Molecular marker mdsr0359 closely linked to melon clustering trait and application thereof

By developing the molecular marker Mdsr0359, which is closely linked to the clustering trait in melon, and using the InDel marker for genotyping at the seedling stage, the problem of low breeding efficiency in melon was solved, and accurate seedling screening and improved breeding efficiency were achieved.

CN118460758BActive Publication Date: 2026-03-17黑龙江省农业科学院大庆分院
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-24
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Candidate genes and related markers for the clustering trait in melons have not been fully developed, resulting in low breeding efficiency and difficulty in screening at the seedling stage, which affects the industrialization and large-scale development of melons.

Method used

We developed the molecular marker Mdsr0359, which is closely linked to the clustering trait in melons. Using a hybrid combination of non-clustering melon variety S8 and clustering melon variety 7223H, we designed the InDel marker through BSA sequencing and F2:3 family analysis to achieve seedling genotyping.

Benefits of technology

By using PCR amplification and polyacrylamide gel electrophoresis, the clustering trait of melon seedlings can be accurately screened, shortening the breeding cycle, improving breeding efficiency, and reducing production costs and labor input.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118460758B_ABST
    Figure CN118460758B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker Mdsr0359 closely linked to a melon cluster character and an application thereof, and belongs to the field of plant molecular genetic breeding research. The molecular marker is used for detecting the cluster character in a plurality of melon natural populations, DNA of a material to be selected is used as a template, a primer pair of the molecular marker Mdsr0359 is used for PCR amplification, and the amplification product is subjected to polyacrylamide gel electrophoresis and combined with field trait analysis, so that the accuracy of the molecular marker in seedling stage identification is 100%. The molecular marker has very important value in melon production practice and breeding. The operation method is simple, stable, fast and accurate, and provides a new method for auxiliary selection of melon molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics and breeding research, and relates to a molecular marker Mdsr0359 that is closely linked to the clustering trait of melon and its application, and is used for molecular marker-assisted breeding of melon clustering trait in the seedling stage. Background Technology

[0002] Muskmelon (Cucumis melo L.) is an annual vine-like herbaceous plant belonging to the genus Cucumis in the Cucurbitaceae family. It is an important economic crop of the Cucurbitaceae family, widely cultivated, and exhibits strong hybrid vigor, bringing significant economic value to agricultural production. Plant architecture is an important agronomic trait; the clustering of flowers is closely related to environmental adaptability and yield, and is of great significance to agricultural production. Muskmelon clustering is the phenomenon where multiple male (female) or fruiting flowers are concentrated at a single node, with each node continuously open. Clustering has a significant impact on branching and yield. An ideal plant architecture during the muskmelon's growth process is crucial for increasing yield. Studies have shown that plant clustering has a significant impact on different crops; for example, in rapeseed and tomatoes, strong clustering increases yield, thereby improving economic benefits. However, in melons, clustering can lead to excessive branching and fruit production. Excessive branching and fruit production consume too much nutrition, reducing yield. Therefore, in greenhouse cultivation, melon producers often thin out flowers and fruits to increase yield and maintain quality. Furthermore, dense clustering results in vigorous branching or excessive fruit production after differentiation, not only increasing the density of the growing environment and thus increasing the occurrence of pests, diseases, and inferior fruit, but also depleting nutrients and hindering fruit set. Therefore, producers prefer varieties with less or no clustering. Clustering in melons can negatively impact fruit quality due to excessive vegetative growth, and the resulting decline in fruit quality after clustering reduces yield and economic value, affecting farmers' income. Clustering has become a bottleneck restricting the industrialization and large-scale development of the melon industry. Therefore, controlling the development of new melon varieties with less or no clustering and exploring simplified cultivation models will undoubtedly strongly promote the industrialization and large-scale development of the melon industry. Analyzing the genetic basis and regulatory mechanism of melon cluster formation and development is the foundation and prerequisite for breeding non-clustered varieties, and has important practical significance for accelerating the improvement of melon plant type and molecular breeding process.

[0003] Genetic studies on the clustering trait in vegetable crops have been reported, involving observation of clustering traits, genetic patterns, and QTL mapping. These studies mainly focus on several fruit and vegetable crops such as tomato, Arabidopsis thaliana, and rapeseed, using gene editing technology to obtain new germplasm with different clustering types. Currently, there are also several reports on the genetic patterns of clustering traits in melons, but these have not yet involved the development of candidate genes and related markers. Summary of the Invention

[0004] The purpose of this invention is to address the problem that candidate genes and related markers for the clustering trait in melons have not been fully developed. This invention provides a molecular marker, Mdsr0359, closely linked to the clustering trait in melons, and its application. The invention utilizes the non-clustering melon variety S8 as the female parent and the clustering melon variety 7223H as the male parent, to create a hybrid combination to obtain the F1 generation. The F1 generation is then continuously self-crossed to obtain the F2 and F3 generations. 2:3 The pedigree was determined, and this population was used as the population material for locating candidate regions for the clustering trait in melons. Based on BSA (Bulk Segregating Analysis) sequencing results, candidate regions were obtained and used to locate F... 2:3 The pedigree was further refined to narrow down the range, and molecular markers linked to the clustering trait of melons were selected for higher efficiency.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The molecular marker Mdsr0359, which is closely linked to the clustering trait of melon, has the following primer sequence:

[0007] Mdsr0359F:CTTCCCCCAAACAAGGGGTT,

[0008] Mdsr0359R:GTCCAACGCACTCCCAAAAC.

[0009] An application of the molecular marker Mdsr0359, which is closely linked to the above-mentioned clustering trait in melon, wherein the molecular marker Mdsr0359 is used for molecular marker-assisted breeding of melon seedlings.

[0010] Furthermore, the application involves: detecting the clustering trait of the molecular marker in several natural melon populations; using the DNA of the candidate material as a template, performing PCR amplification on the molecular marker Mdsr0359 using primers; and performing polyacrylamide gel electrophoresis on the amplification products in conjunction with field trait analysis.

[0011] Furthermore, the molecular labeling method is as follows:

[0012] (1) Using DNA of the material to be identified as a template, PCR amplification was performed on it with primers for the molecular marker Mdsr0359; PCR product detection: the reaction product was electrophoresed on a 7% non-denaturing polyacrylamide gel and stained with silver nitrate.

[0013] (2) Identification of marker primers: those that can amplify a specific band of 250bp are non-clustered varieties, those that can amplify heterozygous bands of 244bp and 250bp are heterozygous, and those that can amplify a band of 244bp are clustered varieties.

[0014] Further, in step (1), the PCR amplification system is 10 μL, including 1 μL of upstream primer, 1 μL of downstream primer, 3 μL of TaqMaster Mix enzyme, 1 μL of DNA template, and 4 μL of ddH2O.

[0015] Further, in step (1), the PCR amplification program is as follows: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 45 s, 35 cycles from step 2 to step 4, extension at 72℃ for 10 min, and storage at 4℃.

[0016] The advantages of this invention over the prior art are as follows:

[0017] 1. InDel (insertion-deletion) markers refer to the insertion or deletion of a certain number of nucleotides in the genome of one parent relative to the other in the whole genome sequence. Based on these insertion and deletion sites in the genome, PCR primers are designed to amplify these sites, thus becoming InDel markers. This invention, based on BSA sequencing technology and comparing melon genome data, designs and develops InDel markers linked to the clustering trait in melons. Through InDel molecular marker-assisted breeding, plants containing clustering sites can be screened at the melon seedling stage, reducing breeding time, improving breeding efficiency, and overcoming the limitation that in actual production, melon clustering can only be distinguished during the vegetative growth stage after transplanting, thereby reducing financial and labor inputs in melon production.

[0018] 2. By using the specific primer pairs provided in this invention, the genomic DNA of the melon to be tested was detected by PCR. The InDel molecular marker Mdsr0359 was amplified. The amplified product containing the non-clustering gene of melon was 250bp, while the amplified product containing the normal clustering gene of melon was 244bp. This molecular marker can be used to accurately screen melons for clustering traits and can be used for seedling screening of melon plants, which greatly improves the breeding efficiency of melons.

[0019] 3. Currently, there are no reports on candidate genes for the clustering trait in melons, both domestically and internationally. The molecular marker Mdsr0359 of this invention was designed based on candidate genes for the clustering trait in melons.

[0020] 4. The molecular markers of this invention are of great significance in melon production practices and breeding.

[0021] 5. The operation method of this invention is convenient and highly accurate, providing a new method for molecular breeding of melons. Attached Figure Description

[0022] Figure 1 Candidate region map of genes controlling clustering traits in melons;

[0023] Figure 2 The candidate gene MELO3C023857.2.1 for the clustering trait in melons is shown in the quantitative fluorescence analysis diagram.

[0024] Figure 3 The candidate gene MELO3C025032.2.1 for the clustering trait in melons is shown in the quantitative fluorescence analysis diagram.

[0025] Figure 4 The candidate gene MELO3C025034.2.1 for the clustering trait in melons is shown in the quantitative fluorescence analysis diagram.

[0026] Figure 5 The candidate gene MELO3C025035.2.1 for the clustering trait in melons is shown in the quantitative fluorescence analysis diagram.

[0027] Figure 6 The fluorescence quantitative analysis diagram of MELO3C030021.2.1, a candidate gene for the clustering trait in melons;

[0028] Figure 7 The fluorescence quantitative analysis diagram of MELO3C030231.2.1, a candidate gene for the clustering trait in melons;

[0029] Figure 8 Electrophoresis results for the Mdsr0359 melon marker in 18 natural populations are shown. In the figures, M represents the marker; band 1 is the maternal parent S8; band 2 is the paternal parent 7223H; band 3 is F1; bands 4-9 are varieties with the same bands as S8 (non-clustered); bands 10-15 are varieties with the same bands as 7223H (clustered); and bands 16-21 are intermediate-type varieties. Non-clustered varieties amplified a 250bp specific band, intermediate-type varieties amplified 244bp and 250bp heterozygous bands, and normally clustered varieties amplified a 244bp specific band. Detailed Implementation

[0030] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention that do not depart from the spirit and scope of the technical solution of the present invention should be covered within the protection scope of the present invention.

[0031] This invention investigates the genetic mechanism of clustering traits in melons and the mapping of candidate genes for this trait. Using the non-clustering melon variety S8 as the female parent and the normally clustering melon variety 7223H as the male parent, hybridization combinations were created to obtain the F1 generation. The F2 segregating population and the F2 generation were then constructed. 2:3 Family pedigrees were constructed using two parents (5 plants from each parent) and two F2 segregating populations of 20 non-clustered and 20 clustered plants. BSA-matched pedigrees were then used for preliminary localization via high-throughput sequencing, combined with F2... 2:3Further fine-tuning of molecular markers designed for candidate regions controlling the clustering trait in melons was carried out using family pedigrees. Primers were designed based on genes within the candidate regions to analyze gene expression levels. After screening for differentially expressed genes among parents, InDel and SSR molecular markers were designed to link the clustering trait in melons to the gene clustering trait, thus achieving higher selection efficiency.

[0032] Specific Implementation Method 1: This implementation method describes a molecular marker, Mdsr0359, closely linked to the clustering trait of melons, with the following primer sequence:

[0033] Mdsr0359F:CTTCCCCCAAACAAGGGGTT,

[0034] Mdsr0359R:GTCCAACGCACTCCCAAAAC.

[0035] The method for obtaining the molecular marker Mdsr0359 is as follows:

[0036] 1. Construction of a melon genetic population

[0037] Using the non-clustered melon variety S8 as the female parent and the normally clustered melon variety 7223H as the male parent, a hybrid combination "S8×7223H" was created to obtain the F1 population. The F1 population was then self-crossed to obtain the F2 segregating population. The F2 segregating population was then self-crossed to obtain the F1 generation. 2:3 Family lineage. Parental hybridization yields F1 plants with identical genotypes and phenotypes. Randomly selected F1 plants can be self-crossed to obtain F2 plants. F2 plants are then randomly selected for self-crossing to obtain the next F1 generation. 2:3 family lineage;

[0038] In 2020, S8 (20 plants), 7223H (20 plants), F1 single plants (20 plants), and F2 segregating population (200 plants) were planted at the Aerospace Breeding Base of Bayi Agricultural Reclamation University in Heilongjiang Province; in 2021, F2 was planted at the Hainan Breeding Base. 2:3 The melon strains (130 families in total, 10 plants per family) were all grown in greenhouses using conventional water and fertilizer management, single-plant pollination, and no pruning. Field surveys of clustered growth characteristics were conducted after the plants completed their vegetative growth phase.

[0039] 2. Genomic DNA extraction and gene pool construction

[0040] 130 F were extracted using the CTAB method. 2:3 Genomic DNA of a family lineage.

[0041] 3. Extreme pooled sequencing localization and molecular marker development

[0042] By performing high-throughput sequencing on the normal clustered melon variety 7223H and the non-clustered melon variety S8, the genomic sequence information of the two parents was obtained. The differential loci between the two parents were analyzed and compared. The candidate gene region controlling melon clustering was obtained by BSA sequencing. SSR and InDel molecular markers were developed in this region. A total of 17 pairs of molecular markers were designed and developed. PCR amplification and polymorphism screening were performed between the normal clustered melon gene pool and the non-clustered melon gene pool. A total of 2 pairs of primers were screened.

[0043] 4. Real-time quantitative PCR analysis

[0044] High-throughput sequencing was performed on the normal clustered melon variety 7223H and the non-clustered melon variety S8. Based on the sequencing information, the sequences of six genes were obtained from the Spanish Cucurbitaceae genome database MELONOMICS according to their accession numbers. Specific primers were designed using Primer Premier 5.0 software. Using total RNA from the growth point of the tenth segment of the melon plant corresponding to the phenotype as a template, PrimeScript was used to sequence the genome. TM RTMaster Mix (Perfect Real Time) was used to reverse transcribe and synthesize the first strand of cDNA. Using the obtained first strand of cDNA as a template, and six candidate gene sequences as primers for corresponding gene detection, [the process was repeated]. Quantitative PCR was performed using the PremixExTaq™ Quantitative PCR kit. The reaction mixture consisted of: 1 μL of reverse transcription product, 12.5 μL of SYBR'PremixExTaq (2x), 1 μL of forward primer (10 μmol / L), 1 μL of reverse primer (10 μmol / L), and sterile ultrapure water to a final volume of 25 μL. Analysis was performed using an Opticon 3 Real-time PCR System (Bio-Rad). The PCR amplification conditions were: 95°C pre-denaturation for 30 seconds, 95°C denaturation for 5 seconds, and 60°C annealing and extension for 30 seconds, for a total of 40 cycles. Data were analyzed using 2... -ΔΔCT The method is used for statistical analysis.

[0045] 5. InDel molecular marker screening

[0046] Molecular markers were developed based on candidate regions of genes controlling the clustering trait in melons, and Mdsr0359 was found to be closely linked to the clustering trait in melons.

[0047] Specific Implementation Method Two: This implementation method provides a method for using the molecular marker Mdsr0359 linked to the clustering trait in melons. The specific steps are as follows:

[0048] (1) DNA was extracted from the sample to be tested and PCR amplification was performed using the molecular marker Mdsr0359. The 10 μL PCR reaction system consisted of: 1 μL of 50-100 ng / μL DNA, 1 μL each of the forward and reverse primers of Mdsr0359, 3 μL of Taq enzyme Mix, and 4 μL of ddH2O. The PCR amplification conditions were: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 45 s, 35 cycles from step 2 to step 4, extension at 72℃ for 10 min, and storage at 4℃.

[0049] (2) After PCR amplification, the PCR product was used for MfeI restriction enzyme digestion. The digestion method was as follows: 10 μL of PCR product, 0.5 μL of MfeI restriction endonuclease (concentration 1 U / μL), 2 μL of 10×Fast Digest buffer, and 7.5 μL of deionized water. The digestion reaction was incubated in a 37℃ water bath for 20 min, and 4 μL of 6×loading buffer was added. Electrophoresis detected fragments of 250 bp, indicating non-clustered melon material, while fragments of 244 bp indicated normal clustered melon material. Figure 2 As shown, 1 represents the maternal parent, which produces non-clustered melons; 2 represents the paternal parent, which produces clustered melons; band 3 indicates the intermediate type of F1; bands 4-9 represent varieties with the same bands as S8, which are non-clustered; bands 10-15 represent varieties with the same bands as 7223H, which produce clustered melons; and bands 16-21 represent heterozygous varieties. The accuracy rate for identifying the clustering trait in melons is 100%. Therefore, amplification of tightly linked markers can accurately distinguish different genotypes of melon clustering trait loci, achieving the purpose of assisted breeding.

Claims

1. Use of a molecular marker Mdsr0359 closely linked to a melon fasciation trait, characterized in that: The molecular marker Mdsr0359 is used for identifying the flowering clustering trait of melon at seedling stage; the primer sequence of the molecular marker is: Mdsr0359F: CTTCCCCCAAACAAGGGGTT, Mdsr0359R: GTCCAACGCACTCCCAAAAC.

2. Use of the molecular marker Mdsr0359 in close linkage with the melon fasciation trait according to claim 1, characterized in that: The application is that the molecular marker is used for detecting the clustering trait in several melon natural populations, using the DNA of the selected material as a template, the primer pair of the molecular marker Mdsr0359 is used for PCR amplification, the amplification product is subjected to polyacrylamide gel electrophoresis and combined with field trait analysis.

3. Use of the molecular marker Mdsr0359 in close linkage with the melon fasciation trait according to claim 2, characterized in that: The application is: (1) using the DNA of the material to be identified as a template, the primer pair of the molecular marker Mdsr0359 is used for PCR amplification; PCR product detection: the reaction product is subjected to electrophoresis on a 7% non-denaturing polyacrylamide gel and is subjected to silver nitrate staining; (2) marker primer identification: the non-clustering variety is that a 250bp specific band can be amplified, the hybrid type is that 244bp and 250bp hybrid bands can be amplified, and the clustering type variety is that a 244bp band can be amplified.

4. Use of the molecular marker Mdsr0359 in close linkage with the melon fasciation trait according to claim 3, characterized in that: In step (1), the PCR amplification system is 10uL, including 1uL of upstream primer, 1uL of downstream primer, 3uL of Taq Master Mix enzyme, 1uL of DNA template and 4uL of ddH2O.

5. Use of the molecular marker Mdsr0359 in close linkage with the melon fasciation trait according to claim 3, characterized in that: In step (1), the PCR amplification program is that pre-denaturation is performed at 95℃ for 5min, denaturation is performed at 95℃ for 30s, annealing is performed at 55℃ for 30s, extension is performed at 72℃ for 45s, the 2nd step to the 4th step are repeated for 35 cycles, extension is performed at 72℃ for 10min, and preservation is performed at 4℃.

Citation Information

Patent Citations

  • Indel molecular marker closely linked with capsicum annuum clustered inflorescence genes, primers and application

    CN110592255A

  • Molecular marker Site1119 closely linked with major QTLfb3.2 of branch character of muskmelon and application of molecular marker Site1119

    CN117568512A