Application of miR531 gene in dongnong winter wheat 1 in regulating plant growth and cold tolerance and cultivating cold-resistant plants
By introducing the miR531 gene of Dongnong Winter Wheat No. 1 into wheat and Arabidopsis thaliana, and using recombinant vectors and Agrobacterium-mediated transformation, the problem of long cycle in improving wheat cold resistance in traditional breeding methods was solved. This resulted in an increase in the number of rosette leaves and improved growth under low temperature stress, providing genetic resources to support improved breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-26
- Publication Date
- 2026-03-20
AI Technical Summary
In existing technologies, traditional breeding methods for improving wheat cold resistance are time-consuming and resource-limited. It is unclear whether there are miRNAs in Dongnong Winter Wheat No. 1 that can improve cold resistance and growth. How to apply these genes for breeding is a difficult problem.
By introducing the miR531 gene of Dongnong Winter Wheat No. 1 into wheat and Arabidopsis thaliana, gene transformation was carried out using the recombinant vector TOPO and the pCambia230035Su plasmid. Homozygous transgenic plants were screened and verified. Gene transfer was performed using Agrobacterium-mediated transformation, and cold-resistant plants were screened.
The increase in the number of rosette leaves and branches under normal temperatures significantly improves the plant's tolerance to low-temperature stress, providing effective gene resources for the genetic improvement of plants such as wheat and shortening the breeding cycle.
Smart Images

Figure CN118480547B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to application of Dongnongdongmai No. 1 miR531 gene in regulation of plant growth and cold resistance and cultivation of cold-resistant plants and belongs to the technical field of plant physiology and plant genetic engineering. BACKGROUND
[0002] The miRNA is a kind of non-coding RNA with a length of 21-25 nt, and the scientific community recognizes that the function of the miRNA is to negatively regulate gene expression. The biosynthesis and action mechanism of the miRNA in plants mainly includes four steps: (1) transcription of an MIR gene into a main transcript (pri-miRNAs); (2) cutting of the pri-miRNA in a cell nucleus to form a hairpin stem-loop structure pre-miRNA; (3) further cutting of the pre-miRNA to release a miRNA duplex (a guide chain (a mature miRNA) and a passenger chain (a miRNA * )); and (4) loading of the miRNA duplex into an ARGONAUTE (AGO) protein to form an induced miRNA silencing complex (miRISC) to drive mRNA cutting and / or inhibition. The main action mechanism of the miRNA is to target and inhibit metabolic function genes and gene expression of stress proteins, thereby playing an important regulation role in plant response to various stress.
[0003] Under the complex and changeable natural environment, plants need to adapt to a variety of adverse environmental factors because they cannot move. Among them, low temperature stress is one of the main abiotic stresses that can seriously affect the growth and development, distribution and yield of plants. Wheat is one of the world's major food crops, and improving the cold resistance of wheat is of great significance to further improve the yield of wheat. Using traditional breeding methods to improve wheat has a long cycle, and there are limited high-quality cold-resistant breeding resources and great uncertainty. Dongnongdongmai No. 1 is the first winter wheat variety developed by Professor TONG Mingyao and Professor ZHENG Jialan, a couple of wheat breeding experts at Northeast Agricultural University, after 14 years of hard work since 1994, ending the history of not planting winter wheat in high-cold areas, and starting to be officially promoted in the northeastern part of Heilongjiang Province (45° north latitude to 47° north latitude) since 2007. Therefore, it is necessary to fully utilize the winter wheat omics information of Dongnongdongmai No. 1 to mine cold-resistant related genes and explore their application in biotechnology breeding. Theoretical research results show that miRNA has the potential to provide rich gene resources for genetic improvement of cold-resistant crops, but is there miRNA in Dongnongdongmai No. 1 that can both improve its cold resistance and improve its growth and development? How do they function? All of these are research hotspots that people are very concerned about. Therefore, how to apply the miRNA gene in Dongnongdongmai No. 1 with potential to improve growth and cold resistance in vivo has become a difficult problem to be solved, so it is necessary to invent the application of Dongnongdongmai No. 1 miR531 gene in regulating plant growth and cold resistance and cultivating cold-resistant plants. SUMMARY
[0004] In order to solve the problem of how to apply the miRNA gene in Dongnongdongmai No. 1 with potential to improve growth and cold resistance in vivo, the application of Dongnongdongmai No. 1 miR531 gene in regulating plant growth and cold resistance and cultivating cold-resistant plants, under normal culture conditions, the miR531 gene can increase the number of rosette leaves and branch number of plants, and promote the growth under low temperature stress.
[0005] The application provides a miR531 gene found from Dongnongdongmai No. 1.
[0006] The application of the miR531 gene provided by the application is for regulating the growth and cold resistance of target plants, and further cultivating cold-resistant plants, wherein the target plants are wheat and Arabidopsis thaliana, and the specific method comprises a method for cultivating cold-resistant plants and a method for cultivating cold-resistant Arabidopsis thaliana.
[0007] The method for cultivating cold-resistant plants comprises the step of introducing the Dongnongdongmai No. 1 miR531 gene into the target plants.
[0008] The introduction in the method is realized by a recombinant vector containing the Dongnongdongmai No. 1 miR531 gene.
[0009] The vector in the embodiment one is TOPO and / or pCambia230035Su plasmid vector.
[0010] The plant in the embodiment one is Arabidopsis thaliana.
[0011] The method for cultivating cold-resistant Arabidopsis thaliana, and the specific steps are shown in the embodiment two.
[0012] S1, using the DNA of wheat as a template, the miR531 gene sequence of Dongnongdongmai No.1 is amplified by PCR method;
[0013] S2, the miR531 gene of Dongnongdongmai No.1 obtained in step S1 is recombined with the TOPO vector, the connection product is transformed into the competent cell of E. coli, and the antibiotic is ampicillin, the positive clone is picked, and after the PCR reaction verification and sequencing identification are correct, the correct bacterial liquid is selected to extract the plasmid TOPO-miR531;
[0014] S3, the plasmid extracted in step S2 is recombined with the vector pCambia230035Su plasmid, the plasmid recombination adopts the In-Fusion cloning method, and then is transformed into the competent cell of E. coli, and the antibiotic is kanamycin, the positive clone is picked, and after the PCR reaction verification and sequencing identification are correct, the correct bacterial liquid is selected to extract the plasmid, and is named as pCambia230035Su-miR531;
[0015] S4, the positive plasmid pCambia230035Su-miR531 identified correctly is transformed into the wild type Arabidopsis thaliana plant by the agrobacterium-mediated method, and the transgenic plant is screened, and the method for screening the transgenic plant is kanamycin screening.
[0016] The application has the beneficial effects that the application of the miR531 gene of Dongnongdongmai No.1 in regulating the growth and cold resistance of plants and cultivating cold-resistant plants comprises connecting the miR531 gene of Dongnongdongmai No.1 to the vector, transforming the vector into Arabidopsis thaliana by the agrobacterium-mediated method, screening and culturing, obtaining the homozygous Arabidopsis thaliana transgenic strain, and the transgenic plant obtained by the transgenic means has the effects of increasing the number of rosette leaves and the number of branches under normal temperature, and the miR531 gene has the effect of significantly improving the low-temperature stress tolerance of plants, and the application provides an effective gene resource for genetic improvement of wheat and other plants in the future, shortens the breeding period of wheat and other crops, and improves the breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1is the miR531 gene base sequence (SEQ ID No. 1) of the application of Dongnong Winter Wheat No. 1 miR531 gene in regulating plant growth and cold tolerance and cultivating cold-resistant plants.
[0018] Figure 2 is the cloning result electrophoretogram of miR531 gene of the application of Dongnong Winter Wheat No. 1 miR531 gene in regulating plant growth and cold tolerance and cultivating cold-resistant plants. In the figure: M: maker (bp).
[0019] Figure 3 is the UmiR531 cloning result electrophoretogram of the application of Dongnong Winter Wheat No. 1 miR531 gene in regulating plant growth and cold tolerance and cultivating cold-resistant plants. In the figure: M: maker (bp).
[0020] Figure 4 is the phenotype situation diagram of transmiR531 gene Arabidopsis under normal conditions in Example Three of the application of Dongnong Winter Wheat No. 1 miR531 gene in regulating plant growth and cold tolerance and cultivating cold-resistant plants, wherein WT is the control and OXmiR531 is the transgenic Arabidopsis.
[0021] Figure 5 is the phenotype situation diagram of transmiR531 gene Arabidopsis after low-temperature treatment in Example Three of the application of Dongnong Winter Wheat No. 1 miR531 gene in regulating plant growth and cold tolerance and cultivating cold-resistant plants, wherein WT is the control and OXmiR531 is the transgenic Arabidopsis. DETAILED DESCRIPTION
[0022] To illustrate the technical content, the purposes and effects of the present application, the following will be described in conjunction with the embodiments and the accompanying drawings. The test methods used in the embodiments are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available unless otherwise specified.
[0023] Example One: As shown in the figure, the cloning and transformation related experimental process of the miR531 gene found from Dongnong Winter Wheat No. 1 of the present application is as follows:
[0024] (1) The plant DNA extraction kit of Kangweishijide Biological Technology Co., Ltd. is used to extract DNA;
[0025] (2) The primer design software Primer 5.0 is used to design the miR531 gene sequence (SEQ ID No. 1) amplification primer, and the nucleotide sequence of the primer is as follows:
[0026] TamiR531F: 5' ACTGCAGCGGAGCATCAAC 3' (SEQ ID No. 2)
[0027] TamiR531R: 5' ATGCGCGTCAACGTCAGTAC 3' (SEQ ID No. 3)
[0028] (3) PCR amplification of the DNA obtained in step (1) using the PCR primers designed in step (2), agarose gel electrophoresis of the PCR product, and recovery of the PCR product using a gel recovery kit;
[0029] (4) connecting the miR531 gene fragment found in Dongnong Winter Wheat No. 1 to TOPO using the pClone007 Blunt Vector Kit from Genesee Biotec Co., Ltd.;
[0030] (5) transferring the ligation product into E. coli DH5a competent cells, coating on LB medium containing ampicillin, picking positive single colonies from the culture dish after single colonies grow, performing colony PCR, selecting single colonies with correct PCR band size for expansion culture, collecting bacterial bodies to extract plasmids, and performing PCR amplification reaction, sending the plasmids with target bands after amplification detection to the company for sequencing, and naming the plasmids with the sequencing results showing that the target gene has been connected as TOPO-miR531;
[0031] (6) adding USER (Uracil-Specific Excision Reagent) enzyme recognition sites to both ends of the two primers of miR531, and the amplification primers are as follows:
[0032] UmiR531F: 5' GGCTTAAUAC TGCAGCGGAG CATCAAC 3' (SEQ ID No. 4)
[0033] UmiR531R: 5' GGTTTAAUAT GCGCGTCAAC GTAGTAC 3' (SEQ ID No. 5)
[0034] (7) PCR amplification using the plasmid vector obtained in step (5) as a template and the PCR primers designed in step (6), agarose gel electrophoresis of the PCR product, and recovery of the PCR product using a gel recovery kit;
[0035] (8) enzyme digestion of the pCambia230035Su plasmid using USER enzyme, agarose gel electrophoresis of the enzyme digestion product, recovery using a gel recovery kit, and connecting the miR531 gene fragment of Dn1 to pCambia230035Su using In-Fusion cloning method;
[0036] (9) The ligation product is transferred into E. coli DH5a competent cells, which are coated on LB medium containing kanamycin. After single colonies grow, a positive single colony is picked from the culture dish for colony PCR. Single colonies with correct PCR band size are selected for expansion culture. After plasmid extraction, PCR amplification is performed. The plasmid with the target band after enzyme digestion is sent for sequencing. The plasmid with the inserted target gene is named pCambia230035Su-miR531.
[0037] The miR531 gene nucleotide sequence discovered from Dongnong Winter Wheat No. 1 in Example 1 is shown in SEQ ID No. 1.
[0038] Example Two: A method for cultivating cold-resistant Arabidopsis thaliana, which comprises the following steps:
[0039] S1. Using the DNA of wheat as a template, the miR531 gene sequence of Dongnong Winter Wheat No. 1 is amplified by PCR method.
[0040] S2. The miR531 gene of Dongnong Winter Wheat No. 1 obtained in step S1 is recombined with a TOPO vector. The ligation product is transformed into E. coli competent cells. After antibiotic screening, the antibiotic is ampicillin. Positive clones are picked, and correct plasmid TOPO-miR531 is selected after PCR reaction verification and sequencing identification.
[0041] S3. After the plasmid extracted in step S2 is recombined with the vector pCambia230035Su plasmid, the plasmid recombination is performed by In-Fusion cloning method. Then, the recombined plasmid is transformed into E. coli competent cells. After antibiotic screening, the antibiotic is kanamycin. Positive clones are picked, and correct plasmid is selected after PCR reaction verification and sequencing identification. The correct plasmid is named pCambia230035Su-miR531.
[0042] S4. The correct positive plasmid pCambia230035Su-miR531 is transformed into Arabidopsis thaliana wild-type plants by Agrobacterium-mediated method. Transgenic plants are screened by kanamycin screening.
[0043] Example Three: Cultivation of Arabidopsis thaliana capable of overexpressing the miR531 gene discovered from Dongnong Winter Wheat No. 1
[0044] (1) The pCambia230035Su-miR531 vector obtained in Example 1 was transferred into Agrobacterium competent cells by heat shock method. The recombinant Agrobacterium was inoculated onto a solid selection medium containing kanamycin and rifampin and cultured at 28°C inverted until single colonies grew. Positive single colonies were randomly selected for PCR detection. The bands amplified by the single colonies were the same size as the positive control, which met the conditions, indicating that the plasmid containing the miR531 gene was successfully transferred into Agrobacterium.
[0045] (2) The Agrobacterium tumefaciens inflorescence method was used to transform the constructed pCambia230035Su-miR531 into wild-type Arabidopsis plants and obtain T0 generation seeds. The seeds were sterilized and spotted onto MS solid culture containing kanamycin to screen for transgenic plants OXmiR531.
[0046] Example 4: Phenotypic and Cold Resistance Identification of Arabidopsis thaliana OXmiR531
[0047] 1. Arabidopsis cultivation: Cultivation conditions include soil cultivation, 24℃ (the optimal temperature for Arabidopsis growth), photoperiod of 16 / 8, and light intensity of 120-150 μmol / m³. -2 s -1 The relative humidity was 60%. The number of rosette leaves and branches of 3-week-old Arabidopsis seedlings were observed.
[0048] 2. Cold stress treatment: Three-week-old Arabidopsis thaliana seedlings were cold-acclimatized in a 4℃ low-temperature incubator for 3 days, then cooled to -15℃ at 2℃ / h for 2 hours, and then returned to 4℃ to recover for 2 hours. After that, they were cultured at 24℃ for 3 days, and the low-temperature phenotype was observed.
[0049] Each of the above experiments was repeated three times.
[0050] 3. Experimental results: such as Figure 4 As shown in the figure, A represents the rosette leaf growth of Arabidopsis thaliana transgenic with the miR531 gene discovered in Dongnong Dongmai 1 under normal culture conditions, and B represents the branching of Arabidopsis thaliana transgenic with the miR531 gene discovered in Dongnong Dongmai 1 under the same treatment and normal culture conditions. It can be seen from the figure that the transgenic plants under normal culture conditions have more rosette leaves, more branches, and faster plant growth than the wild type. The results of the low-temperature treatment experiment are as follows... Figure 5 As shown, transgenic Arabidopsis plants exhibited better growth after cold stress treatment than wild-type plants.
[0051] MiR531 is a kind of miRNA family with high conservation in terrestrial plants. Existing researches show that the expression of miR531 responds in the processes of plant root growth and development, oxidation resistance, drought resistance and disease resistance. However, there is no related report about the application of miR531 gene found in Dongnong Winter Wheat No.1 to Arabidopsis and other plants in the prior art, and the present application scheme achieves unexpected effects.
[0052] In summary, the miR531 gene found in Dongnong Winter Wheat No.1 has the characteristics of non-coding miRNA, and the gene is further transferred to Arabidopsis to obtain a transgenic plant. It is found that the transgenic plant has increased number of rosette leaves and increased branches under normal culture conditions, and its growth condition is better than that of the wild type after low temperature stress, indicating that the gene plays an important regulatory role in wheat growth and development and cold resistance. In the future, the miR531 gene found in Dongnong Winter Wheat No.1 can be used for genetic improvement of wheat and other plants, and can provide effective gene resources for increasing the yield and cold resistance of wheat and other crops.
[0053] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. It should be understood by those skilled in the art that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the present application. The scope of protection of the present application is defined by the appended claims and their equivalents.
[0054] Nucleotide and / or amino acid sequence table
[0055]
Claims
1. The application of the miR531 gene of Dongnong Winter Wheat No. 1 in improving plant growth and cold resistance or cultivating cold-resistant plants, characterized in that, The nucleotide sequence of the miR531 gene of Dongnong Winter Wheat No. 1 is shown in SEQ ID No.
1. By introducing the miR531 gene of Dongnong Winter Wheat No. 1 into the target plant, the plant growth and cold resistance can be improved or cold-resistant plants can be cultivated. The target plant is Arabidopsis thaliana.
2. The application of the Dongnong Winter Wheat No. 1 miR531 gene according to claim 1 in improving plant growth and cold resistance or cultivating cold-resistant plants, characterized in that, The import was achieved using a recombinant vector containing the miR531 gene of Dongnong Winter Wheat No. 1; the recombinant vector was the pCambia230035Su plasmid vector.
3. The application of the Dongnong Winter Wheat No. 1 miR531 gene according to claim 1 in improving plant growth and cold resistance or cultivating cold-resistant plants, characterized in that, The specific steps for cultivating cold-resistant plants are as follows: S1. Using wheat DNA as a template, the sequence of the miR531 gene of Dongnong Winter Wheat No. 1 was amplified by PCR. S2. The miR531 gene of Dongnong Winter Wheat No. 1 obtained in step S1 is recombined with the TOPO vector. The ligation product is transformed into E. coli competent cells. Positive clones are selected by antibiotic screening (ampicillin). After PCR verification and sequencing identification, the correct bacterial solution is selected to extract the plasmid TOPO-miR531. S3. The plasmid extracted in step S2 is recombinated with the vector pCambia230035Su plasmid. The plasmid recombination is carried out using the In-Fusion cloning method. Then, it is transformed into E. coli competent cells. After screening with an antibiotic, namely kanamycin, positive clones are selected. After verification by PCR reaction and sequencing, the correct bacterial culture is selected to extract the plasmid, which is named pCambia230035Su-miR531. S4. The positive plasmid pCambia230035Su-miR531, which was correctly identified, was transformed into wild-type Arabidopsis plants using Agrobacterium-mediated transformation. Transgenic plants were then screened, and the method for screening transgenic plants was kanamycin screening.
Citation Information
Patent Citations
Long-chain non-coding RNA1ncR3017 with potential ceRNA function found from Dongnong winter wheat No.1
CN111019947A