A protein TaPSKR-6D related to plant grain size, its coding gene and applications

Abstract

The present invention relates to the field of genetic engineering technology, and specifically discloses a plant grain size-related protein TaPSKR-6D, its encoding gene and applications. The protein provided by the present invention is named TaPSKR-6D protein, the amino acid sequence of the TaPSKR-6D protein is shown in SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.1. The TaPSKR-6D protein and its encoding gene provided by the present invention play an important role in increasing the grain size of plants and play an important role in cultivating new varieties of high-yield crops.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a plant grain size-related protein TaPSKR-6D, its encoding gene, and applications thereof. Background Art

[0002] Improving crop yields is a key issue that modern agriculture urgently needs to solve. Grain size is an important agronomic trait affecting wheat yields. It is closely related to the wheat grain weight trait, and both grain weight and grain size also affect the end-use quality. Therefore, grain size and grain weight are also the main objectives of domestication and artificial breeding.

[0003] Leucine-rich receptor-like kinases play important roles in the process of plant growth and development. Cloning excellent related genes of receptor-like protein kinases and studying their mechanisms of grain weight formation in plants are of great significance for the study of the mechanism of plant grain size. In addition, using genetic engineering means to improve crop yields also has important practical significance for the cultivation of new varieties. Summary of the Invention

[0004] To obtain a method for constructing a high-yield transgenic line, the present invention provides a plant grain size-related protein TaPSKR-6D, its encoding gene, and applications thereof. The TaPSKR-6D protein and its encoding gene provided by the present invention play important roles in increasing plant grain size and play important roles in cultivating new varieties of high-yield crops.

[0005] The present invention provides a plant grain size-related protein TaPSKR-6D, and the amino acid sequence of the protein TaPSKR-6D is as shown in SEQ ID NO.2.

[0006] The present invention also provides a gene encoding the protein TaPSKR-6D. The gene is named TaPSKR-6D gene, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant plasmid containing the TaPSKR-6D gene. The recombinant plasmid is pCAMBIA1300-TaPSKR-6D-EGFP. The construction process of this recombinant plasmid is: replacing the small fragment of the KpnⅠ and XbaⅠ enzyme digestion sites of the pCAMBIA1300-EGFP vector with the DNA molecule shown by the 137th to 3289th nucleotides from the 5' end of the TaPSKR-6D gene sequence.

[0008] The present invention also provides a recombinant vector containing the TaPSKR-6D gene, and the recombinant vector is p2300-Actin-TaPSKR-6D. The construction process of this recombinant vector is as follows: the small fragment between the restriction enzyme sites PstI of the p2300-Actin vector is replaced with the DNA fragment shown at positions 137-3292 of the TaPSKR-6D gene.

[0009] The present invention also provides the application of the protein TaPSKR-6D or the TaPSKR-6D gene in the cultivation of transgenic plants, and the transgenic plants are large-grain high-yield transgenic plants.

[0010] Furthermore, the transgenic plants include Arabidopsis transgenic lines and rice transgenic lines.

[0011] The present invention also provides the application of the above recombinant plasmid in the cultivation of transgenic Arabidopsis.

[0012] Furthermore, the seed size and 1000-grain weight of the transgenic Arabidopsis are higher than those of the wild type.

[0013] The present invention also provides the application of the above recombinant vector in the cultivation of transgenic rice.

[0014] Furthermore, the seed size and 1000-grain weight of the transgenic rice are higher than those of the wild type.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] 1. The TaPSKR-6D protein and its coding gene provided by the present invention play an important role in increasing the seed size of plants and will play an important role in the cultivation of new high-yield crop varieties.

[0017] 2. The present invention constructs a recombinant expression vector using the TaPSKR-6D gene to transform rice or Arabidopsis to obtain transgenic Arabidopsis and transgenic rice. Compared with the wild type, the seeds of the transgenic plants are significantly larger. The TaPSKR-6D and its coding gene provided by the present invention are of great significance in increasing the seed size of plants and will provide gene resources for the cultivation of new high-yield plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1Expression of TaPSKR-6D gene in different tissues.

[0020] Figure 2 Expression pattern of TaPSKR-6D gene under abiotic stress.

[0021] Figure 3 Subcellular localization of TaPSKR-6D in tobacco leaves.

[0022] Figure 4 Root phenotypes of TaPSKR-6D overexpressing Arabidopsis thaliana;

[0023] In the figure, A is the comparison of root systems between wild type and transgenic lines; B is the lateral root morphology of wild type and transgenic lines under mannitol stress; C is the statistical analysis of lateral root number of wild type and transgenic lines.

[0024] Figure 5 Seed size phenotypes of TaPSKR-6D overexpressing Arabidopsis thaliana;

[0025] In the figure, A is the seed morphological phenotype of wild type and transgenic lines; B is the statistical analysis of seed size of wild type and transgenic lines; C is the statistical analysis of 1000-seed weight of wild type and transgenic lines.

[0026] Figure 6 Phenotypes of TaPSKR-6D overexpressing rice;

[0027] In the figure, A is the seed phenotype of wild type and transgenic rice; B is the comparison of 1000-seed weight between wild type and transgenic rice; C is the comparison of grain length between wild type and transgenic lines; D is the comparison of grain width between wild type and transgenic lines. Detailed implementation mode

[0028] The following is a detailed description of the specific implementation mode of the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific implementation mode. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0029] Example 1: Cloning of TaPSKR-6D gene.

[0030] Select plump seeds of Jinmai 47, disinfect them with 1% sodium hypochlorite for 5 min, rinse them three times with sterile water, then place them in a petri dish lined with filter paper and culture them in the dark for 48 h (25 °C). After the seeds germinate, place them in a light incubator (light / dark cycle 16 / 8 h, temperature 25 / 20 °C) for hydroponic culture. After 7 days, change to 1 / 2 Hoagland nutrient solution for continuous culture, and change the nutrient solution every two days. When the seedlings grow to two leaves and one heart, use the RNAprep pure Plant RNA Extraction Kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract total RNA. Use the reverse transcription kit (ReverTra Ace qPCR RT Master Mix with gDNA Remover) from TOYOBO Co., Ltd. to synthesize single-stranded cDNA. Using the cDNA of the root tissue of Jinmai 47 grown to the three-leaf stage as a template, use the specific primer pair TaPSKR-F1 (nucleotide sequence as shown in SEQ ID NO.3) and TaPSKR-R1 (nucleotide sequence as shown in SEQ ID NO.4) for amplification. The amplified product was detected by 1% agarose gel electrophoresis to obtain a PCR amplified product of about 3000 bp. After sequencing, the nucleotide sequence of this PCR product is as shown in SEQ ID NO.1. The gene shown by this PCR product was named TaPSKR-6D. The full-length sequence of this gene is 3483 bp. Nucleotides 1-136 from the 5' end are 5' UTR, nucleotides 137-3292 are the open reading frame, and nucleotides 3293-3483 are 3' UTR. The protein encoded by this gene was named TaPSKR-6D, which consists of 1051 amino acid residues, and its amino acid sequence is as shown in SEQ ID NO.2.

[0031] SEQ ID NO.3: CATTCATTGGTTCCCTTTGCT

[0032] SEQ ID NO.4: TGTGCATTGCAGCATAATTTGC

[0033] SEQ ID NO.1:

[0034] CCTTCGCCTGAGAGCGACCTGAGGAGAGGATCAAACAAAAAGGAGCCGTGAGCTCCTTGTGTCCCGTTCCTCTCGTGCTCTTTCTTCACCAGCCCGGCCATTCATTGGTTCCCTTTGCTAGCTTCCTCAGAAAGCCATGCAGATGCAGCCACACCATTGCCCAAACAGGAGCAGGCCTTTCCTCGGCTTGGCCCTCCTGCTGCTGCTCGTCTCCTTGGCCTCCCCGGCCAGCTCCTGCACGGCGCAGGAGAGGAGCTCCCTCCTCCAGCTCCTCGCTGGGCTCTCGCGGGACGACGGGCTTGCGGCGGCCTGGCGGAGGAACACGGACTGCTGCACGTGGGATGGGATCACCTGCGGCGGCCCCGATGGAGCGGTCACCGATGTTTCGCTGGCTTCTCGAGGCCTCGAGGGGTCCATCTCGCCGTTCCTGGGCAACCTCACCGGCCTCCTCCGCCTCAACCTGTCACGCAACTCGCTGTCCGGCGGCTTGCCGCTGGAGTTGGTGTCATCGAGCAGCATCGTTGTCCTTGACGTCAGCTTCAACCGCCTGACTGGAGTGCTGAGCGAGCTGCCACCTTCAACACCTGCGCTGCCTCTGCAGGTACTCAACATCTCAAGCAACCTGTTTACAGGAAGGTTTCCATCTGCTATATGGGAGGTGATGAAGAGCCTGGTCGCGCTCAATGCCAGCACCAACAGCTTTACTGGGCAGATACCAATTACCCCCTGTGTGAGCGCGCC

[0035] GTCTTTGGCCGTGCTCGAACTCAGTTTTAACGAGTTCAGTGGAAATATCC

[0036] CTCCAGGACTCAGTAATTGCTCCATGCTGAAACTCCTCGGCGCTGGCTAC

[0037] AACAACCTCAATGGGACTCTTCCAGACGAGCTCTTCAAAGTTACCTCGTT

[0038] AGAGCACCTCTCTTTGCCTAGCAATGGCTTAGAAGGAGCTATCAATGGCA

[0039] TCAGCAAGCTCACAAATCTGGTCGCCCTTGATCTTGGGGGGAATGAGCTC

[0040] ACTGGCAGTATTCCAGAGTCTATTGGTGAGCTGAAGAGATTGGAGGAGCT

[0041] GCATTTGGAACACAATAACATGTCAGGGGAGCTGCCATCAACTCTGAGCA

[0042] ACTGCACAAATCTCGTAACAATTGACCTCAAGAGCAACCAGTTCATTGGA

[0043] GAACTTACCCAGGTCAACTTCACAAGCCTGCCAAATCTAAAAGTTTTAGA

[0044] TCTTCTGTACAACAACTTAACAGGCACAGTTCCAGAAAGCATGTACTCCT

[0045] GCAGCCGGCTGACTGCAATACGGCTATCTAGTAACAATTTCCATGGCCAG

[0046] TTGTCAGAAAGAATAGGCAATCTGAAGTCCCTCGCATTCCTGTCACTTGT

[0047] TAACAACTCCCTGACAAATATCACAAGAACACTTCAGATCCTTAGGAGTT

[0048] CCAGGAGCCTCACCACCCTTCTTCTTGGGTTCAACTTCATGCATGAGACC

[0049] ATGCCAGAGGATATCAACACTGATGGTTTTGGGAGTCTTCAGGTTTTTTC

[0050] GATGAATGACTGTTCATTGTCTGGAACAATTCCTCATTGGTTATCAAAGCT

[0051] ACCGAATTTGGAGATGTTATTTTTACACAACAATCACCTCACTGGGTCAAT

[0052] ACCTGACTGGATCAGCAGCCTAAACTTGCTCTTCTATCTAGACATAACAA

[0053] ACAACAGCCTTACAGGGGAAATTCCAAGTGCCTTAATGGAGATGCCAATG

[0054] CTAAAGTCAGACAAAACTGCACCAAAGGTCTTTGAGCTGCCTGTTTATAA

[0055] TAAGAGCCCATTTATGCAATATCGCATGCCCAGTGCTTTTCCTAAAGTACT

[0056] GAATCTAGGGATGAATAACTTCACTGGCGTGATACCTGAGAAGATTGGTC

[0057] AGTTGAAAGGACTCGTTTCCCTCAACCTGAGCTCCAACCAACTATCTGGA

[0058] GAGATCCCAGAAGCAATCTGCAACCTCACGAACCTGCAGGCGCTCGACT

[0059] TGTCTGGTAATCATCTCATTGGTACAATTCCAGCTGCACTAAACAATCTGC

[0060] ACTTCCTTTCCAAATTCAACATTTCCAATAATGACCTAGAAGGATCTATTC

[0061] CGGCTGTGGGGCAGCTTAGCACGTTTCCAAATTCTAGCTTTGATGGCAAC

[0062] CCAAAATTGTGCGGCCATATGCTTGTAAACCACTGCGGCTCAGCTGAAAC

[0063] ACCTCTGATCACCCAGAGACGAAAGAAAAAGAAGAGTGTTTTTGCACTT

[0064] GCATTTGGTGTATTTTTCGGAGGGGTGGCCATTCTTTTCTTGCTGGCTCGT

[0065] CTCCTTGTCTTGCTCAAGGGTACAAGTTTCATGAAAAAAAGGCAGAACA

[0066] ACAACAGCGATGACATAGAGGCAACATCTTCAAATCTCAATTCAGAATAC

[0067] TCCTTGGTGATGGTTCCACGAGGCAAGGGAGAACAAAACAAACTCACAC

[0068] TGACGGATCTCCTGAAGGCTACAAAGAACTTTGACAAGGATCATATCATT

[0069] GGCTGTGGAGGATATGGGCTAGTCTACAAGGCTGAGCTACCTGATGGCTC

[0070] AAAGGTCGCCATAAAAAAGCTCAATAGTGAAATGTGTCTGATGGAAAGG

[0071] GAATTCAGTGCAGAGGTTGATGCACTCTCCACGGCAGAGCATGACAATCT

[0072] TGTACCATTCTGGGGTTACTGCATACAGGGAGATTCAAGACTACTGATATA

[0073] CTCCTACATGGAGAACGGCAGCCTGGATGATTGGCTTCACAACAGGGAC

[0074] AATGATGACAGCCCATTTCTTGACTGGCCGATGCGGCTGAAGATTGCACA

[0075] AGGAGCAAGCCAGGGTCTATCTTACATCCACGATGGATGCAAGCCTCACA

[0076] TTGTTCACCGTGACATCAAGTCGAGCAACATCCTACTGGACAAAGACTTC

[0077] AAAGCTTATGTTGCAGACTTTGGGCTGTCCAGATTGATCTTTCAAAACAG

[0078] AACTCATGTGACAACTGAGTTGGTTGGTACTCTCGGTTACATCCCCCCAG

[0079] AGTACGGGCAAGGATGGGTTGCTACATTGAGAGGTGATATGTACAGTTTT

[0080] GGTGTGGTCCTGCTTGAACTGGTCACGGGGAGGCGGCCTGTTCAAATCT

[0081] GTCCCAGGTCAAAAGAGCTTGTCAAGTGGGTACAGGAGATGAGATCCAA

[0082] AGGGAAGCAGATTGAAGTCCTGGATCCAACACTTCGAGGCACAGGATAT

[0083] GAAGAACAGATGCTGAAGGTGCTTGAAGTTGCTTCCCAGTGTGTCGACC

[0084] ACAATCCTGGCGTGAGGCCAGCCATACAGGAGGTAGTATCTTTCCTGAAC

[0085] ACCATAGACGCTAACCTGCAGAAGCAAAATTCAGTTAGCTCACAATGTAG

[0086] ATAGCAAATTATGCTGCAATGCACAGAGTAGATTGTATAGTATATGCAACA

[0087] GCTACTAGTTCTGTTCTAATTTGTACAGATTGTGACACACCGCTATACGGA

[0088] AATCTTGTAATTCATCTCCGCTTTCCCTCTTCACAACACAAACTGTGTGTG

[0089] CCATGAGTAATGATAATGAGCAGTTGCTCAGTTCATCGATCT

[0090] SEQ ID NO.2:

[0091]

[0092] Example 2: Analysis of the expression pattern of TaPSKR-6D gene

[0093] I. Expression of TaPSKR-6D gene in different organs during wheat development

[0094] Wheat seedlings at the two-leaf and one-heart stage of growth were transferred to a vernalization cabinet at 4°C for about 30 days of vernalization, then transplanted into flower pots filled with nutrient soil and continued to be cultured in the greenhouse. Young spikes, roots, stems, leaves of the plants were collected at the booting stage of wheat, and grains at 10 days of the filling stage. The above materials were stored at -80°C for subsequent specific expression analysis of the target gene.

[0095] Total RNA of the above different tissues was extracted, and the first strand of cDNA was synthesized. The expression of TaPSKR-6D gene in different tissues was detected by qRT-PCR. The primer pair PF-1 (nucleotide sequence shown in SEQ ID NO.5) and PR-1 (nucleotide sequence shown in SEQ ID NO.6) was used to detect the expression pattern of TaPSKR-6D gene, and the primer pair PF-2 (nucleotide sequence shown in SEQ ID NO.7) and PR-2 (nucleotide sequence shown in SEQ ID NO.8) was used to detect the expression of TaActin. Wheat TaActin was used as the internal reference gene, and the gene expression level was calculated using 2 －ΔΔCt for calculation.

[0096] The experimental results are as Figure 1 shown. The expression level of TaPSKR-6D gene was the highest in roots, followed by leaves, stems, seeds and spikes.

[0097] SEQ ID NO.5: 5'-TCCTGAACACCATAGACGCTAA-3'

[0098] SEQ ID NO.6: 5'-TTCCGTATAGCGGTGTGTCA-3'

[0099] SEQ ID NO.7: 5'-GACCCAGACAACTCGCAAC-3'

[0100] SEQ ID NO.8: 5'-GGAATCCATGACCACCTAC-3'

[0101] II. Expression pattern of TaPSKR-6D gene under drought and salt stresses

[0102] 1. Drought stress: Wheat seedlings at the two-leaf and one-heart stage with consistent growth status were treated with 20% PEG-6000, and the culture conditions were 16 hours of light / 8 hours of darkness.

[0103] 2. High-salt treatment: Wheat seedlings at the two-leaf and one-heart stage with consistent growth status were treated with 200 mmol / L NaCl, and the culture conditions were 16 hours of light / 8 hours of darkness.

[0104] 3. Control treatment: Hydroponic culture was carried out with a nutrient solution, and the culture conditions were 16 hours of light / 8 hours of darkness.

[0105] After 0, 3, 6, 12, and 24 hours of stress treatment, the leaves and roots of the seedlings in the control group and the treatment group were collected, quickly frozen in liquid nitrogen, and then stored in a -80°C refrigerator for later use.

[0106] DNA was extracted from the leaves and roots of the seedlings in the control group and the treatment group collected above, and real-time quantitative detection was carried out according to the method in Part I.

[0107] The real-time quantitative results are as Figure 2 shown. Under PEG stress treatment, the expression of TaPSKR-6D in leaves increased sharply after 48 hours of stress treatment. In roots, the expression level of TaPSKR1-6D was higher than that of the control at 12 and 24 hours of stress treatment. Under NaCl stress conditions, the expression level of the TaPSKR-6D gene in leaves showed an increasing trend with the increase of treatment time, and the gene expression level was the highest at 48 hours of treatment, which was 87 times that of the control. In roots, the TaPSKR-6D gene was up-regulated by salt stress induction. Generally speaking, the response of TaPSKR1 in leaves to salt stress was more intense than that in roots.

[0108] Example 3: Subcellular localization of TaPSKR-6D gene.

[0109] I. Construction of recombinant vector

[0110] 1. mRNA of Jinmai 47 wheat was extracted, and the root tissue cDNA was used as a template. The target gene was amplified using the primer pair composed of GF and GR to obtain a PCR product.

[0111] GF: 5'-CATTCATTGGTTCCCTTTGCT-3'(SEQ ID NO.9)

[0112] GR: 5'-TGTGCATTGCAGCATAATTTGC-3'(SEQ ID NO.10)

[0113] 2. Using the cDNA in step 1 as a template, the target gene was amplified using the primer pair MF and MR to obtain a PCR amplification product.

[0114] TaPSKR-MF:

[0115] 5'-CACGGGGGACGAGCTC GGTACC ATGCAGATGCAGCCACACCAT

[0116] -3'(SEQ ID NO.11)

[0117] TaPSKR-MR:

[0118] 5'-TGCTCACCATGTCGAC TCTAGA TCTACATTGTGAGCTAACTG

[0119] -3'(SEQ ID NO.12)

[0120] In TaPSKR-MF and TaPSKR-MR, the restriction enzyme cleavage sites of KpnⅠ and XbaⅠ are respectively underlined.

[0121] 3. Double digest the vector pCAMBIA1300-EGFP with the restriction enzymes KpnⅠ and XbaⅠ, and recover the vector backbone of about 11 Kb.

[0122] After purification and recovery of the PCR product in step 2, it was ligated to the vector backbone in step 3. Escherichia coli DH5α was transformed by heat shock at 42°C, and positive clone bacteria were selected for sequencing verification. The correct recombinant vector was named pCAMBIA1300-TaPSKR-6D-EGFP. According to the sequencing results, the recombinant vector pCAMBIA1300-TaPSKR-6D-EGFP is described as follows. The small fragment at the KpnⅠ and XbaⅠ restriction enzyme cleavage sites of the pCAMBIA1300-EGFP vector sequence replaced the DNA molecule shown by nucleotides 137-3289 from the 5' end of the TaPSKR-6D gene sequence. The recombinant vector pCAMBIA1300-TaPSKR-6D-EGFP expresses the TaPSKR-6D-EGFP fusion protein.

[0123] 4. Transient transformation of tobacco: Transform the recombinant plasmid pCAMBIA1300-TaPSKR-6D-EGFP into Agrobacterium tumefaciens GV3101. After growing on the plates containing kanamycin and rifampicin for two days, single colonies were selected and cultured in 5 mL of liquid YEB medium. After identification by colony PCR, 1 mL of the overnight cultured Agrobacterium was transferred to 50 mL of liquid medium and cultured until the OD 600 reached 0.6-0.8. The bacteria were collected by centrifugation at 5000 g for 15 minutes and resuspended with the resuspension solution (0.2 mM acetosyringone, 10 mM MgCl2, 10 mM MES, adjusted to pH 5.6 with KOH). Finally, the OD 600It was 1.0. After placing it at room temperature for 2 - 3 h, it was injected into tobacco. Four days after injection, the TaPSKR-6D-GFP fluorescence signal was detected under a laser confocal microscope. The results of subcellular localization are shown in Figure 3, and TaPSKR-6D was mainly localized on the cell membrane.

[0124] Example 4: Functional verification of TaPSKR-6D in Arabidopsis thaliana

[0125] I. Obtaining transgenic Arabidopsis thaliana

[0126] (1) The recombinant plasmid pCAMBIA1300-TaPSKR-6D-EGFP Agrobacterium was added to GV3101 competent cells, placed on ice for 30 min, quickly frozen in liquid nitrogen for 2 min, then water-bathed at 37 °C for 5 min, and placed on ice for 2 min. After that, 1 mL of YEB medium containing only rifampicin was added, and the bacteria were shaken for 4 - 6 h and then spread on a plate containing rifampicin and kanamycin antibiotics.

[0127] (2) After the transformed Agrobacterium was identified by PCR bacterial liquid, it was inoculated into 2 mL of YEB medium containing antibiotics (50 μg / mL kanamycin, 50 μg / mL rifampicin), cultured overnight at 28 °C, and transferred to 200 mL of YEB medium containing the same antibiotics the next day and continued to be cultured until A 600 = 0.8 - 1.0.

[0128] (3) Centrifuge at 4000 r / min for 10 min at room temperature, and gently resuspend the precipitated bacteria with 150 mL of transformation solution (1 / 2 MS, 7.5 g sucrose, Silwet-77).

[0129] (4) Select Arabidopsis thaliana Columbia (Clo-0) plants with the flower buds showing white for transformation. Invert the plants and immerse the inflorescence above the rosette leaves in the bacterial liquid for 1 min.

[0130] (5) Place the plants immersed in the bacterial liquid flat in a tray, seal them with a black light-proof plastic bag and spray water on the bag to maintain humidity.

[0131] (6) Cultivate in the dark for 24 h, remove the black plastic bag, irrigate with nutrient water to recover, and cultivate until the seeds are harvested.

[0132] (7) Disinfect the harvested T0 generation seeds with 1.5% sodium hypochlorite disinfectant for 10 min. Wash them 5 times with sterile water, and evenly sow the washed seeds on 1 / 2 MS solid medium containing the corresponding antibiotic (20 μg / mL hygromycin). Place the seeds at 4 °C for low-temperature treatment for 48 h, transfer them to a 22 °C incubator and grow for about 10 days. Select transgenic Arabidopsis thaliana plants resistant to hygromycin, let the transgenic plants self-cross, screen the resistant plants close to 3:1, plant and harvest the T2 generation seeds, and identify the homozygotes from them.

[0133] II. Phenotypic Identification of Transgenic Arabidopsis

[0134] Seeds of Arabidopsis thaliana Columbia 0 type (Clo-0) and T3 generation transgenic lines (Line1, Line2, and Line3) were taken, disinfected with sodium hypochlorite for 10 min, and then rinsed 5 times with sterilized water. Then they were sown on 1 / 2 MS medium and vertically cultured for 8 d. Three plants were used for each line, and three replicate experiments were set up, and the results were averaged. The statistical results of the lateral roots of Arabidopsis thaliana are as Figure 4 shown in A of Figure 4 and B of

[0135] . The lateral root data of the T3 generation homozygous transgenic Arabidopsis thaliana lines Line1, Line2, and Line3 overexpressing TaPSKR-6D were significantly higher than those of the wild type.

[0136] In addition, Arabidopsis thaliana grown on vertical plates was further transferred to plastic flower pots, with 4 plants transferred to each pot. At the mature stage of the plants, seeds from the middle part of the main stem pods of wild-type and transgenic Arabidopsis thaliana plants were selected, the seeds were arranged neatly, photographed and observed using a stereomicroscope, and the seed size was measured using ImageJ software (http: / / rsbweb.nih.gov / ij / ). 100 seeds from the middle part of the pods were selected, and the thousand-grain weight (TGW) of the overexpression lines (Line1, Line2, and Line3) and wild-type Arabidopsis thaliana seeds was weighed using an analytical balance. Figure 5 The comparison of seed morphology is as Figure 5 shown in A of Figure 5 and B of

[0137] . The size of the T3 generation transgenic Arabidopsis thaliana seeds was significantly larger than that of the control lines. The results of the thousand-grain weight measurement are as

[0138] shown in C of

[0139] 1. Using the pCAMBIA1300-TaPSKR-6D-EGFP plasmid as a template, the target fragment was amplified using primer pair DF1 and DF2. The amplification product was approximately 3 Kb, and the amplification product was recovered using agarose gel.

[0140] DF1 (SEQ ID NO.13):

[0141] 5'-TCCTCTAGAGTCGAC CTGCAG ATGCAGATGCAGCCACACCA-3' (The PstI restriction enzyme sites are underlined respectively, and the following sequence is the 137-156th position of the TaPSKR-6D gene.

[0142] DF2 SEQ ID NO.14):

[0143] 5'-AGAGCCCTGGCATGC CTGCAG CTATCTACATTGTGAGCTAA-3' (The PstI restriction enzyme cleavage sites are underlined respectively, and the subsequent sequence is the reverse complement of positions 3273 - 3292 of the TaPSKR-6D gene.

[0144] 2. Use the restriction enzyme PstI to digest the vector p2300-Actin and recover the vector backbone.

[0145] 3. Connect the recovered product in step 1 and the vector backbone in step 2 by homologous recombination.

[0146] 4. Heat shock transform the ligation product in step 3 into Escherichia coli competent cells DH5α, culture at 37°C for 12 - 16 h, select positive clones for sequencing, and name the correctly sequenced recombinant vector p2300-Actin-TaPSKR-6D.

[0147] The structure of the recombinant vector p2300-Actin-TaPSKR-6D is described as follows: A small fragment between the PstI restriction enzyme cleavage sites of the p2300-Actin vector is replaced with the DNA fragment shown at positions 137 - 3292 of the TaPSKR-6D gene in the recombinant plasmid.

[0148] II. Obtaining transgenic rice plants

[0149] 1. Transform the recombinant expression vector p2300-Actin-TaPSKR-6D into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium.

[0150] 2. Use the Agrobacterium-mediated callus induction method to transfer the recombinant Agrobacterium obtained above into the callus induced from rice embryos, and obtain transgenic plants of the T0 generation through callus differentiation, rooting, etc.

[0151] After germinating the T1 generation seeds, plant them in a hydroponic box, with 14 h of light at 28°C and 12 h of darkness, and screen for positive transgenic rice plants by PCR amplification. Propagate, advance generations, and perform genotype detection on the transgenic line of the T1 generation to obtain a T3 generation pure line of TaPSKR-6D gene transgenic rice.

[0152] III. Phenotypic identification of TaPSKR-6D gene transgenic rice

[0153] Seeds of rice variety Zhonghua 11 (wild-type control, WT) and T3 generation TaPSKR-6D transgenic rice lines (Line1 and Line2) were germinated and grown for about three weeks, and then the seedlings were transplanted to the field and naturally grown to the mature stage. Two rows were sown for each line, with 8 plants in each row, and the experiment was repeated three times, and the average value was taken.

[0154] At the mature stage of rice, the 1000-grain weight, grain length, and grain width were counted. The phenotypes of wild-type and transgenic rice seeds are shown in Figure 6 A of. The grain sizes of T3 generation transgenic lines Line1 and Line2 were significantly larger than those of the wild-type control line. As shown in Figure 6 B of, the 1000-grain weight of the transgenic lines was significantly higher than that of the wild-type. In addition, as shown in Figure 5 C, the grain length of the transgenic lines was also significantly larger than that of the wild-type. The experimental results showed that overexpression of TaPSKR-6D could significantly increase the grain size and yield of rice.

[0155] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0156] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A TaPSKR-6D gene is used in cultivating transgenic plants with grain size and thousand-grain weight higher than those of wild type, characterized in that The TaPSKR-6D nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein TaPSKR-6D encoded thereby is shown in SEQ ID NO.

2. The transgenic plant is an Arabidopsis transgenic line or a rice transgenic line.

2. Application of a recombinant plasmid in cultivating transgenic Arabidopsis thaliana, characterized in that, The seed size and 1000-grain weight of the transgenic Arabidopsis thaliana are higher than those of the wild type; The recombinant plasmid is pCAMBIA1300-TaPSKR-6D-EGFP, and the construction process of the recombinant plasmid is as follows: The sequence of the pCAMBIA1300-EGFP vector Kpn Ⅰ and Xba The small fragment at the Ⅰ restriction enzyme site replaces the DNA molecule shown by the nucleotides at positions 137-3289 from the 5' end in the gene sequence of claim 1. TaPSKR- 6D ​ 3. Use of a recombinant vector in cultivating transgenic rice, characterized in that, The seed size and 1000-grain weight of the transgenic rice are higher than those of the wild type; The recombinant vector is p2300-Actin-TaPSKR-6D, and the construction process of the recombinant vector is as follows: the small fragment between the restriction enzyme sites PstI of the p2300-Actin vector is replaced with the DNA fragment shown at positions 137-3292 of the TaPSKR-6D gene as claimed in claim 1.

Images