HIV-1 detection method based on digital PCR

Abstract

The present invention discloses a primer pair for amplifying HIV-1 nucleic acid, a probe used in combination with the amplification primer pair to detect HIV-1, an internal reference primer pair and a probe combination, and a highly sensitive and highly specific HIV-1 digital PCR detection method using the same. The primer pair and probe of the present invention can be applied to the amplification and detection of common HIV-1 epidemic subtypes in my country, the detection limit can be as low as single copy / mL, the precision of detecting low viral load samples is high, and it is applicable to the quantitative detection of low HIV-1 viral load samples.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to amplification primer pairs and detection probes for amplifying and detecting HIV-1 nucleic acid, especially based on the dPCR principle, and related detection methods and kits. Background Art

[0002] The nucleic acid test for human immunodeficiency virus type 1 (HIV-1) determines the infection status by detecting whether HIV-1 nucleic acid exists in the human body. This allows HIV-1 infected people to be discovered earlier and antiviral treatment to be given in a timely manner, thereby delaying the progression of HIV-1 disease and reducing the spread of HIV-1. The real-time fluorescence quantitative PCR (qPCR) detection method based on the probe method is the most commonly used method for HIV-1 viral load detection. Currently, the HIV-1 viral load detection reagent based on the qPCR principle on the market has a minimum detection limit of 22 IU / mL, which basically meets the needs of HIV-1 RNA quantitative detection in most cases.

[0003] However, the existing technology for detecting HIV still has the following disadvantages, including but not limited to:

[0004] 1. The existing technology has poor detection effect on low viral load samples, high detection limit, low detection precision, inaccurate test results for low viral load patients, and prone to false negatives;

[0005] 2. The experimental operation and data processing of the prior art methods are complicated. For example, for external standard quantitative detection reagents, additional reagents and consumables are required to calculate the standard curve; for internal standard quantitative detection reagents, additional algorithms are required, and the internal standard in the same well may compete and interfere with the sample to be tested, resulting in experimental failure;

[0006] 3. Existing technologies such as qPCR may be interfered by reaction inhibitors during the amplification process, resulting in decreased quantitative results or even amplification failure;

[0007] 4. Existing commercial reagents in China may miss samples of common subtypes in China. For a long time, the HIV-1 viral load reagents commonly used in my country are imported reagents based on qPCR. The primers and probes used in these reagents are designed for common subtypes abroad, and samples of common subtypes in China may miss detection.

[0008] In addition, HIV-1 is a single-stranded RNA virus with poor fidelity of reverse transcriptase. It has high mutation rate, high error rate and high recombination rate during replication, which leads to high diversity among HIV sequences. Due to the diversity of HIV-1 genes, there is no universal primer probe that can cover all HIV-1 sequences, which limits the sensitivity of detection. Although the conservative region can be increased by setting up degenerate bases, the specificity of the primer probe will be reduced to a certain extent.

[0009] Prior art such as Falak S, Macdonald R, Busby EJ, et al. An assessment of the producibility of reverse transcription digital PCR quantification of HIV-1. Methods. 2022 May; 201: 34-40. doi: 10.1016 / j.ymeth.2021.03.006. Epub 2021 Mar 12. PMID: 33722693 constructed an RT-dPCR method for quantitative detection of the fourth generation WHO HIV-1 RNA standard, and disclosed that the detection limit of the dual dPCR method established was 16 copies / mL, and the coefficient of variation (CV) for precision assessment was between 10-12%. However, the inventors of the present application found in their research that there was nonspecific amplification between the primers in the gag region and the pol region designed in the document, which also shows that the primers and probes in the gag region and the pol region disclosed in the document are in fact not suitable for dual-target detection.

[0010] Therefore, there is a need in the art for a highly sensitive, highly specific and highly precise detection method for HIV-1 that is universal for domestically prevalent subtypes. Summary of the invention

[0011] In order to solve the defects of the existing detection methods, the inventors analyzed the complete sequences of common HIV-1 epidemic subtypes in China, designed as many primers and probes as possible in limited conservative fragments, verified the performance of primers and probes in subsequent screening, compared the primer and probe combinations that met the requirements, and finally selected primers and probe sets with high amplification efficiency and subtype coverage, and constructed a detection method for HIV-1 based on digital PCR (dPCR). Thus, the present invention is obtained.

[0012] Thus, in a first aspect, one or more primer pairs for amplifying HIV-1 nucleic acid are provided, the primer pairs being:

[0013] A Ψ region primer pair, comprising a Ψ region upstream primer having a sequence as shown in SEQ ID NO.1 and a Ψ region downstream primer having a sequence as shown in SEQ ID NO.2;

[0014] The LTR region primer pair comprises an LTR region upstream primer having a sequence as shown in SEQ ID NO.4 and an LTR region downstream primer having a sequence as shown in SEQ ID NO.5;

[0015] A pol region primer pair, comprising a pol region upstream primer having a sequence as shown in SEQ ID NO.7 and a pol region downstream primer having a sequence as shown in SEQ ID NO.8; or

[0016] The gag region primer pair comprises a gag region upstream primer having a sequence as shown in SEQ ID NO.10 and a gag region downstream primer having a sequence as shown in SEQ ID NO.11.

[0017] In a second aspect, one or more probes for detecting HIV-1 nucleic acid are provided, the probes comprising:

[0018] The sequence of the Ψ region probe is shown in SEQ ID NO.3;

[0019] The LTR region probe whose sequence is shown in SEQ ID NO.6;

[0020] The pol region probe whose sequence is shown in SEQ ID NO.9; or

[0021] The sequence of the gag region probe is shown as SEQ ID NO.12.

[0022] In a third aspect, an internal reference primer pair and probe combination for HIV-1 nucleic acid detection is provided, comprising: an internal reference upstream primer whose sequence is shown in SEQ ID NO.13, an internal reference downstream primer whose sequence is shown in SEQ ID NO.14, and an internal reference probe whose sequence is shown in SEQ ID NO.15.

[0023] In a fourth aspect, a reaction system for detecting HIV-1 nucleic acid is provided, the reaction system comprising one or more primer pairs of the first aspect.

[0024] In a fifth aspect, there is provided use of one or more primer pairs according to the first aspect of the present invention in preparing a detection system for detecting HIV-1.

[0025] In a sixth aspect, there is provided a method for detecting HIV-1, the method being used for non-diagnostic purposes or diagnostic purposes, comprising:

[0026] 1) Provide HIV-1 nucleic acid samples;

[0027] 2) Using the HIV-1 nucleic acid sample as a template, amplify HIV-1 nucleic acid using one or more primer pairs of the first aspect.

[0028] In a seventh aspect, a kit for detecting HIV-1 is provided, comprising:

[0029] a) one or more primer pairs of the first aspect; and

[0030] b) instructions for use indicating how to use the kit.

[0031] The beneficial effects of the present invention are:

[0032] The present invention provides four sets of amplification primer pairs and detection probes for HIV-1 nucleic acid amplification and detection, especially for dPCR, thereby establishing HIV-1 nucleic acid amplification and detection methods based on single dPCR and dual dPCR, with high amplification efficiency, low detection limit, high precision, and high sensitivity and specificity. The detection limit of the dual dPCR method based on the primer pair and probe combination of the present invention can even reach single copy / mL, which can be used for high-precision quantitative detection of low HIV-1 viral load samples. And the detection of the present invention targets a wide coverage of subtypes, and the positive detection rate and negative detection rate of samples, strains and negative samples of common domestic epidemic subtypes are 100%.

[0033] The dPCR detection method based on the primer pair and probe combination of the present invention can effectively shorten the time required for HIV-1 virus infection to detection for the diagnosis of HIV-1 infected persons due to its high sensitivity and high precision, and advance the HIV-1 detection window period, thereby avoiding missed detection when the viral load in the infected person in the early stage of HIV-1 replication is lower than the detection limit of the existing method, and plays an important role in the discovery of acute infected persons and more sensitive blood screening. In addition, for the application of HIV-1 infected person treatment effect evaluation, the dPCR detection method based on the primer pair and probe combination of the present invention can quantify the viral level in the body of HIV-1 infected person after antiviral treatment with high precision, more accurately monitor the antiviral treatment effect, and help to timely discover the situation of low viral load resistance after treatment. Therefore, the HIV-1 detection method based on dPCR of the present invention is a beneficial supplement to the currently commonly used HIV-1 detection method, and has its unique advantages in ultra-sensitive diagnosis and accurate monitoring of antiretroviral therapy (ART) effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for use in the specific implementation or the description of the prior art are briefly introduced below.

[0035] Figure 1-Figure 4 Screening validation of primer pairs and probes of the present invention is shown.

[0036] Figure 5-Figure 9 The screening validation of the internal reference primer pair and probe of the present invention is shown.

[0037] Fig.10 The figure shows the optimization of the single-target dPCR amplification reaction of the Ψ region primer pair and probe of the present invention.

[0038] Fig.11 The amplification results of the primers for the LTR region, gag region, and pol region of the present invention are shown in pairs.

[0039] Figure 12-13 The amplification results of the primer pair and probe combination of LTR+gag and LTR+pol of the present invention are shown respectively.

[0040] Figure 14-16 The amplification results of the primer pair and probe combination of LTR+pol of the present invention at different annealing temperatures are shown.

[0041] Fig.17 The figures show the amplification results of the LTR+pol primer pair and probe combination of the present invention using "40 cycles, 30 seconds" and "45 cycles, 30 seconds", respectively.

[0042] Fig.18 The amplification results of the primer pair and probe combination of LTR+pol of the present invention at different primer pair and probe concentrations are shown. DETAILED DESCRIPTION

[0043] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It should be understood that the following description is only used to illustrate the present invention by way of example, and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the attached claims. In addition, those skilled in the art will understand that the technical solution of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.

[0045] Where a numerical range is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value to one-tenth of the unit of the lower limit between the upper and lower limits of the range and any other stated or intervening values ​​in the stated range are included in the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or two limits, ranges excluding either or both of those included limits are also included in the subject matter.

[0046] In the context of the present invention, many embodiments use the expressions "comprising", "including" or "consisting essentially / mainly of..." The expressions "comprising", "including" or "consisting essentially / mainly of..." can usually be understood as open-ended expressions, indicating that in addition to the elements, components, assemblies, method steps, etc. specifically listed after the expression, other elements, components, assemblies, method steps, etc. are also included. In addition, in this article, the expressions "comprising", "including" or "consisting essentially / mainly of..." can also be understood as closed expressions in some cases, indicating that only the elements, components, assemblies, method steps specifically listed after the expression are included, and no other elements, components, assemblies, method steps are included. At this time, the expression is equivalent to the expression "consisting of..."

[0047] In order to better understand the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers and other numerical values ​​used in the specification and claims indicating quantities, percentages or ratios should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. At a minimum, each numerical parameter should at least be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0048] In the context of the present invention, primer pairs and probes are designed for four conserved regions of the HIV-1 genome sequence, namely, the LTR region, the Ψ region, the gag region and the pol region. In the HIV-1 reference sequence (HXB2), the LTR region is located at 1-634bp, the gag region is located at 790-2292bp, the pol region is located at 2085-5096bp, and the packaging signal Ψ region is located between the LTR region and the gag region, and is often combined with the env region (6045-8795bp) for detecting HIV-1 complete provirus.

[0049] Based on these four conserved regions, the inventors of the present invention found 7 conserved segments, the positions of which on the HXB2 reference sequence are: Conserved segment 1: 522-544 bp; Conserved segment 2: 577-603 bp; Conserved segment 3: 622-649 bp; Conserved segment 4: 682-709 bp; Conserved segment 5: 761-807 bp; Conserved segment 6: 890-909 bp; Conserved segment 7: 4896-4980 bp. Based on these 7 conserved segments, the primer pairs and probes of the present invention were designed.

[0050] Thus, in a first aspect, one or more primer pairs for amplifying HIV-1 nucleic acid are provided, the primer pairs being:

[0051] A Ψ region primer pair, comprising a Ψ region upstream primer having a sequence as shown in SEQ ID NO.1 and a Ψ region downstream primer having a sequence as shown in SEQ ID NO.2;

[0052] The LTR region primer pair comprises an LTR region upstream primer having a sequence as shown in SEQ ID NO.4 and an LTR region downstream primer having a sequence as shown in SEQ ID NO.5;

[0053] A pol region primer pair, comprising a pol region upstream primer having a sequence as shown in SEQ ID NO.7 and a pol region downstream primer having a sequence as shown in SEQ ID NO.8; or

[0054] The gag region primer pair comprises a gag region upstream primer having a sequence as shown in SEQ ID NO.10 and a gag region downstream primer having a sequence as shown in SEQ ID NO.11.

[0055] In a preferred embodiment, the plurality of primer pairs is a combination of an LTR region primer pair and a pol region primer pair or a combination of an LTR region primer pair and a gag region primer pair.

[0056] In a second aspect, one or more probes for detecting HIV-1 nucleic acid are provided, comprising:

[0057] The sequence of the Ψ region probe is shown in SEQ ID NO.3;

[0058] The LTR region probe whose sequence is shown in SEQ ID NO.6;

[0059] The pol region probe whose sequence is shown in SEQ ID NO.9; or

[0060] The sequence of the gag region probe is shown as SEQ ID NO.12.

[0061] In a preferred embodiment, the plurality of probes is a combination of the LTR region probe and the pol region probe or a combination of the LTR region probe and the gag region probe.

[0062] Due to the diversity of HIV-1 genes, there are no universal primers and probes that can cover all HIV-1 sequences, which limits the sensitivity of detection. Although the conserved regions can be increased by setting up degenerate bases, the specificity of the primer probes can be reduced to a certain extent. Therefore, in the present invention, the primer pairs designed based on the different conserved regions of the HIV-1 genome are in one-to-one correspondence with the probes, that is, when the primer pair of the first aspect is a Ψ region primer pair, then the Ψ region probe corresponding to the primer pair is selected, and when the primer pair of the first aspect is an LTR region primer pair and a gag region primer pair, then the LTR region probe and the gag region probe corresponding to the two primer pairs are selected, thereby ensuring the specificity of the probe and the sensitivity of detection.

[0063] Therefore, in a specific embodiment, the Ψ region primer pair is used in combination with a Ψ region probe whose sequence is shown in SEQ ID NO. 3 for the detection of HIV-1.

[0064] In yet another specific embodiment, the LTR region primer pair is used in combination with the LTR region probe whose sequence is shown as SEQ ID NO. 6 for the detection of HIV-1.

[0065] In yet another specific embodiment, the pol region primer pair is used in combination with a pol region probe whose sequence is shown as SEQ ID NO.9 for the detection of HIV-1.

[0066] In yet another specific embodiment, the gag region primer pair is used in combination with a gag region probe having a sequence as shown in SEQ ID NO. 12 for the detection of HIV-1.

[0067] The specific sequence is as follows:

[0068] SEQ ID NO.1: TAGCAGTGGYGCCCGAACAG

[0069] SEQ ID NO.2: GCTCTCGCACCCATCTCTCTCCTTCTA

[0070] SEQ ID NO.3: CAGGACTCGGCTTGCTGA-MGB

[0071] SEQ ID NO.4:GCCTCAATAAAGCTTGCCTT

[0072] SEQ ID NO.5:GCRCCACTGCTAGAGATTTT

[0073] SEQ ID NO.6:ACTCTGGTAWCTAGAGATCCCTCAG-MGB

[0074] SEQ ID NO.7: GGTTTATTACAGRGACARCAGA

[0075] SEQ ID NO.8: CYGCYCCTTCACCTTTCCA

[0076] SEQ ID NO.9: TGGAAAGGACCAGC-MGB

[0077] SEQ ID NO.10:GCGGAGGCTAGAAGGAGA

[0078] SEQ ID NO.11:CYCTGCTTGCCCATACTA

[0079] SEQ ID NO. 12: ATGGGTGCGAGAGCGTC-MGB.

[0080] In a third aspect, an internal reference primer pair and probe combination for HIV-1 nucleic acid detection is provided, comprising: an internal reference upstream primer having a sequence as shown in SEQ ID NO.13, an internal reference downstream primer having a sequence as shown in SEQ ID NO.14, and an internal reference probe having a sequence as shown in SEQ ID NO.15. The specific sequences are as follows:

[0081] SEQ ID NO.13:GTTAGTACACGGGAATTTCATG

[0082] SEQ ID NO.14: CATTATTTTTGCTACAATTCAGTC

[0083] SEQ ID NO. 15: ATTTCACCGGGAAGTTTCTT-MGB.

[0084] It is understood that in addition to considering the use of the internal reference itself, the design and screening of the internal reference primer pair and probe also need to avoid nonspecific amplification caused by nonspecific dimerization or mismatching between the internal reference primer pair and the probe, and also avoid nonspecific amplification caused by nonspecific dimerization or mismatching between the internal reference primer pair and the probe to be amplified. In the dPCR amplification method adopted by the present invention, especially the dual dPCR amplification method, the internal reference primer pair of the present invention is verified by the dye method and does not produce nonspecific dimers with the two selected amplification primer pairs, thereby having higher amplification efficiency and accuracy.

[0085] In a fourth aspect, a reaction system for detecting HIV-1 nucleic acid is provided, the reaction system comprising one or more primer pairs of the first aspect of the invention, i.e., a Ψ region primer pair, an LTR region primer pair, a pol region primer pair, a gag region primer pair, or a combination thereof.

[0086] In a preferred embodiment, the reaction system further comprises one or more probes of the second aspect of the present invention, ie, a Ψ region probe, an LTR region probe, a pol region probe, a gag region probe, or a combination thereof.

[0087] In a more preferred embodiment, the reaction system further comprises an internal reference primer pair and a probe combination.

[0088] In the context of the present invention, an exogenous internal reference sequence having no cross reaction with HIV-1 and a corresponding internal reference primer pair and internal reference probe are designed for internal quality control of the nucleic acid amplification process to ensure the reliability of the detection results.

[0089] It is understood that for the design and screening of internal reference primer pairs and internal reference probes, in addition to considering their use as internal references themselves, it is also necessary to avoid non-specific dimerization or mismatching between the primer pairs and probes of the internal references themselves and non-specific dimerization or mismatching between the primer pairs and probes of the amplified target genes and non-specific amplification caused by them. To this end, the inventors of the present invention used internal reference sequences derived from the non-human carrot genome (GenBank: CM004278.1), used SnapGene software for sequence alignment, and confirmed their specificity by dye method and probe method, thereby obtaining internal reference primer pairs and internal reference probes that can be used in the present invention.

[0090] Therefore, in a preferred embodiment, the internal reference primer pair and probe combination is the internal reference primer pair and probe combination of the third aspect of the present invention.

[0091] It has been verified by the inventors of the present invention that in the dPCR amplification method adopted by the present invention, especially in the dual dPCR amplification method, the internal reference primer pair of the present invention has been verified by the dye method and does not produce non-specific dimers with the two selected pairs of amplification primer pairs, thereby having higher amplification efficiency and accuracy.

[0092] In a fifth aspect, there is provided use of one or more primer pairs of the first aspect in preparing a detection system for detecting HIV-1.

[0093] In a specific embodiment, the detection system further comprises one or more probes according to the second aspect of the present invention.

[0094] As mentioned above, those skilled in the art will know that the primer pairs designed based on different conserved regions of the HIV-1 genome correspond one to one with the probes, that is, when the primer pair of the first aspect is a Ψ region primer pair, the Ψ region probe corresponding to the primer pair is selected, and when the primer pair of the first aspect is an LTR region primer pair and a gag region primer pair, the LTR region probe and the gag region probe corresponding to the two primer pairs are selected, thereby ensuring the specificity of the probe and the sensitivity of the detection.

[0095] In yet another specific embodiment, the detection system further comprises an internal reference primer pair and a probe combination.

[0096] In a preferred embodiment, the internal reference primer pair and probe combination is the internal reference primer pair and probe combination of the third aspect of the present invention.

[0097] In a preferred embodiment, the detection is performed by primer amplification and probe hybridization based on digital PCR (dPCR). It is understood that in the context of the present invention, detection of HIV-1 virus can be achieved by dPCR amplification reaction. The dPCR amplification can include single dPCR amplification or double dPCR amplification, thereby achieving single target or dual target detection of HIV-1.

[0098] In a further preferred embodiment, the detection can be based on single-plex dPCR amplification using a Ψ region primer pair, an LTR region primer pair, a gag region primer pair or a pol region primer pair.

[0099] In yet another further preferred embodiment, the detection may be based on dual dPCR amplification using a primer pair for the LTR region and a primer pair for the gag region, or based on dual dPCR amplification using a primer pair for the LTR region and a primer pair for the pol region.

[0100] In a further preferred embodiment, the detection can be based on dual dPCR amplification using LTR region primer pairs, LTR region probes, gag region primer pairs and gag region probes, or based on dual dPCR amplification using LTR region primer pairs, LTR region probes, pol region primer pairs and pol region probes.

[0101] In a sixth aspect, a method for detecting HIV-1 is provided, the method comprising:

[0102] 1) Provide HIV-1 nucleic acid samples;

[0103] 2) Using the HIV-1 nucleic acid sample as a template, amplifying the HIV-1 nucleic acid using one or more primer pairs of the first aspect of the present invention.

[0104] In a specific embodiment, the amplification is performed by digital PCR (dPCR).

[0105] It is understood that the primer pair of the first aspect of the present invention can detect HIV-1 virus through dPCR amplification reaction. The dPCR amplification can include single dPCR amplification or double dPCR amplification, thereby realizing single target or dual target detection of HIV-1.

[0106] It is understood that the HIV-1 nucleic acid sample used in the context of the present invention can be from any source, for example, from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc., or it can be a sample artificially synthesized based on a known nucleic acid sequence. In addition, it is also understood that the HIV-1 nucleic acid sample can be extracted and obtained by conventional nucleic acid extraction techniques in the art, and the present invention has no particular limitations on nucleic acid extraction methods and reagents. Therefore, in a specific embodiment, HIV-1 nucleic acid can be extracted from a blood sample, a body fluid sample, or a sample artificially synthesized based on a known nucleic acid sequence.

[0107] It can also be understood that the HIV-1 nucleic acid sample involved in the present invention can be an HIV-1 RNA sample or an HIV-1 DNA sample. It is well known to those skilled in the art that HIV-1 is a single-stranded RNA virus, and the usual nucleic acid detection for HIV-1 is to detect HIV-1 RNA in plasma, but in the early stages of HIV-1 infection, HIV-1 RNA will be integrated into the cell to form HIV-1 DNA. The primers and probes designed by the present invention can successfully amplify both HIV-1 RNA and HIV-1 DNA, and only different sample types and nucleic acid extraction reagents need to be selected. For example, HIV-1 RNA samples can be plasma samples or RNA extraction reagents, and HIV-1 DNA samples can be samples such as whole blood, cells, tissues, or DNA extraction reagents, but are not limited thereto.

[0108] In yet another specific embodiment, the detection can be based on single-plex dPCR amplification using a Ψ region primer pair, an LTR region primer pair, a gag region primer pair or a pol region primer pair.

[0109] In yet another specific embodiment, the detection can be based on dual dPCR amplification using a primer pair for the LTR region and a primer pair for the gag region, or based on dual dPCR amplification using a primer pair for the LTR region and a primer pair for the pol region.

[0110] In yet another specific embodiment, the method further comprises using one or more probes of the second aspect of the invention.

[0111] In a preferred embodiment, the detection can be based on dual dPCR amplification using an LTR region primer pair, an LTR region probe, a gag region primer pair and a gag region probe, or a detection based on dual dPCR amplification using an LTR region primer pair, an LTR region probe, a pol region primer pair and a pol region probe.

[0112] As mentioned above, those skilled in the art will know that the primer pairs designed based on different conserved regions of the HIV-1 genome correspond one to one with the probes, that is, when the primer pair of the first aspect is a Ψ region primer pair, the Ψ region probe corresponding to the primer pair is selected, and when the primer pair of the first aspect is an LTR region primer pair and a gag region primer pair, the LTR region probe and the gag region probe corresponding to the two primer pairs are selected, thereby ensuring the specificity of the probe and the sensitivity of the detection.

[0113] In yet another specific embodiment, the detection further comprises the use of an internal reference primer pair and probe combination.

[0114] In a preferred embodiment, the internal reference primer pair and probe combination are the internal reference primer pair and probe combination of the third aspect of the present invention. As mentioned above, the internal reference primer pair and probe combination are used for internal quality control of nucleic acid extraction and amplification processes to ensure the reliability of the test results. In the dPCR detection method adopted by the present invention, especially in the dual dPCR detection method, the internal reference primer pair and probe combination of the present invention are verified by the dye method and will not produce non-specific dimers with the two selected pairs of amplification primer pairs, thereby having higher amplification efficiency and accuracy.

[0115] In yet another specific embodiment, the annealing temperature of the amplification reaction is 50°C-60°C, the annealing extension time is 30-60 seconds, and the number of cycles is 40-45 times.

[0116] It is understood that for single dPCR and duplex dPCR, the preferred annealing temperature, annealing extension time and number of cycles may be the same or different. For example, when performing a single dPCR amplification reaction, the annealing temperature may be 57°C-60°C, preferably 60°C, the annealing extension time may be 30 seconds, and the number of cycles may be 40. When performing a duplex dPCR amplification reaction, the annealing temperature may be 50°C-56°C, preferably 52°C, the annealing extension time may be 30 seconds, and the number of cycles may be 45.

[0117] In yet another specific embodiment, the concentration ratio of primers to probes in the amplification reaction is 2:2:1.

[0118] In yet another specific embodiment, the concentration of the primer is 0.2 μM-0.6 μM.

[0119] In a preferred embodiment, the concentration of the primer is 0.4 μM-0.45 μM.

[0120] In yet another specific embodiment, the concentration of the probe is 0.1 μM-0.3 μM.

[0121] In a preferred embodiment, the concentration of the probe is 0.2 μM-0.225 μM.

[0122] Other reagents required in the amplification reaction of the present invention, such as buffer, dNTP, etc., can use commonly used reagents in the art, and the present invention has no particular limitation on this.

[0123] It is also understandable that the method for detecting HIV-1 of the present invention can be used for diagnostic purposes or for "non-diagnostic purposes", wherein the "non-diagnostic purposes" include but are not limited to inspection and quarantine and epidemic prevention and control.

[0124] The inventors of the present invention have concluded through repeated studies that the primer pairs and probe combinations for HIV-1 detection of the present invention, whether for single-target detection or dual-target detection, show low detection limits, high sensitivity and high specificity, and can be applied to the amplification of subtypes such as CRF01_AE, CRF07_BC, CRF08_BC, B, CRF55_01B and other common prevalent strains of HIV-1 in my country, with a wide range of subtype coverage. Therefore, compared with existing methods, the present invention is more suitable for the inspection, quarantine and prevention and control of HIV-1 diseases in my country.

[0125] In a seventh aspect, a kit for detecting HIV-1 is provided, comprising:

[0126] a) one or more primer pairs of the first aspect; and

[0127] b) instructions for use indicating how to use the kit.

[0128] In a preferred embodiment, the kit further comprises one or more probes of the second aspect. Those skilled in the art will know that when the primer pair of the first aspect is a Ψ region primer pair, a Ψ region probe corresponding to the primer pair is selected, and when the primer pair of the first aspect is an LTR region primer pair and a gag region primer pair, an LTR region probe and a gag region probe corresponding to the two primer pairs are selected.

[0129] In a further preferred embodiment, the kit further comprises an internal reference primer pair and a probe combination for internal quality control of the nucleic acid extraction and amplification process to ensure the reliability of the detection results.

[0130] In a further preferred embodiment, the internal reference primer pair and probe combination is the internal reference primer pair and probe combination of the third aspect of the present invention.

[0131] Example

[0132] In the following examples, primer pairs and probe combinations, amplification and detection methods of the present invention are shown. Unless otherwise specified, the test methods used are all conventional methods, and unless otherwise specified, the test materials used in the following examples are all conventional reagents purchased from stores. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention.

[0133] It should be noted that the terms used in the specification of the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The above summary of the invention, the specific embodiments and the following examples are only for the purpose of specifically explaining the present invention, and are not intended to limit the present invention in any way. Without departing from the spirit and purpose of the present invention, the scope of the present invention is determined by the attached claims.

[0134] Example 1: Design and screening of primers and probes

[0135] (1) HIV-1 gene sequence analysis

[0136] 610 HIV-1 full gene sequences in my country and 237 HIV-1 LTR and gag region gene sequences in Asia were downloaded from the Los Alamos database to construct gene sequence sets. The gene sequence library was compared using Bioedit software under the conditions of "shade threshold 99%" and "shade threshold 100%" to find conservative fragments for the design of primers and probes.

[0137] (2) Primer and probe design

[0138] Using the gene sequence sets of the LTR and gag regions in Asia and the domestic full gene sequence set, a total of 7 conserved fragments were found in the conserved region, and 20 sets of primer and probe combinations were designed, as shown in Table 1 below (F represents upstream primer, R represents downstream primer, and P represents probe).

[0139] Table 1: Preliminary designed primer and probe sequences

[0140]

[0141]

[0142] (3) Construction of reference sequence HXB2 plasmid

[0143] Based on the sequence analysis results, the reference plasmid HXB2 (GenBank: K03455.1) was designed. The specific steps are as follows:

[0144] Bioedit software was used to analyze the complete gene sequence set of HIV-1 in my country. Using pUC57 as a vector, 7 conserved region fragments were inserted. Their positions on the HXB2 reference sequence were as follows: Conserved fragment 1: 522-544bp; Conserved fragment 2: 577-603bp; Conserved fragment 3: 622-649bp; Conserved fragment 4: 682-709bp; Conserved fragment 5: 761-807bp; Conserved fragment 6: 890-909bp; Conserved fragment 7: 4896-4980bp, to ensure that the designed primer probe can be amplified successfully. When inserting the conserved region fragment, the length of the conserved fragment should exceed the length of the amplified fragment of the primer probe to avoid the situation where the 5' end of the upstream primer designed based on the conserved region and the 3' end of the downstream primer are the same as the start and end positions of the conserved region, and the primer and probe are adjacent, which may lead to amplification failure. After the gene fragment is determined, the SnapGene software is used to analyze the fitted plasmid full sequence (pUC57 + conserved region fragment) to ensure the specific binding of the primer probe and avoid the situation where the same set of primers and probes can successfully amplify two fragments.

[0145] (4) Primer and probe screening

[0146] First round of screening: Using the reference sequence plasmid (HXB2) prepared in step (3) as a template, amplify using the 20 sets of primers and probes designed in step (2), and perform duplicate testing. The specific steps are as follows:

[0147] Centrifuge the sample tube containing the plasmid powder at 13000rpm for 10-15 minutes to allow the powder to settle to the bottom of the tube. Slowly open the tube cap, add a certain amount of RNase-Free ddH2O to dissolve the plasmid and mix well. Use NanoDrop One spectrophotometer to quantify (ng / μL), and calculate the DNA copy number (copy / μg) based on the full length of the plasmid. Use the spectrophotometer quantitative value and the DNA copy number to calculate the concentration of the plasmid (copy / μL). Take the theoretical concentration as 10 5 The reference plasmid (HXB2) with 100 copies / μL was used as a template and TaKaRa One Step PrimeScript TM The RT-PCR kit and the 20 sets of primer probes designed in step (2) were tested in duplicate wells to avoid inaccurate results caused by single-well amplification failure due to experimental operation. The reaction system and reaction conditions are shown in Table 2 below:

[0148] Table 2: Reaction system and reaction conditions for one round of screening amplification reagents

[0149]

[0150] The amplification results are as follows Figure 1 As shown. Figure 1It can be seen that the Ct values ​​of groups 1 to 4 are all greater than 30, and the Ct values ​​of groups 9 to 12 are greater than 25, which are higher than the Ct values ​​of the other 12 groups (all less than 25), and the final fluorescence values ​​are significantly lower. Therefore, in this round of screening, 12 groups of primer probes with better amplification effects were retained, namely groups 5 to 8 and groups 13 to 20.

[0151] Second round of screening: QIAamp Viral RNA Mini Kit (250) was used to extract RNA from each subtype of strains and plasma samples of HIV-1 infected individuals. The strains included 2 samples each of CRF01_AE subtype, CRF07_BC subtype, CRF55_01B subtype and B subtype strains; the plasma samples of HIV-1 infected individuals included 2 samples each of CRF01_AE subtype, CRF07_BC subtype, CRF08_BC subtype and B subtype samples, and 1 plasma sample of CRF85_BC subtype.

[0152] The theoretical concentration is 10 5 The RNA of subtype B strain (SF33) with 10 copies / mL was used as template and TaKaRa One StepPrimeScript TM The RT-PCR kit and the 12 sets of primers and probes after a round of screening were tested in duplicate wells to avoid inaccurate results caused by single-well amplification failure due to experimental operation. The reaction system and reaction conditions are shown in Table 3 below.

[0153] Table 3: Reaction system and reaction conditions of the second round of screening amplification reagents

[0154]

[0155] The amplification results are as follows Figure 2 As shown in A. Groups 13 to 16 were unable to successfully amplify RNA from one of the B subtype strains. Figure 2 Based on the amplification results of A, the amplification effects of primers and probes on qPCR and the location of the target, a set of primers and probes were finally selected in the LTR region, gag region, pol region and Ψ region, namely, Group 6, Group 18, Group 19 and Group 20 in Table 1.

[0156] The theoretical concentration is 10 5 The RNA of each subtype strain with a copy / mL and the RNA of each subtype plasma sample with unknown viral load were used as templates, using TaKaRa One Step PrimeScript TM The RT-PCR kit and the final 4 sets of primers and probes were tested in duplicate to avoid inaccurate results caused by single-well amplification failure due to experimental operation. The reaction system and reaction conditions are shown in Table 3 above.

[0157] The amplification results are as follows Figure 2 As shown in B. These four sets of primers and probes were successfully used to amplify samples of various subtypes of strains and plasma samples of HIV-1 infected individuals of various subtypes.

[0158] Example 2: Validation of primers and probes

[0159] Amplification efficiency verification: The amplification efficiency and linearity of the four sets of primers and probes screened in Example 1 were verified. The specific steps are as follows: 10 The reference sequence plasmid (HXB2) with a concentration of 10 copies / μL was diluted 10-fold to obtain 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL and 10 3 Copies / μL of plasmid, using TaKaRa OneStep PrimeScript TM The RT-PCR kit and the primers and probes of groups 6, 18, 19 and 20 in Table 1 were used to detect each concentration of plasmid in parallel 3 times. The reaction system and reaction conditions are shown in Table 4 below:

[0160] Table 4: Reaction system and reaction conditions for amplification efficiency and linearity verification

[0161]

[0162] The results are as follows Figure 3 As shown. Figure 3 The results showed that the amplification efficiency and linearity of the four sets of primers and probes were consistent with E in the range of 90-110%, R 2 The requirement of ≥0.98 indicates that the amplification effects of these four sets of primers and probes are close to the ideal situation, and the higher the correlation between the test results and the Ct value.

[0163] Specificity verification: When primer dimers exist between primers, non-specific products may be formed during amplification. Generally, the qPCR results based on the probe method cannot distinguish whether non-specific amplification occurs. In this example, the dye method is used to observe the peaks of the melting curve to distinguish whether non-specific amplification occurs. If only one peak appears when the target fragment is used as a template, it indicates that non-specific amplification does not occur; if multiple peaks are generated, it indicates that non-specific amplification occurs.

[0164] Using water as a template, Taq Pro Universal SYBR qPCR Master Mix reagent was used to verify the specificity of the upstream primers and downstream primers of Group 6, Group 18, Group 19 and Group 20 in Table 1, and double wells were tested. The reaction system and reaction conditions are shown in Table 5 below:

[0165] Table 5: Reaction system and reaction conditions for specificity verification

[0166]

[0167]

[0168] The melting curve acquisition program can use the instrument default program.

[0169] The amplification results are as follows Figure 4 As shown. Figure 4 It can be seen that when water is used as a template, the amplification results of the four sets of upstream primers and downstream primers tested by the dye method have no peaks in the figure, indicating that there is no nonspecific amplification between the four sets of upstream primers and downstream primers.

[0170] Example 3: Preparation of HIV-1 in vitro transcribed RNA standard

[0171] HIV-1 is an RNA virus. HIV-1 nucleic acid detection usually confirms the infection status by detecting HIV-1 RNA in plasma. In order to avoid the influence of different template types on the optimization of the best reaction conditions, before optimizing the reaction conditions, the HIV-1 plasmid is subjected to an in vitro transcription test to construct an HIV-1 in vitro transcribed RNA standard. The specific steps are as follows:

[0172] 1. Amplify the linearized DNA fragment containing the target fragment

[0173] (1) The plasmid constructed in the early stage uses pUC57 as a vector, and the target fragment is inserted between the vector sequences to form the complete sequence of the plasmid. The complete sequence of the plasmid is analyzed, and a set of transcription primers common to each plasmid is designed upstream and downstream of the target fragment. When synthesizing the primers, the T7 promoter (5'-GGATCCTAATACGACTCACTATAGG-3') is introduced at the 5' end of the upstream primer. The primer sequence is shown in Table 6.

[0174] Table 6: Primer sequences used in in vitro transcription experiments

[0175]

[0176] (2) Using TaKaRa Ex Kit, using F-T7 and R-T7 as primers and each plasmid as template for amplification. The reaction system is 50 μL, including: 0.25 μL TaKaRa Ex Taq (5U / μL); 5 μL 10×Ex Taq Buffer (Mg 2+ free); 4μL MgCl2 (25mM); 4μL dNTP Mixture; 4μL F-T7 and R-T7 (10μM); template and water make up to 50μL, the template can be in excess, but make sure that the total amount of recovered PCR product reaches 1μg; reaction conditions are: ①98℃, 10 seconds; ②55℃, 30 seconds; 72℃, 60 seconds, 30 cycles.

[0177] (3) Prepare agarose gel with a concentration of 1%-1.2%, add 50 μL of PCR product into the sample tank for gel electrophoresis experiment. After the experiment, cut out the target fragment for subsequent recovery.

[0178] 2. Recover PCR products

[0179] The amplified product was purified and recovered using a common agarose gel DNA recovery kit (Tiangen #DP209).

[0180] 3. In vitro transcribed HIV-1 RNA standard

[0181] The recovered product was quantified using a NanoDrop One spectrophotometer, and an appropriate volume was taken as a template (ensuring that the total template amount was approximately 1 μg), and in vitro transcription was performed using the Promega T7 RiboMAX Express Large Scale RNA ProductionSystem reagent. 10 μL RiboMAXTM Express T7 2×Buffer, 2 μL Enzyme Mix, T7 Express were added to the template, and water was added to make up to 30 μL, and then gently mixed, and incubated at 37°C for 30 minutes; RQ1 RNase-Free DNase was added to a final concentration of 1U / μg template DNA, and gently mixed, and incubated at 37°C for 15 minutes to remove the DNA template. RNA in the transcription product was extracted using the RNAsimple Total RNA Extraction Kit (Tiangen #DP419).

[0182] Example 4: Design and verification of primers and probes for internal reference plasmids

[0183] In order to ensure the reliability of the test results and avoid the situation where the test results are significantly different from or inconsistent with the actual results due to systematic errors or failures in the experimental process, internal reference sequences and corresponding primer probes are constructed for internal quality control of the nucleic acid amplification process.

[0184] Construction of internal reference plasmid: Referring to the commercial HIV-1 viral load detection kits registered by the State Food and Drug Administration, such as Roche Cobas AmpliPrep / COBAS TaqMan HIV-1 Test, version 2.0 and Abbott RealTime HIV-1 Kit, a non-human sequence (such as SEQ ID NO. 16) was selected to construct the internal reference plasmid. The specific steps are as follows:

[0185] To avoid nonspecific amplification caused by nonspecific dimerization or mismatch between the internal reference plasmid and the primer pairs and probes for amplification, the non-human carrot genome (GenBank: CM004278.1) was used to design the internal reference plasmid. Select multiple gene fragments of about 200 bp and preliminarily design primers and probes. Use PrimerSelect software for screening to ensure that there is no nonspecific dimerization between the primer pairs and probes of the internal reference plasmid itself, and also to ensure that there is no nonspecific dimerization between it and the HIV-1 primers and probes. Use SnapGene software for sequence alignment, and select the gene fragments that do not match the HIV-1 sequence and the primers and probes of HIV-1 as the internal reference plasmid.

[0186] Design of internal reference primers and probes: When designing primers and probes for the internal reference plasmid, refer to the design principles of primers and probes, and design primers and probes for the internal reference plasmid sequence shown in SEQ ID NO.16, as shown in Table 7 below.

[0187] Table 7: Primers and probes for internal reference plasmids

[0188] Internal reference sequence Upstream primer: GTTAGTACACGGGAATTTCATG(SEQ ID NO.13) Downstream primer: CATTATTTTTGCTACAATTCAGTC(SEQ ID NO.14) Probe: ATTTCACCGGGAAGTTTCTT-MGB(SEQ ID NO.15)

[0189] Linearization of internal reference plasmid: To avoid the inability to obtain the target gene in the closed plasmid structure, which will ultimately affect the detection performance and final quantification, the internal reference plasmid is linearized as follows before optimizing the reaction conditions:

[0190] The sequence of the internal reference plasmid was analyzed. The internal reference plasmid used pUC57 as a vector. To ensure the integrity of the internal reference gene after restriction digestion, the EcoRI site was selected for restriction digestion.

[0191] The reagent used for enzyme digestion is NEB EcoRI-HF. Take an appropriate volume of circular plasmid as template (to ensure that the total template amount is about 1μg), add 5μL 10×NEBuffer, 1μL restriction endonuclease, add water to make up to 50μL and mix gently, incubate at 37℃ for 5-15 minutes, and heat and incubate at 65℃ for 20 minutes to obtain a mixture of linear plasmid and enzyme digestion reagent. Use a common DNA product purification kit (Tiangen #DP204) for purification to obtain a linearized internal reference plasmid.

[0192] Amplification of internal reference primers and probes: Referring to the steps in Example 2, water and a theoretical concentration of 10 5 The internal reference plasmid with a copy / μL was used as a template and TaKaRa One Step PrimeScript TM The RT-PCR kit, internal reference primers and probes were tested in duplicate. The specific reaction system and reaction conditions are shown in Table 4 above. Figure 5 As shown by Figure 5 It can be seen that the plasmid templates were amplified successfully, but the water templates were not amplified successfully.

[0193] Verification of internal reference primers and probes: The amplification efficiency and linearity of the internal reference primers and probes were verified with reference to the steps in Example 2. Figure 6 As shown. Figure 6 It can be seen that the amplification efficiency and linearity of this set of internal reference primers and probes are consistent with E being between 90-110%, R 2 ≥0.98 requirement.

[0194] Specificity Verification:

[0195] (1) Referring to the specificity verification step of Example 2, water was used as a template, the dye method was used, and Taq Pro Universal SYBR qPCR Master Mix reagent was used to divide the upstream and downstream primer pairs of the internal reference plasmid and the four upstream and downstream primer pairs of the LTR region, gag region, pol region and Ψ region of HIV-1 into the following 13 groups for pairwise comparison, and double-well retesting was performed. The specific reaction system and reaction conditions are shown in Table 5 above.

[0196] The first set of duplicate wells: upstream primer and downstream primer of internal reference;

[0197] The second set of duplicate wells: upstream primers of the internal reference and upstream primers of the LTR region;

[0198] The third set of duplicate wells: upstream primer of internal reference and downstream primer of LTR region;

[0199] The fourth set of duplicate wells: upstream primers of the internal reference and upstream primers of the gag region;

[0200] The fifth set of duplicate wells: upstream primer of internal reference and downstream primer of gag region;

[0201] The sixth set of duplicate wells: upstream primers of the internal reference and upstream primers of the pol region;

[0202] The seventh set of duplicate wells: upstream primer of internal reference and downstream primer of pol region;

[0203] The eighth set of duplicate wells: downstream primers of the internal reference and upstream primers of the LTR region;

[0204] The ninth set of duplicate wells: downstream primers of the internal reference and downstream primers of the LTR region;

[0205] The tenth set of duplicate wells: downstream primers of the internal reference and upstream primers of the gag region;

[0206] Eleventh set of duplicate wells: downstream primers of internal reference and downstream primers of gag region;

[0207] The twelfth set of duplicate wells: downstream primer of internal reference and upstream primer of pol region;

[0208] The thirteenth set of duplicate wells: the downstream primer of the internal reference and the downstream primer of the pol region.

[0209] The amplification results are as follows Figure 7 As shown. Figure 7 It can be seen that there is no non-specific amplification between the upstream and downstream primer pairs of the internal reference, and between the upstream primer or downstream primer of the internal reference and the upstream primer or downstream primer of HIV-1.

[0210] (2) Referring to the second round of screening amplification step in Example 1, the theoretical concentration was 10 5 Copies / μL of HIV-1 in vitro transcribed RNA as template, using TaKaRa One Step PrimeScript TM The RT-PCR kit, internal reference primers and probes were tested in duplicate. The specific reaction system and reaction conditions are shown in Table 3 above. Figure 8 As shown. Figure 8 It can be seen that the double-well retest failed to amplify successfully.

[0211] (3) Referring to the amplification efficiency verification step of Example 2, the theoretical concentration was 10 5 The linearized internal reference plasmid with 1000 copies / μL was used as the template and TaKaRa One Step PrimeScript TM The RT-PCR kit used primers and probes in the LTR+gag and LTR+pol regions for dual-target detection. The specific reaction system and reaction conditions are shown in Table 4 above. Fig. 9 As shown. Fig. 9 It can be seen that the double-well retest failed to amplify successfully.

[0212] The above amplification results all indicate that when the internal reference primers and probes are used together with the primers and probes of HIV-1 RNA, non-specific amplification does not occur and the amplification has good specificity.

[0213] Example 5: Optimization of single-plex dPCR reaction conditions

[0214] A single-target dPCR amplification reaction was established using Ψ region primers and probes for HIV-1 RNA detection. The single-target dPCR amplification reaction conditions were optimized by the following steps.

[0215] Annealing temperature optimization: Annealing temperature is related to the Tm value of the primer. Usually, the optimal annealing temperature is 3-5°C lower than the lowest Tm value of the primer. The Tm value of the upstream primer of the Ψ region synthesized in this experiment is 62°C, and the Tm value of the downstream primer is 63°C. Theoretically, the optimal annealing temperature is 57-60°C. In addition, the dPCR amplification reagent used in this experiment is QlAcuity One-step Viral RT-PCRKit, and the optimal annealing temperature recommended in the reagent manual is 60°C. Therefore, 10 5 The HXB2 in vitro transcribed RNA with a concentration of 100 copies / μL was used as a template, and the annealing temperatures were 58°C, 60°C, and 62°C, respectively. The formation of "raindrops" at each annealing temperature was observed, and the temperature with less "raindrops" and more obvious positive and negative partitions was used as the annealing temperature. "Raindrops" refer to some positive droplets with low amplification efficiency between the positive partitions and the negative partitions of the dPCR one-dimensional graph. If "raindrops" are excluded when calculating the copy number, the results will be underestimated. The reaction system and reaction conditions are shown in Table 8 below:

[0216] Table 8: Reaction system and reaction conditions for annealing temperature optimization:

[0217]

[0218] The amplification results are as follows Fig.10 As shown, when the annealing temperature is 60°C, fewer "raindrops" are formed and the cation-cation partitioning is more obvious, so 60°C is selected as the annealing temperature.

[0219] Optimization of extension time and cycle number: Currently, the commonly used extension time and cycle number for PCR are usually: "30 seconds, 40 / 45 cycles" and "1 minute, 40 / 45 cycles", which can meet the amplification needs in most cases. At 60°C annealing temperature, without changing the reaction system and other reaction conditions, the "raindrop" formation was compared when "annealing extension time 30 seconds, 40 cycles" and "annealing extension time 1 minute, 45 cycles". The amplification results are also as follows Fig.10 As shown in the figure, under the two conditions, the "raindrop" formation and the positive and negative partitioning were similar, and the dPCR quantitative values ​​were similar. In order to reduce the amplification reaction time, "annealing extension time 30 seconds, 40 cycles" was selected as the reaction condition.

[0220] Primer and probe concentrations: Under the optimized annealing temperature, extension time and cycle number conditions, different volumes of primer and probe mixture (total concentration is 10μM) were added: 0.8μL, 1.2μL, 1.6μL, 2μL and 2.4μL, where the ratio of primer and probe mixture was upstream primer: downstream primer: probe = 2:2:1, so that the final concentration of each primer in the amplification system was 0.2μM, 0.3μM, 0.4μM, 0.5μM and 0.6μM, respectively, and the final concentration of the probe was 0.1μM, 0.15μM, 0.2μM, 0.25μM and 0.3μM, respectively. The formation of "raindrops" at various primer and probe concentrations was compared. When 1.6μL of primer and probe mixture (primer: 0.4μM; probe: 0.2μM) was added, fewer "raindrops" were formed and the positive and negative partitioning was more obvious. The amplification results are shown in the figure. Fig.10 As shown. Fig.10 It can be seen that when other conditions are consistent, the annealing temperature is 60°C, the annealing extension time is 30 seconds, 40 cycles, and 1.6 μL of primer and probe mixture is added (primer: 0.4 μM; probe: 0.2 μM), fewer "raindrops" are formed in the dPCR one-dimensional graph, and the positive and negative partitioning is more obvious. The final reaction conditions are: annealing temperature: 60°C; primer and probe concentration: 1.6 μL of primer and probe mixture with a total concentration of 10 μM (primer: 0.4 μM; probe: 0.2 μM) is added; number of cycles and extension time: 40 cycles, 30 seconds.

[0221] Example 6: Primer selection for dual dPCR

[0222] In this embodiment, the primers of LTR region, gag region and pol region are combined in pairs (i.e., LTR+gag, LTR+pol and gag+pol) to establish a dual-target HIV-1 RNA detection system. The reason why the Ψ region primers and probes are not introduced here is that in previous experiments, it was found that dimers exist between the Ψ region primers and the other three sets of primers.

[0223] Specificity verification: Referring to the specificity verification step of Example 2, water was used as a template, and Taq Pro Universal SYBR qPCR Master Mix reagent was used to perform specificity verification on three sets of upstream and downstream primer pairs in the HIV-1 LTR region, gag region, and pol region in the following 12 groups, and double-well retests were performed. The specific reaction system and reaction conditions are shown in Table 5 above.

[0224] The first set of duplicate wells: upstream primers of the LTR region and upstream primers of the gag region;

[0225] The second set of duplicate wells: LTR upstream primer and gag region downstream primer;

[0226] The third set of duplicate wells: upstream primers of LTR and upstream primers of pol region;

[0227] The fourth set of duplicate wells: upstream primer of LTR and downstream primer of pol region;

[0228] The fifth set of duplicate wells: downstream primers of the LTR region and upstream primers of the gag region;

[0229] The sixth set of duplicate wells: downstream primers of the LTR region and downstream primers of the gag region;

[0230] The seventh set of duplicate wells: downstream primers of the LTR region and upstream primers of the pol region;

[0231] The eighth set of duplicate wells: downstream primers of the LTR region and downstream primers of the pol region;

[0232] The ninth set of duplicate wells: upstream primers of the gag region and upstream primers of the pol region;

[0233] The tenth set of duplicate wells: upstream primers of the gag region and downstream primers of the pol region;

[0234] Eleventh set of duplicate wells: downstream primers of gag region and upstream primers of pol region;

[0235] The twelfth set of duplicate wells: downstream primers of the gag region and downstream primers of the pol region.

[0236] The amplification results are as follows Fig.11 As shown, the primer pair combination of gag region and pol region showed a high peak (the eleventh group) and a low peak (the tenth group), indicating that there was nonspecific amplification between the primers in the gag region and the pol region, while the primer pair combination of LTR+gag or LTR+pol did not show similar peaks, indicating that there was no nonspecific amplification between the primers in these two combinations and the specificity was good. Therefore, in subsequent experiments, the combination of LTR+gag or LTR+pol was selected for performance verification and condition optimization.

[0237] Selection of dual-target primer and probe combination: refer to the second round of screening steps in Example 1, use the same concentration of HIV-1 RNA as template, use LTR+gag and LTR+pol primers and probes for amplification, and repeat the test in two wells. The specific steps are as follows: take the theoretical concentration as 10 5 Copies / μL of HIV-1 in vitro transcribed RNA were used as templates and TaKaRa One StepPrimeScript TMRT-PCR kit, QIAcuity One-step Viral RT-PCR Kit and LTR+gag and LTR+pol primers and probes were used for amplification, and double-well retesting was performed. The specific reaction system and reaction conditions are shown in Table 3 and Table 8 above. The amplification results are shown in Table 3 and Table 8. Fig.12 and Fig.13 As shown. Fig.12 It can be seen that the Ct value of the primers and probes in the LTR+pol group is smaller, and Fig.13 It can be seen that the dPCR quantitative results of the LTR+pol group were higher, so the primers and probes of the LTR+pol group were selected for subsequent optimization.

[0238] Example 7: Optimization of dual dPCR amplification reaction conditions

[0239] In this example, the LTR+pol primers and probes selected in Example 6 were optimized for subsequent amplification reaction conditions.

[0240] Annealing temperature optimization: In order to find the best annealing temperature, the annealing temperature test was performed using the Bio-Rad CFX96 qPCR. Using the dPCR reaction system, 8 temperature gradients were set between 50-60°C (i.e., 50°C, 50.7°C, 52°C, 53.9°C, 56.3°C, 58.3°C, 59.4°C, and 60°C), and double-well retests were performed. The specific steps are as follows:

[0241] The theoretical concentration is 10 5 Copies / μL of HIV-1 in vitro transcribed RNA as template, using TaKaRa One StepPrimeScript TM RT-PCR kit and LTR+pol primers and probes were used for amplification, and double-well retesting was performed to avoid inaccurate results caused by single-well amplification failure due to experimental operation. Bio-Rad CFX96 instrument was used for amplification. When setting the annealing temperature, the temperature gradient was inserted, and the minimum temperature was set to 50°C and the maximum temperature was set to 60°C. The instrument automatically generated 6 intermediate temperatures. The reaction system and reaction conditions are shown in Table 9 below:

[0242] Table 9: Reaction system and reaction conditions for annealing temperature optimization:

[0243]

[0244] The amplification results are as follows Fig.14 As shown, comparison Fig.14 The Ct values ​​at different temperatures were calculated. The smaller the Ct value, the higher the amplification efficiency. It was preliminarily determined that the optimal range of annealing temperature was between 50℃-56℃.

[0245] Further, amplification was performed on the dPCR instrument at 50°C, 52°C, 54°C, 56°C and 60°C (the optimal temperature of the enzyme recommended in the manual) as the annealing temperature, and the specific steps were the same as above. Fig.15 (one-dimensional graph) and Fig.16 (Two-dimensional graph). It can be seen that when the annealing temperature is 52°C, fewer "raindrops" are formed in the one-dimensional graph, and the positive and negative divisions are more obvious; combined with the two-dimensional graph, it is found that there are fewer "raindrops" between the first quadrant (HIV-1 positive, internal reference negative) and the second quadrant (HIV-1 negative, internal reference negative), and the division is more obvious. Therefore, 52°C is selected as the final annealing temperature.

[0246] Optimization of the number of cycles: At an annealing temperature of 52°C, the amplification reaction system and other reaction conditions were kept unchanged, and only the number of cycles was changed. Amplification was performed using two conditions, "40 cycles, 30 seconds" and "45 cycles, 30 seconds", respectively, and the "raindrop" formation under these two conditions was compared.

[0247] The amplification results are as follows Fig.17 As shown. Fig.17 It can be seen that when the condition of "45 cycles, 30 seconds" is adopted, fewer "raindrops" are formed in the one-dimensional graph, the positive and negative division is more obvious, there are fewer "raindrops" between the first quadrant and the second quadrant in the two-dimensional graph, and the final quantitative result is higher than about 1 copy / μL of "40 cycles, 30 seconds". Finally, "45 cycles, 30 seconds" was selected as the final number of cycles and extension time.

[0248] Primer and probe concentration optimization: Under the conditions of 52°C annealing temperature, "45 cycles, 30 seconds" cycle number and extension time, the concentration of primers and probes in the reaction system was changed, and 1.0 μL, 1.2 μL, 1.4 μL, 1.6 μL, 1.8 μL, 2.0 μL, 2.2 μL and 2.4 μL of primer and probe mixture with a total concentration of 10 μM were added, respectively, so that the final concentration of each primer was 0.25 μM, 0.3 μM, 0.35 μM, 0.4 μM, 0.45 μM, 0.5 μM, 0.55 μM and 0.6 μM, respectively, and the final concentration of the probe was 0.125 μM, 0.15 μM, 0.175 μM, 0.2 μM, 0.225 μM, 0.25 μM, 0.275 μM and 0.3 μM, respectively. Comparison of amplification under these eight concentration conditions, the results are as follows Fig.18 As shown. Fig.18It can be seen that when 1.8 μL of 10 μM primer and probe mixture (i.e., primer: 0.45 μM; probe: 0.225 μM) was added, fewer "raindrops" were formed, the positive and negative partitioning was more obvious, and the quantitative results were higher and more stable. Finally, 1.8 μL of primer and probe mixture with a total concentration of 10 μM (i.e., primer: 0.45 μM; probe: 0.225 μM) was selected as the final reaction condition.

[0249] Example 8: Subtype coverage verification

[0250] The strain was sequenced by Sanger sequencing for nearly full-length genome sequencing, the pol region of the positive sample was sequenced, the sequence information obtained was analyzed, and the genetic subtypes of the strain and sample were obtained, including CRF01_AE, CRF07_BC, CRF08_BC, B and CRF55_01B subtypes. Single-target (single) dPCR detection was performed using the Ψ region primers and probes of the present invention, and dual-target (double) dPCR detection was performed using the LTR+pol region primers and probes of the present invention. The dPCR reagent used was QlAcuity One-step Viral RT-PCR Kit, and the total volume of the reaction system was 40 μL. The successfully extracted nucleic acid was used as a template for detection, and the reaction system and reaction conditions were shown in Tables 10 and 11 below:

[0251] Table 10: Reaction system and reaction conditions for single-plex dPCR

[0252]

[0253] Table 11: Duplex dPCR reaction system and reaction conditions

[0254]

[0255] 50 samples were tested using the established dPCR detection method. The positive detection rates of the dual-target dPCR method and the single-target dPCR method were both 100%. The subtype distribution of the samples is shown in Table 12:

[0256] Table 12: Subtype distribution information of strains and samples

[0257]

[0258]

[0259] Example 9: Detection Limits of Singleplex dPCR and Duplex dPCR Assays

[0260] HIV-1 national standard was used, and the test results were compared with those of a commercial kit (using qPCR method, dual target, LTR+pol, internal reference quantification) with the same amplification target region under optimized conditions. The dPCR detection method of the present invention was used to detect standard products with theoretical concentrations of 320IU / mL, 160IU / mL, 80IU / mL, 40IU / mL, 20IU / mL, 10IU / mL, 5IU / mL, 2IU / mL and 1IU / mL, and each concentration of standard product was tested 10 times, and the reaction system and reaction conditions were the same as in Example 8. The detection results were subjected to Probit probability analysis with the number of detections as the response frequency, and the predicted value when the positive detection rate was calculated to be 95% was the detection limit of the reagent.

[0261] The test results are shown in Table 13. As can be seen from Table 13, the dPCR amplification method using the primers and probes of the Ψ region, LTR+pol region of the present invention can achieve higher sensitivity using less template amount. By calculating the detection limit of the dPCR method and comparing it with the commercial qPCR kit of the dual-target point, it was found that the detection limits of the dual-target point dPCR, single-target point dPCR and commercial qPCR kit were 6.496 IU / mL, 17.687 IU / mL and 61.298 IU / mL, respectively, that is, the detection limit of the dual-target point dPCR method established by the present invention is much lower than the dual-target point qPCR of the prior art.

[0262] Table 13: Comparison of detection limits of the primer probe set of the present invention and commercial kits

[0263]

[0264] Example 10: Specificity Detection

[0265] The dPCR detection method of the present invention was used to detect 10 normal human plasma samples and 40 HIV-1 RNA negative, single positive or double positive samples of Treponema pallidum, HCV and HBV, and the reaction system and reaction conditions were the same as those in Example 8. The distribution and detection rate of HIV-1 negative samples are shown in Table 14 below. From the results of the table, it can be seen that the negative detection rates of the dual-target dPCR method and the single-target dPCR method are both 100%, indicating that the established dPCR detection method has good specificity and will not cross-react with samples of Treponema pallidum, HCV and HBV infected persons.

[0266] Table 14: Distribution of HIV-1 negative samples

[0267]

[0268] Example 11: Precision of Dual dPCR Detection

[0269] The dPCR method of the present invention was used to detect HIV-1 national standards with theoretical concentrations of 13000 IU / mL, 1300 IU / mL and 130 IU / mL, respectively. The reaction system and reaction conditions were the same as in Example 8. Each concentration of the standard was tested 5 times, and the precision (CV%) of the dual-target dPCR method was calculated. In addition, the CV% of the dual-target dPCR method was compared with the results of commercial kits A and B (using the qPCR method, the domestic (A) and imported (B) kits with the best precision evaluated by the internal reagents of the National AIDS Reference Laboratory).

[0270] The test results are shown in Table 15. As can be seen from Table 15, when the dPCR method using the LTR+pol region primers and probes of the present invention detects high, medium and low concentrations of standard products, the CV% of the test results are lower than that of the commercial kit based on qPCR, and the precision is higher, and is much lower than the requirement that the intra-batch precision of the quantitative reagent specified in the "Pharmaceutical Industry Standard of the People's Republic of China - Nucleic Acid Amplification Detection Reagents (Kits)" should meet the coefficient of variation (CV, %) of the logarithm of the detection concentration ≤ 5%.

[0271] Table 15: Comparison of the precision of the dual-target primer probe set of the present invention and the commercial kit

[0272]

[0273] Sequence Listing:

[0274] SEQ ID NO.1 (upstream of Ψ region): TAGCAGTGGYGCCCGAACAG

[0275] SEQ ID NO.2 (downstream of the Ψ region): GCTCTCGCACCCATCTCTCTCCTTCTA

[0276] SEQ ID NO.3 (Ψ region probe): CAGGACTCGGCTTGCTGA-MGB

[0277] SEQ ID NO.4 (upstream of LTR region): GCCTCAATAAAGCTTGCCTT

[0278] SEQ ID NO.5 (downstream of LTR region): GCRCCACTGCTAGAGATTTT

[0279] SEQ ID NO.6 (LTR region probe): ACTCTGGTAWCTAGAGATCCCTCAG-MGB

[0280] SEQ ID NO.7 (upstream of pol region): GGTTTATTACAGRGACARCAGA

[0281] SEQ ID NO.8 (downstream of pol region): CYGCYCCTTCACCTTTCCA

[0282] SEQ ID NO.9 (pol region probe): TGGAAAGGACCAGC-MGB

[0283] SEQ ID NO.10 (upstream of gag region): GCGGAGGCTAGAAGGAGA

[0284] SEQ ID NO.11 (downstream of gag region): CYCTGCTTGCCCATACTA

[0285] SEQ ID NO.12 (gag region probe): ATGGGTGCGAGAGCGTC-MGB

[0286] SEQ ID NO.13 (upstream internal reference): GTTAGTACACGGGAATTTCATG

[0287] SEQ ID NO.14 (downstream of internal reference): CATTATTTTTGCTACAATTCAGTC

[0288] SEQ ID NO.15 (internal reference probe): ATTTCACCGGGAAGTTTCTT-MGB

[0289] SEQ ID NO.16 (internal reference plasmid sequence): CGAATTCTCAAAGGGGTTAGTACACGGGAATTTCA

[0290] TGAAAATTTCACCGGGAAGTTTCTTTTTGATATTTTCACATAAATAGGTACTTATGGAT

[0291] ATATGAATTTGGTCATGACAATATTTGGGGCAGTCGAGACTGAATTGTAGCAAAAAT

[0292] AATGAAGTTCGAGTTTTT

Claims

1. A primer pair and probe combination for amplifying HIV-1 nucleic acid, wherein the primer pair combination is a combination of an LTR region primer pair and a pol region primer pair, wherein: The LTR region primer pair includes an LTR region upstream primer whose sequence is shown in SEQ ID NO.4 and an LTR region downstream primer whose sequence is shown in SEQ ID NO.5; The pol region primer pair includes a pol region upstream primer whose sequence is shown in SEQ ID NO.7 and a pol region downstream primer whose sequence is shown in SEQ ID NO.8; The probe combination is a combination of an LTR region probe and a pol region probe, wherein: The sequence of the LTR region probe is shown in SEQ ID NO.6: The sequence of the pol region probe is shown in SEQ ID NO.

9.

2. A reaction system for detecting HIV-1 nucleic acid, the reaction system comprising the primer pair and probe combination according to claim 1.

3. The reaction system according to claim 2, wherein The reaction system also includes an internal reference primer pair and a probe combination.

4. The reaction system according to claim 3, wherein The internal reference primer pair and probe combination includes: an internal reference upstream primer whose sequence is shown as SEQ ID NO.13, an internal reference downstream primer whose sequence is shown as SEQ ID NO.14, and an internal reference probe whose sequence is shown as SEQ ID NO.

15.

5. Use of the primer pair and probe combination of claim 1 in preparing a detection system for detecting HIV-1.

6. The use according to claim 5, wherein The detection system also includes an internal reference primer pair and a probe combination, which includes: an internal reference upstream primer with a sequence as shown in SEQ ID NO.13, an internal reference downstream primer with a sequence as shown in SEQ ID NO.14, and an internal reference probe with a sequence as shown in SEQ ID NO.

15.

7. The use according to claim 5 or 6, wherein The detection is performed by dual dPCR-based primer amplification and probe hybridization.

8. A method for detecting HIV-1 for non-diagnostic purposes, comprising: 1) Provide HIV-1 nucleic acid samples; 2) Using the HIV-1 nucleic acid sample as a template, using the primer pair and probe combination of claim 1 to amplify and detect HIV-1 nucleic acid.

9. The method according to claim 8, wherein: The detection also includes the use of an internal reference primer pair and probe combination.

10. The method according to claim 9, wherein: The internal reference primer pair and probe combination includes: an internal reference upstream primer whose sequence is shown as SEQ ID NO.13, an internal reference downstream primer whose sequence is shown as SEQ ID NO.14, and an internal reference probe whose sequence is shown as SEQ ID NO.

15.

11. The method according to any one of claims 8 to 10, wherein: The amplification was performed by duplex dPCR.

12. The method according to any one of claims 8 to 10, wherein: The concentration of each primer was 0.2 μM-0.6 μM, and the concentration of the probe was 0.1 μM-0.3 μM.

13. The method according to claim 12, wherein: The concentration of each primer was 0.4 μM-0.45 μM.

14. The method according to claim 12, wherein: The concentration of the probe is 0.2 μM-0.225 μM.

15. The method according to any one of claims 8 to 10, wherein: The annealing temperature of the amplification reaction is 50° C.-56° C., the annealing extension time is 30 seconds, and the number of cycles is 45 times.

16. The method according to claim 15, wherein: The annealing temperature of the amplification reaction was 52°C.

17. A kit for detecting HIV-1, comprising: a) the primer pair and probe combination of claim 1; as well as b) instructions for use indicating how to use the kit.

18. The kit according to claim 17, wherein The kit also includes an internal reference primer pair and a probe combination.

19. The kit according to claim 18, wherein The internal reference primer pair and probe combination includes: an internal reference upstream primer whose sequence is shown as SEQ ID NO.13, an internal reference downstream primer whose sequence is shown as SEQ ID NO.14, and an internal reference probe whose sequence is shown as SEQ ID NO.15.

Images