An early screening kit for rheumatoid arthritis using HERV:MLT2B2 as a marker

Abstract

The present invention relates to an early screening kit for rheumatoid arthritis using HERV:MLT2B2 as a marker, and belongs to the field of biomedical technology. The present invention quantitatively analyzes the expression of HERV:MLT2B2 in peripheral blood mononuclear cells (PBMCs) and finds that the expression of the endogenous retrovirus HERV:MLT2B2 in PBMCs of rheumatoid arthritis patients is significantly upregulated. It is also found that HERV:MLT2B2 expression is closely correlated with disease indicators such as activity of rheumatoid arthritis patients, and the receiver operating characteristic (ROC) curve predicts that HERV:MLT2B2 can diagnose early RA. Therefore, HERV:MLT2B2 has a high diagnostic value for early rheumatoid arthritis patients as a new marker.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an early screening kit for rheumatoid arthritis using HERV:MLT2B2 as a marker. Background Art

[0002] Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by inflammatory infiltration of the synovial membranes. Early symptoms include morning stiffness, swelling, and pain, followed by gradual destruction of articular cartilage, ultimately leading to joint deformity and loss of function. Currently, the diagnosis of RA relies primarily on characteristic clinical manifestations combined with positive autoantibodies and X-ray changes. While typical cases are easy to diagnose, in the early stages of RA, before the diagnostic criteria are fully met, when uniarticular disease occurs and X-ray changes are not yet apparent, definitive diagnosis can be challenging. RA is incurable and has a high disability rate. Early screening and diagnosis of RA are crucial for disease management and treatment. Timely intervention can significantly improve synovitis and reduce joint destruction, slowing disease progression and improving long-term prognosis.

[0003] Currently, RA diagnostic markers are usually detected by ELISA or electrochemiluminescence methods to detect rheumatoid arthritis-related proteins in serum. However, the current diagnostic methods have the following problems: (1) Some early rheumatoid arthritis markers in plasma, such as type I interferon, are still challenging to detect using traditional methods such as ELISA. (2) Free rheumatoid arthritis markers in plasma are easily degraded or denatured due to storage time and detection time, which will affect the test results and make it impossible to achieve early screening and diagnosis of RA. (3) Rheumatoid arthritis markers in plasma (such as rheumatoid factor and erythrocyte sedimentation rate) are not clearly characterized in early RA, so the diagnostic sensitivity and specificity of early RA are low. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a marker that can be used for early screening of rheumatoid arthritis, so as to overcome the problem that existing markers cannot be used for early screening and diagnosis of rheumatoid arthritis. The present invention quantitatively analyzes the expression results of HERV:MLT2B2 in peripheral blood mononuclear cells and finds that the expression of HERV:MLT2B2 is closely related to the clinical detection indicators of RA, and the expression of HERV:MLT2B2 increases significantly in early RA patients, and responds very quickly to IFN-α, so HERV:MLT2B2 can be used as a marker for early RA. In clinical diagnosis, the kit of the present invention is used for suspected RA patients to achieve early screening of RA, so as to promptly diagnose and carry out treatment, which helps to control disease progression and improve prognosis.

[0005] The first object of the present invention is to provide an application of an endogenous retrovirus HERV:MLT2B2 as an early screening marker for rheumatoid arthritis.

[0006] The second object of the present invention is to provide an endogenous retrovirus HERV: MLT2B2 as a marker in an early screening kit for rheumatoid arthritis.

[0007] The third object of the present invention is to provide a kit for early screening of rheumatoid arthritis, wherein HERV:MLT2B2 is used as a marker in the kit, and the nucleotide sequence of the marker is shown in SEQ ID NO.3.

[0008] Furthermore, the sample detected by the kit is peripheral blood mononuclear cells (PBMCs).

[0009] Furthermore, the kit contains a reagent for detecting the expression level of HERV:MLT2B2.

[0010] Furthermore, the rheumatoid arthritis early screening kit includes primers for amplifying HERV:MLT2B2.

[0011] Furthermore, the primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2.

[0012] SEQ ID NO.1:ATTTGTTATGGGAGGTGGCT

[0013] SEQ ID NO.2: ATCCATCTTCTTCTGCTCTC

[0014] Furthermore, the rheumatoid arthritis early screening kit also includes a component for PCR amplification.

[0015] The fourth object of the present invention is to provide a primer for amplifying HERV:MLT2B2 for use in a kit for early screening of rheumatoid arthritis.

[0016] Furthermore, the primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2.

[0017] Beneficial effects of the present invention:

[0018] The present invention finds that HERV: MLT2B2 can be used as a marker for early rheumatoid arthritis. Through this marker, suspected RA patients who have not yet reached the diagnostic criteria for RA can be judged in advance and timely intervention treatment can be carried out. Timely intervention helps to significantly improve the patient's synovitis and reduce joint damage, which can slow the progression of the disease and improve the patient's long-term prognosis. Therefore, HERV: MLT2B2 has a high diagnostic value for patients with early rheumatoid arthritis as a new marker. In clinical diagnosis, the kit of the present invention is used for suspected RA patients to achieve early screening of RA, and timely diagnosis and treatment can be carried out, which helps to control disease progression and improve prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the volcano plot of differentially expressed HERVs between early RA and OA groups;

[0020] Figure 2 is the volcano plot of differentially expressed HERVs between the early RA and HC groups;

[0021] Figure 3 is the heat map of Spearman correlation between differentially expressed HERVs and RA clinical indicators;

[0022] Figure 4 is a boxplot of the correlation between HERV:MLT2B2 and C-reactive protein (CRP) drawn by tertiles;

[0023] Figure 5 It is a box plot of HERV:MLT2B2 and inflammatory factor comprehensive score (Inflammatoryscore) drawn by tertiles;

[0024] Figure 6 is a boxplot of HERV:MLT2B2 and erythrocyte sedimentation rate (ESR) plotted by tertiles;

[0025] Figure 7 is a boxplot of HERV:MLT2B2 and rheumatoid arthritis disease activity score (DAS28) plotted by tertiles;

[0026] Figure 8 is a box plot of HERV:MLT2B2 and the number of swollen joints (SWALLEN) drawn by tertiles;

[0027] Figure 9 is a bar graph of the expression of HERV:MLT2B2 and its host gene Ifi44l in PBMCs stimulated with IFN-α;

[0028] Figure 10It is a bar graph showing the expression of HERV:MLT2B2 and its host gene Ifi44l in PBMCs stimulated with poly I:C;

[0029] Figure 11 is a bar graph showing the expression of HERV:MLT2B2 and its host gene Ifi44l in early RA patients and OA patients;

[0030] Figure 12 is a bar graph of the expression of HERV:MLT2B2 and its host gene Ifi44l in 293T cells stimulated by IFN-α;

[0031] Figure 13 This is the ROC curve of HERV:MLT2B2 for the prediction of early RA. DETAILED DESCRIPTION

[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0033] Example 1: Quantification of HERV:MLT2B2 by Fluorescence Quantitative PCR

[0034] (1) Sample collection

[0035] Two groups of samples were obtained: ① A screening group of 18 samples, including 6 patients with early rheumatoid arthritis (RA), 6 patients with osteoarthritis (OA), and 6 healthy controls (HC). ② An independent sample of 20 samples, including 10 patients with early rheumatoid arthritis and 10 controls with OA. Blood samples were collected in citrate anticoagulant tubes and PBMCs were isolated by density gradient centrifugation (Ficoll). The upper pale yellow plasma layer was aspirated and stored at -80°C.

[0036] (2) Establishment of HERV expression profile in PBMCs

[0037] RNA was extracted using an RNA extraction kit (column method). Absorbance at 260 nm, 280 nm, and 230 nm was measured using a Nanodrop spectrophotometer to calculate and assess RNA purity. Agarose gel electrophoresis was used to verify RNA purity and integrity. Transcriptome sequencing technology is mature and commercially available, using the Illumina PE1500 next-generation sequencing platform. FastQC software was used to quality control the fastq files, which were filtered using Trim Galore software. The trimmed fastq files were aligned to hg38 using Bowtie2 software to generate SAM files. SAM files were converted to BAM files and sorted using SAMtools. FeatureCounts was used to quantify the sorted BAM files, and counts were generated for differential analysis using DESeq2. Differential expression of HERVs was identified by comparing the results of patients with early RA with controls.

[0038] (3) Real-time quantitative PCR (RT-qPCR)

[0039] The sample mRNA was reverse transcribed into cDNA. The reaction system contained total RNA, Oligo dT, random primers, reverse transcriptase, and RNase inhibitor. PCR amplification was performed using forward and reverse primers. The fluorescent dye SYBE Green binds to double-stranded DNA. As the number of cycles increases, the amplified target gene increases exponentially, and the fluorescence signal also increases. Fluorescence was detected and analyzed using a fluorescence quantitative PCR instrument. The housekeeping gene Gapdh was used as an internal reference, and 2 -△△Ct HERV expression was quantitatively analyzed by the method.

[0040] The sequences in this embodiment are shown in Table 1:

[0041] Table 1 Sequence Listing

[0042]

[0043] (4) Statistical methods

[0044] Statistics were performed using SPSS 18.0 (SPSS Inc., Chicago, USA) software.

[0045] (5) Diagnostic criteria for early RA

[0046] The diagnosis of RA currently uses the 2010 ACR / EULAR rheumatoid arthritis classification criteria, as shown in the following table. Patients with a score of 6 or more can be diagnosed with RA:

[0047]

[0048] There is currently no unified standard for the diagnosis of early RA. According to the RA classification criteria developed by the American College of Rheumatology and the European League Against Rheumatism (ACR / EULAR) in 2010 and the 2015 ACR diagnosis and treatment guidelines and clinical practice, early RA is defined as patients who do not meet the diagnostic criteria for RA.

[0049] Example 2: HERV:MLT2B2 expression profile analysis in PBMCs

[0050] like Figure 2 As shown, PBMCs were collected from patients with early-stage rheumatoid arthritis (RA), osteoarthritis (OA), and healthy controls (HC) and analyzed for HERV (MLT2B2) expression profiles using RNA-Seq. Peripheral blood mononuclear cells (PBMCs) contain immune cells such as T cells, B cells, monocytes, dendritic cells, and neutrophils, providing crucial information about immune responses and inflammatory processes. They are readily accessible and are a commonly used sample for RA immunology research. Using a case-control design, PBMCs were isolated from six patients with early-stage rheumatoid arthritis (RA), six patients with osteoarthritis (OA), and six healthy controls (HC). PBMCs were then analyzed using the Illumina PE1500 next-generation sequencing platform for RNA-Seq to construct HERV expression profiles. In PBMCs from patients with early-stage RA, 2,563 and 2,882 HERVs were abnormally expressed compared to those in the OA and HC groups, respectively. The proportion of HERVs with elevated expression was 69% and 72%, respectively, indicating global activation of HERVs in PBMCs from patients with early-stage RA. Among them, the expression of HERV:MLT2B2 was significantly increased in early RA patients compared with OA and HC ( Figure 1 and Figure 2 ).

[0051] Example 3: Correlation analysis between HERV:MLT2B2 and clinical detection indicators

[0052] Correlation analysis between differentially expressed HERVs and clinical indicators revealed that activated HERVs were significantly correlated with disease progression; Spearman correlation results showed that differentially expressed HERVs were positively correlated with C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), rheumatoid arthritis disease activity score (DAS28), rheumatoid factor (RF) and inflammatory score (Inflammatoryscore). Figure 3 Among them, HERV: MLT2B2 was strongly associated with CRP, ESR, DAS28, Inflammatory score and SWALLEN score ( Figure 4-Figure 8These results indicate that HERV:MLT2B2, as a dormant viral element in the gene, can be activated during the course of RA and is closely related to the progression of early RA.

[0053] Example 4: Validation of HERV:MLT2B2 (Ifi44L) in independent samples

[0054] Studies have shown that interferon plays an important role in the pathophysiology of early RA. Interferon is activated in early RA patients, and interferon can activate the expression of the host gene Ifi44L (HERV:MLT2B2 is a specific sequence located in the intron region of Ifi44L). However, it is difficult to detect interferon with current technical means. Therefore, ifi44L expression is activated by simulating interferon activation, it is proved that HERV:MLT2B2 is expressed in early RA. First, PBMCs of healthy volunteers were isolated and stimulated with IFN-α and dsRNA mimic poly I:C to simulate interferon activation (poly I:C is an interferon inducer). Then, the expression of HERV:MLT2B2 (Ifi44L) was detected by RT-qPCR. It was found that IFN-α and poly I:C could significantly activate the expression of HERV:MLT2B2, and IFN-α and poly I:C could significantly enhance the expression of the HERV:MLT2B2 host gene Ifi44l ( Figure 9-10 ). Next, the expression of HERV:MLT2B2 was detected in independent samples (10 early RA cases and 10 OA cases) by RT-qPCR. The results showed that the expression of HERV:MLT2B2 was increased in early RA patients ( Figure 11 ). 293T cells are often used to detect the expression of retroviruses in in vitro experiments, so 1000IU / ul of IFN-α was used to stimulate 293T cells to detect the transcriptional changes of HERV:MLT2B2 and the host gene Ifi44L. The results showed that HERV:MLT2B2 responded very quickly to IFN-α and was rapidly activated in 0.5h, while the expression of the host gene Ifi44L began to increase at 1h. Ifi44L has been considered to be activated in rheumatoid arthritis in the past, and this example found through experiments that ERV:MLT2B2 near Ifi44L is activated faster and earlier, so it can be used as a driving factor for early rheumatoid arthritis and become a marker for early rheumatoid arthritis ( Figure 12 ).

[0055] Example 5: ROC curve validation of HERV:MLT2B2 for the diagnosis of early RA

[0056] PBMCs were extracted from 10 patients with early RA and 10 patients with OA. The expression of HERV:MLT2B2 in PBMCs was detected by RT-PCR. The ROC curve (Receiver Operating Characteristic Curve) was drawn according to the expression value of HERV:MLT2B2. The AUC (Area Under the Curve) value reached 0.79 (95% CI: 0.59-0.99), indicating that the expression value of HERV:MLT2B2 in PBMCs can effectively diagnose early RA patients ( Figure 13 ).

[0057] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting endogenous retrovirus HERV: MLT2B2 in the preparation of an early screening kit for rheumatoid arthritis, characterized in that: The nucleotide sequence of the endogenous retrovirus HERV:MLT2B2 is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The sample detected by the rheumatoid arthritis early screening kit is peripheral blood mononuclear cells.

3. The use according to claim 1, characterized in that: The rheumatoid arthritis early screening kit contains a reagent for detecting the expression level of HERV:MLT2B2.

4. The use according to claim 1, characterized in that: The rheumatoid arthritis early screening kit includes primers for amplifying HERV:MLT2B2.

5. The use according to claim 4, characterized in that: The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

6. The use according to claim 4, characterized in that: The rheumatoid arthritis early screening kit also includes a component for PCR amplification.

7. Application of primers for amplifying HERV:MLT2B2 in the preparation of an early screening kit for rheumatoid arthritis.

8. The use according to claim 7, characterized in that: The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

Images