdipoQ-Cre+ / - mice to obtain sufficient genotype for GPRC5B flox / + ×AdipoQ-Cre+ / - heterozygous mice, the next step is to make GPRC5B flox / flox Mice and GPRC5B flox / +×AdipoQCre+ / - heterozygous mice were mated to obtain sufficient GPRC5B for experiments flox / flox ×AdipoQ-Cre+ / - knockout mice and GPRC5B flox / flox Control mice. AT-KO The body weight of mice and control mice was monitored, and the mice were dissected after 12 weeks of high-fat feeding, and the liver and various adipose tissues were weighed.

[0093] The results showed that the body weight of fat-specific GPRC5B knockout mice was significantly reduced, and the weight of liver, subcutaneous fat and visceral fat were significantly reduced ( Figure 4 ).

[0094] Example 5

[0095] GPRC5B AT-KO Paraffin sections were made from subcutaneous fat of mice and control mice, and the subcutaneous fat tissue was stained with hematoxylin-eosin (HE) to observe the pathological changes of subcutaneous fat tissue. Immunohistochemical staining of subcutaneous fat tissue was performed using uncoupling protein-1 (UCP1) antibody, a characteristic marker of white fat browning.

[0096] Paraffin section preparation steps: Fix the mouse fat tissue with formalin for 24 hours, recover the formalin the next day, and rinse the tissue with running water overnight. Dehydrate the tissue in 75% ethanol, 85% ethanol, and 95% ethanol for 1 hour each, then dehydrate the tissue in 100% ethanol for 30 minutes, and finally dehydrate the tissue in 100% ethanol for 15 minutes. Put the dehydrated tissue in 50% xylene + 50% ethanol for 30 minutes, and then put the tissue in xylene I and xylene II in sequence for 15 minutes each to make the tissue transparent. Treat the transparent tissue in paraffin I for 1 hour, then put it in paraffin II overnight, and finally put it in paraffin III for 1 hour to complete the wax immersion process. Note that this step is completed in a 65°C oven. Open the embedding machine in advance so that the temperature inside can melt the paraffin in the channel. Use tweezers to gently clamp the tissue block and place it with the cut surface facing down in the embedded box prepared in advance. Quickly pour the molten wax into the box. Use tweezers to clamp the embedded box and slowly move it to the cold table. Take it out after the wax block is completely solidified. Precool the wax block at 4℃ for 30 minutes before slicing, and adjust the slice thickness to 5μm for slicing. Carefully transfer the cut slices to water to fully unfold them. Then, gently pick up the slices with the pre-marked slides.

[0097] Hematoxylin-eosin (HE) staining experimental steps: Bake the prepared paraffin sections at 65°C for 2 hours. Place the sections in xylene I and xylene II in sequence for 10 minutes each, then soak the sections in 50% xylene + 50% ethanol for 5 minutes to complete the dewaxing step. Place the dewaxed sections in 100% ethanol, 90% ethanol, 80% ethanol and 70% ethanol in sequence for 5 minutes each to complete the rehydration step. Stain the sections with hematoxylin stain for 2 minutes, then rinse with tap water at a low flow rate for 10 minutes, and finally rinse with ddH2O for 5 seconds. Stain the sections with eosin stain for 5 minutes, then rinse with tap water at a low flow rate for 10 minutes. Place the eosin-stained sections in 70% ethanol, 80% ethanol, 90% ethanol and 100% ethanol in sequence for 3 minutes each. Place the sections in 50% xylene + 50% ethanol, xylene I and xylene II in sequence for 3 minutes each. Finally, the sections were mounted with neutral gum, dried in a fume hood, and observed under a microscope.

[0098] Immunohistochemical staining steps: Put the prepared paraffin sections into dewaxing solution I, dewaxing solution II, and dewaxing solution III in order for 10 minutes each, then put the sections into anhydrous ethanol I, anhydrous ethanol II, and anhydrous ethanol III for 5 minutes each, and finally rinse with distilled water. During the antigen retrieval experiment, pay attention to keep the sections moist. After natural cooling, rinse the sections with 1× PBS for 5 minutes each time, and repeat the shaking and rinsing 3 times. Immerse the sections in 3% hydrogen peroxide solution, incubate at room temperature in the dark for 25 minutes, then rinse the sections with 1× PBS for 5 minutes each time, and repeat the shaking and rinsing 3 times. Slowly add 3% BSA to the tissue in the section so that the tissue is evenly covered, and block at room temperature for 30 minutes. Discard the blocking solution, slowly add UCP1 antibody (dilution ratio 1:500) to the tissue in the section, and incubate overnight at 4°C. The next day, rinse the slices with 1×PBS for 5 minutes each time, shake and rinse 3 times, then gently dry the slices, and add HRP-labeled rabbit secondary antibody to the tissue to cover the tissue, and incubate at room temperature for 50 minutes. After incubation, rinse the slices with 1×PBS for 5 minutes each time, shake and rinse 3 times, then gently dry the slices, and add freshly prepared DAB color development solution to the tissue, observe the slices under a microscope and control the color development time, and then rinse the slices with tap water to terminate the color development. Use hematoxylin for 3 minutes, then rinse with tap water; differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water; return to blue with hematoxylin blue solution, rinse with tap water. After that, place the slices in 75% ethanol, 85% ethanol, anhydrous ethanol I, anhydrous ethanol II, n-butanol, and xylene II in order for 5 minutes each. Finally, seal the slices with neutral gum, place them in a fume hood to dry, and observe them under a microscope.

[0099] The results showed that compared with control mice, the diameter of subcutaneous adipocytes in adipose-specific GPRC5B knockout mice was reduced, the average fat area in the same field of view was reduced, and the number of small adipocytes increased significantly; UCP1 immunohistochemical staining results showed that compared with control mice, the number of UCP1-positive cells in adipose-specific GPRC5B knockout mice was significantly increased ( Figure 5 ).

[0100] Example 6

[0101] Extraction of GPRC5B AT-KO The RNA of subcutaneous adipose tissue of mice and control mice was reverse transcribed into cDNA and the expression levels of genes related to thermogenesis and browning were detected.

[0102] The specific experimental plan is as follows: take an appropriate amount of adipose tissue and place it in a 2mL sterile enzyme-free EP tube, add 1mL Trizol and 3 3mm grinding beads, cover the EP tube lid tightly, place it in a pre-cooled tissue homogenizer and run it at 70Hz for 30 seconds, pause for 20 seconds to prevent the instrument from overheating and causing RNA degradation, and repeat the above steps 8 to 10 times until the tissue is completely ground. Carefully aspirate the lower layer of red liquid and transfer it to a new labeled 1.5mL sterile enzyme-free EP tube. Add 200μL of chloroform to each 1.5mL EP tube, shake it upside down and violently 30 times, let it stand at room temperature for 10 minutes, slowly put the 1.5mL EP tube that has been standing still into a 4℃ centrifuge, 13000rpm / minute, 15 minutes, and carefully take out the centrifuged EP tube and place it at room temperature. Transfer 400μL of supernatant to a new labeled 1.5mL enzyme-free sterile EP tube. Try to avoid aspirating the lower layer of solution during transfer. Add 500μL of isopropanol to the 1.5mL EP tube containing the supernatant, mix it upside down 30 times (in this step, the upside-down technique should be gentle), let it stand at room temperature for 10 minutes, slowly put the 1.5mL EP tube into a 4℃ centrifuge, 13000rpm / min, 10 minutes, carefully take out the centrifuged EP tube and place it at room temperature. Discard the waste liquid. The precipitate obtained at this time is RNA. Add 1mL of 75% ethanol diluted with DEPC water, and centrifuge it at 7500rpm / min at 4℃ for 5 minutes. Discard the waste liquid, open the lid and let it stand to allow the residual solvent to evaporate until the precipitate becomes transparent, add an appropriate amount of DEPC water to dissolve the precipitate, mix it by blowing, and centrifuge it at 7500rpm / min at 4℃ for 2 minutes. The concentration of the RNA sample was determined, and 5× PrimeScript RT Master reverse transcriptase was added to reverse transcribe the RNA into cDNA. Then, primers, 2× SuperReal PreMix, template cDNA and water were added according to the experimental requirements, and the samples were spotted on a 384-well plate. The spotted plate was centrifuged at 3000 rpm / min for 3 minutes before real-time fluorescence quantitative PCR reaction.

[0103] The results showed that compared with control mice, adipose-specific GPRC5B knockout promoted the expression of genes related to thermogenesis and browning, and activated the browning process of white fat ( Figure 6 ).

[0104] Example 7

[0105] Adeno-associated virus AAV9 (purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.) was constructed to specifically overexpress GPRC5B in adipose tissue. 10 vg / mouse was injected into C57BL / 6 mice by in situ adipose injection. Two weeks after adeno-associated virus injection, mice were fed with a high-fat diet for 12 weeks. The body weight of mice with in situ GPRC5B overexpression and control mice was monitored. After 12 weeks of high-fat feeding, the mice were dissected and the liver and various adipose tissues were weighed. The experimental protocol for in situ adipose overexpression was as follows: After anesthetizing the mice, the abdominal area of ​​the mice was fully disinfected with alcohol, the skin of the groin area was cut open, the subcutaneous iWAT of the mice was slowly exposed, and AAV9 virus (total virus titer was 2×10 10 vg) to achieve GPRC5B overexpression. The wound was sutured after the injection, and the high-fat model was given 2 weeks after the operation.

[0106] The results showed that the body weight of mice with fat-specific GPRC5B overexpression increased significantly, and the weight of liver, subcutaneous fat and visceral fat increased significantly ( Figure 7 ).

[0107] Example 8

[0108] Paraffin sections were made from the subcutaneous fat of mice with in situ GPRC5B overexpression and control mice, and stained with hematoxylin-eosin (HE) to observe the pathological changes of subcutaneous adipose tissue. Immunohistochemical staining of subcutaneous adipose tissue was performed using an antibody against uncoupling protein-1 (UCP1), a characteristic marker of browning of white adipose. The specific experimental protocol was the same as that in Example 5.

[0109] The results showed that compared with control mice, the diameter of subcutaneous adipocytes in mice with GPRC5B overexpression in adipose tissue increased, the average fat area under the same field of view increased, and the number of large adipocytes increased significantly; UCP1 immunohistochemical staining results showed that compared with control mice, the number of UCP1-positive cells in mice with GPRC5B overexpression in adipose tissue decreased significantly ( Figure 8 ).

[0110] Example 9

[0111] RNA was extracted from subcutaneous adipose tissue of GPRC5B-overexpressing mice and control mice, and the expression levels of genes related to thermogenesis and browning were detected after reverse transcription into cDNA. The specific experimental scheme was the same as that in Example 6.

[0112] The results showed that, compared with control mice, adipose-specific GPRC5B overexpression could downregulate the expression of genes related to thermogenesis and browning, and inhibit the browning process of white fat ( Fig. 9 ).

[0113] Example 10

[0114] The complex of GPRC5B and downstream G protein was assembled in vitro and the binding of GPRC5B and downstream G protein was verified by fluorescence energy resonance transfer experiment, and the downstream signaling pathway of G protein was detected. The specific experimental scheme for in vitro assembly of G protein complex is as follows: Insect cell line (Sf9 / Zsf9 / His5) was used as the main protein expression system, GPRC5B and G protein were constructed into pFastBac vector respectively, and the main methods included homologous recombination, Transfer-PCR (T-PCR), full-field PCR, etc., and plasmid was extracted with high-purity plasmid mini-extraction kit. Plasmid was transformed into DH10Bac competent state and blue-white class screening, white monoclonal antibody was picked from the plate, and p0, p1 and p2 were prepared using sf9 insect cells. The obtained receptor virus was added to the cells for culture, and the expression and purification of GPRC5B receptor and G protein were carried out, and the protein concentration was determined and frozen. The GPRC5B-G protein complex was assembled in vitro, the protein counterstaining was used to detect the uniformity and particle integrity of the sample, and the gel was run to detect the binding of GPRC5B to the downstream G protein. The fluorescence energy resonance transfer experimental scheme is as follows: The action of GPCR is generally achieved by activating heterotrimeric G proteins. In the resting state, Gαβγ binds to GDP. When GPCR binds to the ligand and activates the G protein, GDP is replaced by GTP under the action of the guanylate exchange factor, Gα binds to GTP and dissociates from Gβγ, and then activates the subsequent signaling pathway. The Gα subunit is divided into Gs, Gi, Gq / 11, G12 / 13, etc., which can mediate different signaling pathways. Fluorescence energy donors (Nluc) and receptors (YFP) are connected to different Gα subunits and Gβγ respectively. When the two are combined together, the receptor will emit fluorescence. When the GPCR G protein binds, the Gα subunit and Gβγ separate, and the fluorescence gradually weakens. Based on this principle, the fluorescence energy resonance transfer experiment is used to observe the changes in fluorescence intensity to clarify the coupling of GPRC5B and G protein.

[0115] The results showed that GPCR5B specifically binds to Gαi protein and activates the downstream Gαi signaling pathway in a constitutively activated manner. The activation of Gαi reduces the synthesis of cAMP in the body and inhibits the downstream PKA signaling pathway ( Fig.10 ).

[0116] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of GPRC5B inhibitors in the preparation of drugs for treating obesity: The GPRC5B inhibitor is at least one of (b1) to (b3): b1) siRNA targeting GPRC5B; b2) a nucleic acid molecule encoding the siRNA targeting GPRC5B described in b1); b3) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in b2); The siRNA is a reverse complementary double-stranded RNA, wherein the sequence of one strand is shown in SEQ ID NO:

1.

2. A siRNA, which is a reverse complementary double-stranded RNA, wherein the sequence of one strand is shown in SEQ ID NO:

1.

3. The biological material related to the siRNA according to claim 2, which is c1) or c2): c1) a nucleic acid molecule encoding the siRNA according to claim 2; c2) An expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in c1).

4. A reagent comprising the siRNA according to claim 2 or the biomaterial according to claim 3.

5. Use of the siRNA according to claim 2, the biomaterial according to claim 3 or the reagent according to claim 4 in the preparation of a drug for treating obesity.

Images