An asparagine synthetase A mutant for synthesizing L-asparagine and its application

Abstract

The present invention discloses an aspartate synthase A mutant for producing L-asparagine and its application, belonging to the technical field of bioengineering. Using L-aspartic acid and ATP as raw materials, the present invention utilizes a mutant of aspartate synthase A (EcAsnA) with enhanced activity for the biosynthesis of L-asparagine, and the overall catalytic process is simple and efficient. By using the purified enzyme for the ammonia ligation reaction, the production intensity of L-asparagine reaches 20.28 g / L / h. Compared with the parental strain that can currently catalyze the formation of L-asparagine from L-aspartic acid, EcAsnA<supgt;L109K / K58R< / supgt; has a higher catalytic efficiency, and its catalytic activity is increased to 2603.64 U / mg, which is 4.24 times that of the parental strain (497.15 U / mg). The present invention provides a new synthesis method for the rapid synthesis of L-asparagine and a new idea for the industrial production of L-asparagine.

Description

Technical Field

[0001] The present invention relates to an asparagine synthetase A mutant for producing L-asparagine and its application, belonging to the technical field of bioengineering. Background Art

[0002] As one of the 20 common amino acids, asparagine is widely used in the fields of medicine, food, etc. In recent years, studies have shown that the compounds obtained by the transformation of asparagine have high medicinal value and exhibit good biological activities in aspects such as anti-inflammatory, blood pressure lowering, and hemostasis. For example, captopril (ACEI) type blood pressure lowering drugs, endomorphin-2 (EM2) type analgesic drugs, and anti-inflammatory drug N-[β-(p-substituted benzoyl)ethyl] asparagine, etc. The main methods for synthesizing L-asparagine are chemical synthesis, plant extraction, and biosynthesis. Among them, biosynthesis has the advantages of simple process, low equipment requirements, high production efficiency, low energy consumption, and small pollution. However, there are still problems such as relatively low activity of key enzymes. Given the importance of L-asparagine, it is urgent to develop an efficient method for synthesizing L-asparagine to promote the production and application of L-Asn.

[0003] In the existing biological synthesis, L-aspartic acid is used as a substrate, and asparagine synthetase A is used to carry out an ammonia connection reaction on its side-chain carboxyl group to synthesize L-asparagine. Asparagine synthetase A is a multifunctional enzyme that uses ATP as a cofactor to functionalize the C-O bond of amino acids and is considered one of the important catalysts for amino acid amidation. Currently, in the synthesis of L-asparagine, Cheng Chi reported in 2015 that an asparagine synthetase A derived from Escherichia coli carried out an ammonia connection reaction with L-aspartic acid and NH4 + to synthesize L-asparagine, where the substrate dosage was 0.1 - 0.2 M L-aspartic acid and 0.1 - 0.2 M ATP, and the reaction was carried out at 37°C, with the L-asparagine production intensity of 15.81 g / L / h; Ma Jiangfeng reported in 2016 an engineered bacterium co-expressing fumarase, aspartase, and asparagine synthetase A, which could convert fumaric acid into L-aspartic acid under the catalysis of aspartase, and then convert L-aspartic acid into L-asparagine under the catalysis of asparagine synthetase A, with the L-asparagine production intensity of 6.93 g / L / h; Luo Wei reported in 2021 an asparagine synthetase A derived from Lactobacillus salivarius, which could convert L-aspartic acid into L-asparagine, and the L-asparagine production intensity reached 1.44 g / L / h. Although a large number of related bioenzymes for catalyzing the synthesis of L-asparagine have been reported, there are generally problems of relatively low enzyme activity and L-asparagine production intensity. Facing these problems, it is expected to modify the asparagine synthetase A derived from Escherichia coli by means of protein engineering to obtain an asparagine synthetase A with improved activity and complete the low-cost industrial synthesis of L-asparagine. SUMMARY OF THE INVENTION

[0004] In view of the deficiencies of the prior art, the present invention provides an aspartate aminotransferase A mutant for the production of L-asparagine and its application, aiming to efficiently synthesize L-asparagine from inexpensive substrates L-aspartic acid and cofactor ATP through genetically engineered bacteria, and solve the technical problems that the activity of aspartate aminotransferase A in the existing biological synthesis is low, resulting in too low yield of L-asparagine and the production intensity still needs to be further improved.

[0005] The first technical solution provided by the present invention is an aspartate aminotransferase A mutant, which is a mutation of leucine at position 109 and / or lysine at position 58 of the aspartate aminotransferase A parent, and the amino acid sequence of the aspartate aminotransferase A (EcAsnA) is shown in SEQ ID NO.1.

[0006] In some embodiments, the nucleic acid sequence of the gene encoding the EcAsnA is shown in SEQ ID NO.2.

[0007] In some embodiments, the mutant is mutated as shown in any one of the following (a)-(c) to the parent:

[0008] (a) Mutating leucine L at position 109 to lysine K;

[0009] (b) Mutating lysine K at position 58 to arginine R;

[0010] (c) Mutating leucine L at position 109 to lysine K and mutating lysine K at position 58 to arginine R.

[0011] Compared with the EcAsnA parent, the mutant mutates its amino acid at position 109 to obtain the mutant EcAsnA L109K .

[0012] Compared with the EcAsnA parent, the mutant mutates its amino acid at position 58 to obtain the mutant EcAsnA K58R .

[0013] Compared with the EcAsnA parent, the mutant mutates its amino acids at positions 109 and 58 to obtain the mutant EcAsnA L109K / K58R .

[0014] In some embodiments, the mutant EcAsnA L109K 、EcAsnA L109K / K58RThe amino acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.5 respectively, and the nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.6 respectively.

[0015] The method for obtaining the EcAsnA mutant includes the following steps:

[0016] (1) Determine the mutation sites based on the amino acid sequence of asparagine synthetase A (EcAsnA) in Escherichia coli; design mutant primers for saturation mutagenesis, and perform saturation mutagenesis using the vector carrying the EcAsnA gene as a template; construct a plasmid vector containing the mutant.

[0017] (2) Transform the mutant plasmid into a host cell.

[0018] (3) Select positive clones for fermentation culture and purify EcAsnA.

[0019] The second technical solution provided by the present invention is a gene encoding the mutant described in the first technical solution.

[0020] The third technical solution provided by the present invention is an expression vector carrying the gene described in the second technical solution.

[0021] In some embodiments, pET-28a(+) is used as the expression vector.

[0022] The fourth technical solution provided by the present invention is a genetically engineered bacterium expressing the mutant described in the first technical solution, or containing the gene described in the second technical solution, or transformed with the expression vector described in the third technical solution.

[0023] In some embodiments, the genetically engineered bacterium uses Escherichia coli as the starting strain.

[0024] Preferably, Escherichia coli BL21(DE3) is used as the expression host.

[0025] In some embodiments, the gene encoding EcAsnA is ligated into the expression vector pET28a to successfully construct the recombinant vector EcAsnA-pET-28a, which is then transferred into E. coli BL21(DE3) to obtain the genetically engineered bacterium EcAsnA-pET-28a-BL21(DE3).

[0026] In some embodiments, construct an expression vector EcAsnA L109K / K58R carrying the gene encoding L109K / K58R EcAsnA L109K / K58R- The pET-28a was introduced into Escherichia coli BL21(DE3) to form EcAsnA L109K / K58R - The genetically engineered bacterium pET-28a-BL21(DE3).

[0027] The fifth technical solution provided by the present invention is a method for preparing L-asparagine. Using L-aspartic acid and NH4Cl as substrates, and using the mutant described in the first technical solution or the genetically engineered bacterium described in the fourth technical solution as a catalyst to form a catalytic system for catalytic production of L-asparagine.

[0028] In some embodiments, the catalytic system is 10 mL, wherein, L-aspartic acid is 200 mM, NH4Cl is 200 mM, ATP200 is 200 mM, MgCl2 is 200 mM, and the dosage of the catalyst is 30 μM mutant or 20 g / L genetically engineered bacterium.

[0029] In some embodiments, the buffer solution of the catalytic system is 200 mM Tris-HCl.

[0030] In some embodiments, the pH of the catalytic system is 8.0, the catalytic reaction temperature is 37 °C, and the catalytic reaction time is 0.5 h.

[0031] The sixth technical solution provided by the present invention is the application of the mutant described in the first technical solution, or the gene described in the second technical solution, or the expression vector described in the third technical solution, or the genetically engineered bacterium described in the fourth technical solution, or the method described in the fifth technical solution in the preparation of L-asparagine or products containing L-asparagine.

[0032] Advantages of the present invention:

[0033] The present invention designs a method for the biosynthesis of L-asparagine using L-aspartic acid and ATP as raw materials and using the mutant of asparagine synthetase A (EcAsnA) with enhanced activity. The overall catalytic process is simple and efficient. Using the purified enzyme for ammonia ligation reaction, in a 10 mL reaction system, reacting with 200 mM L-aspartic acid for 0.5 h, the production intensity of L-asparagine reaches 20.28 g / L / h. Compared with the current EcAsnA that can catalyze L-aspartic acid to produce L-asparagine, the EcAsnA in the present invention L109K / K58R has higher catalytic efficiency, and its catalytic activity is increased to 2603.64 U / mg, which is 4.24 times that of EcAsnA (497.15 U / mg). The present invention provides a new synthesis method for the rapid synthesis of L-asparagine and a new idea for the industrial production of L-asparagine. Description of the Drawings

[0034] Figure 1 The synthesis method for L-asparagine catalyzed by the enzyme EcAsnA

[0035] Figure 2 The analysis result of the expression of the EcAsnA parental enzyme; M: Marker, empty vector: the supernatant of the lysate of E. coli BL21, AsnA: the supernatant of the lysate of EcAsnA-BL21

[0036] Figure 3 The LC-MS diagram of the conversion of L-aspartic acid to L-asparagine by the enzyme EcAsnA using the cofactor ATP. A is the standard product of L-asparagine, and B is the reaction solution of EcAsnA

[0037] Figure 4 The primary screening results of the saturation mutations at the 109th amino acid (A) and the 109th / 58th amino acids (B) of the enzyme EcAsnA

[0038] Figure 5 For the mutant enzyme EcAsnA L109K , EcAsnA L109K / K58R And the yield diagram of the catalytic production of L-asparagine by EcAsnA on a 10 mL preparation scale

[0039] Figure 6 The production intensity of L-asparagine when the Leu at the 109th site is mutated to other amino acids Specific implementation mode

[0040] The following describes the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention

[0041] Gene source: The gene of the biocatalyst EcAsnA involved in the present invention is derived from Escherichia coli. The plasmid pET-28a(+) is purchased from Novagen (Madison, WI, U.S.A.). The ClonExpress II One Step Cloning Kit, Primer Star Max, DpnI, etc. are purchased from TaKaRa (Dalian, China). All EcAsnA mutants are obtained by molecular modification

[0042] The host used is E. coli BL21(DE3), the vector is pET-28a(+), and the resistance is kanamycin resistance. The following embodiments mutate the parental genetic engineering strain E. coli-EcAsnA-pET-28a to screen for high-yield strains

[0043] Preparation of LB medium: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, sterilized at 121 °C for 20 min.

[0044] Preparation of TB fermentation medium: tryptone 12 g / L, Angel yeast extract FM 802 24 g / L, glycerol 4 g / L, KH2PO4 2.31 g / L and K2HPO4 12.31 g / L.

[0045] Determination of L-aspartic acid and L-asparagine by HPLC: The specific steps are referred to the literature Anal. Biochem., 1984, 136(1): 195 - 201 (A high-performance liquid chromatography assay for asparagine synthetase).

[0046] Determination of the content of the product L-asparagine: The reaction product was determined by high-performance liquid chromatography (HPLC). The liquid-phase detection conditions are referred to the above-mentioned determination of L-aspartic acid and L-asparagine by HPLC.

[0047] Determination of enzymatic parameters: Set the substrate concentrations to 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 mM. After mixing with 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, and 200 mM ATP, adjust the pH to 8.0 with ammonia water. Add EcAsnA with a final concentration of 0.1 mg / ml and react at 37 °C for 30 min at a rotation speed of 220 rpm. After the reaction, terminate the reaction with 50 mM HCl. Detect the content of L-asparagine by HPLC, and use the Michaelis-Menten fitting of non-linear regression in Origin to analyze enzyme kinetics (K m , V max ), k cat = V max / E, where E is the molar concentration of the enzyme molecule.

[0048] Example 1

[0049] I. Construction and expression of the engineering bacterium EcAsnA-pET28a-BL21(DE3)

[0050] The genome of Escherichia coli was extracted and used as a template. The target protein sequence AsnA was amplified (shown in SEQ ID NO.1) by primers AsnA-F (ATGGGTCGC GGATCCATGAAAACCGCTTACATTGCCA) and AsnA-R (ACGGAGCTCGAATTCTTACAGCAGAGAAGGGACGCT) and connected to the pET-28a (+) vector. After obtaining the recombinant expression plasmid EcAsnA-pET-28a, it was transferred into E.coli BL21 (DE3), and the positive engineering bacteria were named EcAsnA-pET-28a-BL21 (DE3). The EcAsnA-pET28a-BL21 (DE3) strain was transferred to 3 mL LB liquid culture medium and cultured overnight at 37°C. Subsequently, the inoculum was transferred to 150 mL of TB liquid medium at a ratio of 2:100 and cultured at 220 rpm and 37 °C. 600 When the value is between 0.4-0.8, add IPTG with a final concentration of 0.4mM, induce culture at 25℃ for 16h, and collect the bacteria after centrifugation. Add 10mL of binding solution A (25mM Tris-HCl, 250mMNaCl, 20mM imidazole, adjust pH to 8.0 with HCl) to fully resuspend the bacteria, then place the centrifuge tube in an ice bath and put it into an ultrasonic cell disruptor. The conditions for ultrasonic disruption are: working time 3.5s, interval time 2.5s, a total of 5min. The obtained disrupted liquid was subjected to low-temperature high-speed centrifugation, centrifuged at 4℃ and 10000rpm for 30min, and then identified by SDS-PAGE electrophoresis that the target enzyme AsnA was successfully expressed ( Figure 2 ). Next, the recombinant bacteria are used to transform and produce L-asparagine. The reaction process is as follows Figure 1 As shown. 20g / L of recombinant wet bacteria was mixed with 200mM L-aspartic acid, 200mM NH4Cl, 200mM MgCl2, and 200mM ATP. The pH was adjusted to 8.0 with ammonia water and then reacted at 37°C for 30min at a speed of 220rpm. After the conversion reaction was completed, 50mM HCl was added to terminate the reaction; after centrifugation at 12000rp m for 10min, the product was filtered through a 0.22μmol filter and derivatized with o-phthalaldehyde OPA (volume ratio 1:1). LC-MS detection showed that EcAsnA reacted to generate the target product L-asparagine ( Figure 3 ).

[0051] 2. Determination of catalytic activity of parent enzyme EcAsnA

[0052] Before measuring the catalytic activity of the parental enzyme EcAsnA, EcAsnA was purified by nickel column. First, at 4°C, using a constant flow pump, ultrapure water was pumped into the nickel ion affinity chromatography column to wash the column (about 6 - 12 column volumes), and then 10 mL of binding solution A was used to equilibrate the column environment. When the pH value of the effluent at the lower end of the column was the same as that of the low-salt concentration buffer pumped into the column (about 5 column volumes of buffer were required), the obtained crude enzyme solution after passing through the membrane was added to the column. The column was first washed with binding solution A to baseline equilibrium for the miscellaneous proteins, and then eluted with elution solution B (25 mM Tris-HCl, 250 mM NaCl, 500 mM imidazole). The eluate at the absorption peak was collected and the enzyme activity was measured.

[0053] The catalytic activity assay system of the parental enzyme EcAsnA contained 0.5 mg / ml pure enzyme, 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP, the reaction temperature was 37°C, the pH was 8.0, the conversion time was 30 min, and the rotation speed was 220 rpm. After the conversion reaction ended, 50 mM HCl was added to terminate the reaction; after centrifugation at 12000 rpm for 10 min, it was filtered through a 0.22 μmol filter membrane and derivatized with OPA, and the production of the product L-asparagine was detected using an HPLC ultraviolet detector at 338 nm. Definition of enzyme activity: 1 U is the amount of enzyme consumed to produce 1 μM product per minute. It was calculated that the specific enzyme activity of the parental enzyme EcAsnA was 497.15 U / mg.

[0054] III. Construction of single mutants and double mutants

[0055] Construction of mutants: Primers for single mutation sites and double mutation sites of EcAsnA were designed, as shown in Table 1, and mutants were constructed by whole plasmid PCR.

[0056] Table 1 Mutation primer sequences

[0057]

[0058] When constructing the PCR amplification system for the reaction, the Prime Star Max system was used. Using the plasmids containing EcAsnA-pET-28a and EcAsnA L109K -pET-28a as templates respectively, PCR was carried out using the primers shown in Table 1. The Prime Star Max system is shown in Table 2. The PCR reaction conditions were: ① 98°C for 30 s; ② 98°C for 10 s; ③ 55°C for 30 s; ④ 72°C for 1 min 20 s; ⑤ The three steps of ② - ④ were cycled 34 times; ⑥ 72°C for 10 min; ⑦ Incubated at 12°C.

[0059] Table 2 Prime Star Max system table

[0060]

[0061] Incubate the above PCR reaction system in a 37°C metal bath for 30 min to digest the plasmid template (the digestion system is: 0.3 μL of DpnI quick, 8.7 μL of the above PCR reaction product, and 1 μL of 10×T Buffer). After digestion, the digestion product is obtained.

[0062] Transformation: Introduce the above digestion product into E. coli BL21(DE3) competent cells by heat shock method. The specific transformation steps are as follows:

[0063] (1) Introduce 10 μL of the PCR product into 100 μL of E. coli BL21(DE3) competent cells;

[0064] (2) Incubate on ice for 30 min;

[0065] (3) Heat shock in a 42°C water bath for 60 s, then quickly take it out and place it on ice and let it stand in the ice bath for 3 - 5 min;

[0066] (4) Add 600 μL of antibiotic-free LB medium, mix well, and culture at 37°C and 220 rpm for 1 h;

[0067] (5) Centrifuge at 4000 rpm for 2 min;

[0068] (6) Discard the supernatant, resuspend the cells with the remaining 100 - 200 μL of LB medium by pipetting, and spread them on a kanamycin-resistant plate containing 0.05 mg / mL kanamycin, and incubate at 37°C for about 12 h.

[0069] IV. Mutant strain EcAsnA L109K -pET-28a-BL21(DE3) and EcAsnA L109K / K58R -Screening of pET-28a-BL21(DE3)

[0070] Pick monoclonal colonies into a 96-well deep-well plate containing kanamycin-resistant LB liquid medium at 0.05 mg / mL, culture at 220 rpm and 37°C for 12 h, then add TBA liquid medium and continue to culture at 220 rpm and 37°C; after culturing for 2 - 3 h, transfer to 25°C for induction for 16 h, and then centrifuge at 10,000 rpm for 30 min.

[0071] Screening conditions: Add the reaction solution (pH 8.0) containing 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, and 200 mM ATP to a 96-well plate and react at 37 °C for 30 min. After the reaction, centrifuge at 10,000 rpm for 30 min, take 90 μL of the supernatant of the reaction solution, mix it with a 1 g / L aqueous solution of catechol violet at a volume ratio of 9:1 for color development, and the results are as Figure 4 shown in Figures A and 4B. The results show that the reaction solutions of 42 mutants at the L109 site and 17 combined mutants at the L109 site / K58 site can turn catechol violet yellow. Subsequently, these mutants were sent to Tianlin Biotechnology Company for sequencing.

[0072] Inoculate the mutant strains with correct sequencing into LB seed medium, culture at 220 rpm and 37 °C for 8 - 12 h, inoculate them into the shake flask fermentation medium at an inoculation amount of 2% respectively, culture at 220 rpm and 37 °C until OD600 = about 0.6 - 0.8, add IPTG with a final concentration of 0.2 mM for induction, and the induction conditions are 220 rpm and 25 °C for 16 h. Ultrasonically disrupt and purify the induced bacterial cells and then measure the catalytic activity. The catalytic activity measurement system is: 0.5 mg / mL pure enzyme, 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP (pH 8.0), the reaction temperature is 37 °C, the pH is 8.0, the conversion time is 30 min, and the rotation speed is 220 rpm. After the reaction, take a part of the conversion solution, centrifuge at 10,000 rpm for 30 min, filter the supernatant with a 0.22 μm microfiltration membrane and then use HPLC method for determination. The results show that the specific enzyme activities of mutant EcAsnA L109K and EcAsnA L109K / K58R reach 2079.84 U / mg and 2603.64 U / mg respectively, which are 3.18 times and 4.24 times higher than that of the wild type; their k cat values are 1.46 s -1 and 1.71 s -1 respectively, which are increased by 40.38% and 64.42% compared with the wild type (k cat = 1.04 s -1 ); the K m values are 2.18 mM and 2.74 mM respectively, with little change compared with the wild type (K m = 2.65 mM); the k cat / K m values are 669.13 M -1 s -1 and 624.34 M -1 s -1 respectively, which are compared with the wild type (k cat / Km = 393.74 M -1 s -1 ) increased by 69.94% and 36.94% respectively.

[0073] Example 2

[0074] EcAsnA L109K / K58R Large-scale reaction for the preparation of L-asparagine

[0075] This example uses EcAsnA in Example 1 L109K / K58R -pET-28a-BL21(DE3) was used for whole-cell catalysis in a 10 mL reaction system. The conversion conditions were as follows: the addition amount of genetically engineered bacteria was 20 g / L, 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP (pH 8.0), the reaction temperature was 37 °C, the pH was 8.0, the reaction time was 30 min, and the rotation speed was 220 rpm. After the reaction, a part of the conversion solution was centrifuged at 10,000 rpm for 30 min, and the supernatant was filtered through a 0.22 μm microfiltration membrane and then the yield was measured by HPLC method. The results were as Figure 5 shown. The results showed that the production intensity of the mutant EcAsnA L109K / K58R reached 20.28 g / L / h.

[0076] Example 3

[0077] Referring to the method of Example 1, Leu at position 109 was mutated into other amino acids, and whole-cell catalysis was carried out according to the method of Example 2. The results were as Figure 6 shown. When Leu was mutated to Lys, the production intensity of L-asparagine reached the highest at 17.08 g / L / h; followed by mutations to Ala, Thr, Cys, Gly, Ser, Gln, Ile, Met, Arg, Trp, Tyr, and the production intensities were 16.01 g / L / h, 15.98 g / L / h, 15.97 g / L / h, 15.95 g / L / h, 15.95 g / L / h, 15.21 g / L / h, 15.19 g / L / h, 15.03 g / L / h, 14.00 g / L / h, 13.88 g / L / h, 13.65 g / L / h respectively; when Leu was mutated to Val, the production intensity of L-asparagine was 10.49 g / L / h.

[0078] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An asparagine synthetase A mutant, characterized in that: The mutant is obtained by subjecting the asparagine synthetase A parent with the amino acid sequence shown in SEQ ID NO.1 to any of the following mutations: (a) mutating the leucine L at position 109 to lysine K, alanine A, threonine T, cysteine ​​C, glycine G, serine S, glutamine Q, isoleucine I, methionine M, arginine R, tryptophan W or tyrosine Y; (b) The leucine L at position 109 was mutated to lysine K and the lysine K at position 58 was mutated to arginine R.

2. A gene encoding the mutant according to claim 1.

3. An expression vector carrying the gene according to claim 2.

4. The expression vector according to claim 3, characterized in that pET-28a(+) was used as the expression vector.

5. A genetically engineered bacterium expressing the mutant according to claim 1, or containing the gene according to claim 2, or transformed with the expression vector according to claim 3 or 4.

6. The genetically engineered bacterium according to claim 5, characterized in that: The genetically engineered bacteria uses Escherichia coli as a starting strain.

7. A method for preparing L-asparagine, characterized in that: L-aspartic acid and NH4Cl are used as substrates, and the mutant described in claim 1 is used as a catalyst to form a catalytic system to catalyze the production of L-asparagine.

8. A method for preparing L-asparagine, characterized in that: L-aspartic acid and NH4Cl are used as substrates, and the genetically engineered bacteria described in claim 5 or 6 are used as catalysts to form a catalytic system to catalyze the production of L-asparagine.

9. Use of the mutant according to claim 1, or the gene according to claim 2, or the expression vector according to claim 3 or 4, or the genetically engineered bacteria according to claim 5 or 6, or the method according to claim 7 or 8 in the preparation of L-asparagine or a product containing L-asparagine.

Images