A method for detecting porcine Japanese encephalitis virus based on CRISPR-Cas13d system

Abstract

The present invention discloses a method for detecting porcine Japanese encephalitis virus based on CRISPR-Cas13d system, and belongs to the field of molecular biological diagnosis technology. The method of the present invention can successfully detect clinical positive JEV samples, and can perform on-site visual detection of JEV in combination with RNA fluorescent reporter molecules, and only uses a blue light transmission instrument for irradiation, and observes whether the amplified product of the reaction system presents fluorescence to determine the test result, or uses a qPCR instrument to perform quantitative detection on it, and the result can be determined within 1h. The primers and crRNA of the present invention are highly specific, highly sensitive, and simple to operate, fast to detect, and visualized results, so that the method for detecting JEV based on RAA and CRISPR-Cas13d technology established by the present invention can be used for on-site visual detection of JEV, so as to improve the level of JEV detection in the pig farming industry and reduce the biosafety risk of farms. Provide technical means.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological diagnosis, and in particular relates to a method for detecting porcine Japanese encephalitis virus based on a CRISPR-Cas13d system. Background Art

[0002] Japanese encephalitis virus (JEV) is a single-stranded positive-sense RNA virus belonging to the genus Flavivirus of the family Flaviviridae. It is the main pathogen causing Japanese encephalitis (JE), posing a serious threat to human and livestock health, and manifesting as a typical zoonosis. Since it was first identified in Japan in 1924, JEV has spread rapidly to other parts of Asia and has become a major public health problem. Although effective vaccines have been promoted in many countries, Japanese encephalitis remains a persistent challenge for many countries in Asia. In order to reduce the harm of the virus to humans and livestock, public health strategies emphasize the importance of mosquito control, vaccination, and public health education. Currently, the commonly used detection methods for JEV, such as PCR, qPCR, and ELISA, have their own limitations in terms of time cost, economic cost, sensitivity, and specificity. In comparison, CRISPR / Cas13d technology, as an emerging detection technology, has shown the advantages of high specificity and high sensitivity, especially in the field of molecular biology detection. By utilizing specially designed crRNA, the Cas13d protein can specifically recognize and cut the single-stranded RNA target sequence. In the detection application, the added fluorescently labeled reporter RNA makes the quantitative detection of RNA fast and accurate. In addition, our research also combines RAA technology with CRISPR-Cas13d technology to develop a new method for high-sensitivity, low-complexity visual detection of JEV clinical samples. This innovative detection kit is not only simple to operate and sensitive, but also can significantly improve the pig farming industry's ability to detect viral diseases such as PEDV and reduce biosafety risks. Summary of the invention

[0003] The present invention provides a crRNA molecule for detecting porcine Japanese encephalitis virus based on the CRISPR-Cas13d system, and the sequence of the crRNA molecule is shown in SEQ ID NO.3.

[0004] The present invention also provides a reagent for detecting porcine Japanese encephalitis virus based on the CRISPR-Cas13d system, wherein the reagent contains the above-mentioned crRNA molecule.

[0005] The present invention also provides a kit for detecting porcine Japanese encephalitis virus based on the CRISPR-Cas13d system, wherein the kit contains the above-mentioned crRNA molecule or the above-mentioned reagent.

[0006] Preferably, the kit also contains Cas13d protein, a fluorescent RNA reporter probe, and an upstream primer SEQ ID NO.7 and a downstream primer SEQ ID NO.10 for recombinase polymerase nucleic acid amplification.

[0007] More preferably, the fluorescent RNA reporter probe is 5′-FAM-UUU UUU-BHQ1-3′.

[0008] The present invention also provides the use of the above-mentioned crRNA molecule or the above-mentioned reagent in preparing a porcine Japanese encephalitis virus detection product.

[0009] Preferably, the product is a kit.

[0010] More preferably, the kit contains Cas13d protein, a fluorescent RNA reporter probe, and an upstream primer SEQ ID NO.7 and a downstream primer SEQ ID NO.10 for recombinase polymerase nucleic acid amplification.

[0011] More preferably, the method for using the kit is as follows:

[0012] (1) The sample DNA is used as a template to amplify the product, which is then transcribed into ssRNA in vitro;

[0013] (2) reacting the ssRNA, Cas13d protein, fluorescent RNA reporter probe, and crRNA molecule obtained in step (1) in a CRISPR-Cas13d reaction system;

[0014] (3) After the reaction in step (2) is completed, the reaction system is placed under blue light / ultraviolet light to observe the test results.

[0015] More preferably, the amplification in step (1) adopts a recombinase polymerase nucleic acid amplification method.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a method for on-site visualization of detecting JEV based on RAA and CRISPR-Cas13d technology. Clinically positive JEV samples can be successfully detected by the method of the present invention. In combination with RNA fluorescent reporter molecules, JEV can be detected on-site by visualization. Only a blue light transmission instrument is used for irradiation, and the detection result can be determined by observing whether the amplified product of the reaction system presents fluorescence, or a qPCR instrument is used for quantitative detection, and the result can be determined within 1 hour. It does not require expensive equipment and reduces the cost and time of diagnosis. The primers and crRNA of the present invention have strong specificity and good sensitivity, and the invented kit is simple to operate, fast to detect, and visualized results, so that the method for detecting JEV based on RAA and CRISPR-Cas13d technology established by the present invention can be used for on-site visualization detection of JEV, thereby providing technical means for improving the level of JEV detection in the pig farming industry and reducing the biosafety risk of farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The pET28a-MH6-EsCas13d plasmid identification result in Example 1, wherein M is the marker lane; 1 is the colony PCR amplification product lane; and 2 is the negative control lane.

[0019] Figure 2 The pET28a-MH6-EsCas13d plasmid transformation identification results in Example 1, wherein M is the marker lane; 1 is the bacterial liquid PCR amplification product lane; and 2 is the negative control lane.

[0020] Figure 3 The SDS-PAGE experimental results of CRISPR-Cas13d protein expression and purification in Example 1 are from left to right using 2 tubes of 50% elution buffer and 8 tubes of 75% elution buffer.

[0021] Figure 4 It is the Western-blot experimental result for the His tag of CRISPR-Cas13d protein in Example 1, wherein M is the protein Marker lane, 1 is the negative control lane, and 2 is the purified protein lane.

[0022] Figure 5 The target gene amplification results of the positive plasmid constructed in Example 1, wherein M is the marker lane, 1 is the negative control lane, and 2 is the PCR product lane.

[0023] Figure 6The results of gel electrophoresis analysis of the amplification products of different RAA primer combinations in Example 1, wherein M is the marker lane, and 1-10 are the RAA amplification product lanes of RAA primers F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, F2 / R3, F3 / R1, F3 / R2, F3 / R3 and the negative control, respectively.

[0024] Figure 7 It is a fluorescence amplification graph for verification of crRNA and Cas13d protein activity in Example 1; the red curve (the highest fluorescence value is about 109500) is crRNA-1, the green curve (the highest fluorescence value is about 107000) is crRNA-2, the orange curve (the highest fluorescence value is about 95000) is crRNA-3, and the blue curve (no change in fluorescence value) is the negative control.

[0025] Figure 8 This is a specific fluorescence amplification diagram of the combination of RAA and CRISPR-Cas13d in Example 1; the red curve (with a maximum fluorescence value of 65,000) is the amplification result of the JEV-positive plasmid sample.

[0026] Fig. 9 This is the sensitivity fluorescence amplification diagram of combining RAA and CRISPR-Cas13d in Example 1, where the dark red curve (with the highest fluorescence value of 108000) indicates that the template copy number is 10 8 ; Sky blue curve (highest fluorescence value is 102000) template copy number is 10 7 ; Orange curve (maximum fluorescence value is about 99000) template copy number is 10 6 Gray curve (maximum fluorescence value is about 91000) template copy number is 10 5 ; Yellow curve (maximum fluorescence value is about 90000) template copy number is 10 4 ; Pink curve (maximum fluorescence value is about 85000) template copy number is 10 3 ; Black curve (maximum fluorescence value is about 80,000) template copy number is 10 2 ; Green curve (maximum fluorescence value is about 77000) template copy number is 10 1 ; Light blue curve (maximum fluorescence value is about 68000) template copy number is 10 0 ; The blue curve (fluorescence value did not change) is the negative control.

[0027] Fig.10 This is the naked eye fluorescence of the product under blue light / ultraviolet light conditions after the sensitive reaction combining RAA and CRISPR-Cas13d in Example 1. DETAILED DESCRIPTION Example 1

[0028] 1. Expression, purification and concentration of EsCas13d protein

[0029] 1.1 Transformation of exogenous plasmid into cloning strains

[0030] The purchased plasmid (pET28a-MH6-EsCas13d) powder was operated according to the instructions, and Kana (kanamycin) was selected as the resistance of the culture medium. The protein expressed by the plasmid is about 112.4kDa, and the total length of the plasmid is 8242bp. The fragment of the inserted target protein is 2907bp in size, and it carries 6×His, which is convenient for protein separation and purification.

[0031] The EsCas13d protein plasmid was transformed into Escherichia coli DH5α competent cells (plasmid: competent cell ratio was 1:10), mixed and placed on ice for 25 min, heat-shocked in a 42°C metal bath for 90 s, and ice-bathed for 10 min; 500 uL of warm LB medium was added, incubated in a 37°C metal bath for 10 min, the shaking incubator was adjusted to 37°C, cultured at 70 rpm for 10 min, then cultured at 100 rpm for 25 min, and cultured at 120 rpm until the bacterial solution became turbid. The mixed bacterial solution was evenly spread on the LB culture dish containing Kana resistance using a spreading rod, placed in a 37°C incubator for forward culture for 1.5 hours, and then inverted for culture overnight. A single colony was picked as a DNA template and normal PCR amplification was performed according to the primers provided in the plasmid map in add gene. The reaction conditions were: 95°C for 3min; 95°C for 30 s, 58°C for 40s, 72°C for 35 s, 35 cycles, 72°C for 5 min; primers are shown in Table 1, and the reaction system is shown in Table 2. The PCR amplification product was subjected to gel electrophoresis experiment, and the results are shown in Figure 1 The remaining part of the single colony was picked into LB liquid medium (500uL) containing Kana resistance and cultured in a shaking incubator at 37℃ for 12h. The positively amplified monoclonal strain was stored as glycerol bacteria (bacterial liquid: 50% glycerol = 1:1) and frozen at -80℃ for later use.

[0032] Table 1 EsCas13d plasmid verification primers

[0033] Primers Sequence 5'-3' Cas13d-F SEQ ID NO.1:ATAATCCGCTGCGTCGTT Cas13d-R SEQ ID NO.2: CGGCTGTTGGTGCTTTCT

[0034] Table 2 Colony common PCR reaction system

[0035] Components Volume (uL) Upstream and downstream primers 1 each 2xTaq enzyme Mix 10 Colony (DNA template) About 1ug <![CDATA[ddH 2 The]]> Up to 20

[0036] The experimental results showed that the single colony picked was plasmid positive, as shown in Figure 2 .

[0037] 1.2 Inducible expression of EsCas13a protein

[0038] First, plasmids were extracted from positive E. coli DH5α bacterial suspension using a small plasmid extraction kit, and then these plasmids were transformed into Rosetta competent cells. The transformation steps were the same as before. Next, the overnight culture was inoculated into a freshly prepared 300 ml LB liquid medium containing kanamycin at a ratio of 1:100 (the ratio of kanamycin in the medium was 1000:1), and cultured on a constant temperature shaker at 37°C for 2 to 3 hours until the OD600nm value of the bacterial solution reached about 0.6. After reaching the target OD value, isopropylthiogalactoside (IPTG) was added to the culture medium at a final concentration of 500 μM to induce protein expression, and the temperature was adjusted to 18°C ​​and the shaking culture was continued at 180 rpm for 18 hours. This low-temperature culture helps to improve the solubility and folding efficiency of the target protein. After the culture is completed, the collected bacterial solution will be used for subsequent protein purification and processing steps. This process not only optimizes the expression conditions of the protein, but also lays the foundation for subsequent experimental steps.

[0039] 1.3 Purification of EsCas13d protein

[0040] The purification process of EsCas13d protein includes the following key steps: First, the overnight cultured EsCas13d expression bacterial solution is transferred to a 50ml centrifuge tube and centrifuged at 5000rpm for 15 minutes at 4°C to precipitate the cells, and then the bacteria are resuspended with 10ml PBS. The resuspension is poured into a new 50ml centrifuge tube again, and the centrifugation process is repeated until the bacterial solution is completely concentrated. The concentrated bacteria are resuspended to 20ml with PBS, lysozyme and protease inhibitor PMSF are added at a ratio of 1:100 and mixed, and then ultrasonically disrupted using a ф6 probe at 30% power, ultrasonically disrupted for 2 seconds, 4 seconds at intervals, and a total duration of 40 minutes. The disrupted bacterial solution is centrifuged at 5000rpm for 40 minutes at 4°C, the supernatant is collected, and filtered through a 0.22μm filter membrane to prepare for protein affinity chromatography. The filtered supernatant was mixed with binding buffer in a 1:1 ratio and affinity chromatography was performed on a nickel column equipped with HisTrap FF crude column. Non-specific adsorbed impurities were removed using 2 column volumes of binding buffer. Subsequently, the target protein was eluted step by step using elution buffer of different concentrations of 25%, 50%, 75% and 100%. Each concentration of elution buffer was configured with 10 ml, and each elution of 1 ml was collected into a 1.5 ml clean EP tube. The protein identification and preservation steps included analyzing the elution effect using SDS-PAGE to determine the optimal elution conditions, and verifying the expression of EsCas13d protein for the His tag by Western-blot. Finally, the column medium was equilibrated with 3 volumes of binding buffer and 1 volume of 20% ethanol, and stored at 4°C to prevent bacterial contamination.

[0041] The results of SDS-PAGE experiments showed that the impurity proteins of Cas13d protein were basically removed in the 9th tube under the 50% concentration of elution buffer, and were basically eluted completely in the 8th tube under the 75% concentration of elution buffer. For specific experimental results, see Figure 3 The eluted protein solution in the 6th tube under the 50% concentration of elution buffer was selected, and the His tag on the protein was verified by Western-blot. The results of Western-blot experiments showed that the prokaryotic expression of Cas13d protein was successful. For specific experimental results, see Figure 4 .

[0042] 1.4 Concentration of CRISPR-Cas13d protein

[0043] First, the protein sample that was confirmed to be essentially free of impurities by SDS-PAGE was transferred to a 30,000 MWCO Millipore ultrafiltration column for concentration. First, precool the centrifuge at 4°C and then centrifuge at 4000 rpm for 15 minutes. After centrifugation, the remaining protein sample was added to the ultrafiltration column, and the loading and centrifugation steps were repeated until the final protein solution was reduced to 500 μL. Subsequently, PBS solution was added to the ultrafiltration column to 1000 μL, and this addition step was repeated three times to ensure that the liquid in the ultrafiltration tube was completely replaced by PBS until the volume of the protein solution was reduced to approximately 200 μL. After that, the concentrated protein solution was transferred to a clean EP tube and stored at -80°C for freezing. Finally, the concentrated and stored protein sample was identified again by SDS-PAGE to verify the quality and purity of the protein. This step ensures the high concentration and high purity of the protein, which is suitable for subsequent experimental analysis or application.

[0044] 2. Design and synthesis of crRNA

[0045] Since the Cas13d protein does not need to recognize a specific PAM / PFS sequence, the design of crRNA depends only on the inherent hairpin structure sequence and target gene sequence of the Cas13d protein. Specifically, the highly conserved target region in the NS1 gene of porcine Japanese encephalitis virus (JEV) was first determined, and the 3′ end of the region was ensured to be A, U, or C. 28 nucleotides (nt) were selected from this site as the sequence of crRNA. The designed sequence was then compared on the BLAST database of NCBI to confirm its specificity. After the sequence was determined, the synthesis of crRNA was entrusted to Shanghai Sangon Biotech Co., Ltd. After receiving the synthesized crRNA, RNase-free H 2 O to the concentration required for the experiment, and then aliquot and store at -80°C for later use. This design and synthesis method ensures that crRNA has high specificity and efficiency in targeted Cas13d-mediated editing or detection applications.

[0046] Table 3 crRNA sequences

[0047] name Sequence 5'-3' crRNA-1 SEQ ID NO.3: CACCCGUGCAAAAUUGCAGGGGUCUAAAACTGGTGACTTTCGTCCCTGGGCAATAGTC crRNA-2 SEQ ID NO.4: CACCCGUGCAAAAUUGCAGGGGUCUAAAACCCTGGTTTTGTGTCTTATACCCTTCCCT crRNA-3 SEQ ID NO.5: CACCCGUGCAAAAUUGCAGGGGUCUAAAACCAAGACTATGCGATTCTCATCCCAAGGT

[0048] 3. Design and synthesis of fluorescent RNA reporter probes

[0049] The ability of the Cas13d protein and crRNA complex to recognize and cut specific target RNA sequences, while detecting RNA sequences through fluorescent RNA reporter probes in the "incidental cutting" active cutting system. The design of the fluorescent RNA reporter probe is based on the following principle: When Cas13d and crRNA bind and recognize a specific RNA sequence, the nuclease activity of Cas13d is activated. This activity enables Cas13d to cut the target RNA and the fluorescently labeled ssRNA reporter molecules in the system. Specifically, the sequence of the ssRNA fluorescent reporter molecule used is 5′-FAM-UUUUUU-BHQ1-3′, in which a fluorescent group FAM is connected to the 5′ end and a quenching group BHQ1 is connected to the 3′ end. When Cas13d is not activated, the reporter molecule does not emit a fluorescent signal. Once Cas13d and crRNA recognize and cut the target RNA, the trans-cutting activity of Cas13d will also cut the fluorescent RNA probe, thereby removing the quenching and causing FAM to emit a fluorescent signal. This fluorescence change can be detected and analyzed by a dedicated fluorescence detection system. The fluorescent RNA reporter probe was synthesized by Shanghai Sangon Biotech Co., Ltd. and used in experiments to evaluate the efficiency and specificity of Cas13d-mediated RNA targeting activity, thus providing a highly sensitive and specific method for detecting target RNA. This design makes the fluorescent RNA reporter probe a powerful tool for detecting the presence or absence of specific RNA sequences.

[0050] 4. RAA Primer Design and Synthesis

[0051] The JEV-NS1 gene sequence was downloaded from NCBI, and its homologous conserved regions were analyzed using Mega 11.0 software. RAA primer design principles: (1) The primer length is 30-36 nt. Too long will affect the amplification effect. (2) The GC content is 40-60% to avoid the generation of primer dimers and hairpin structures. (3) The product size is between 100-500 bp, with the optimal range being 100-300 bp. (4) The GC content and single nucleotide repeat sequence at the 5′ end of the primer cannot exceed 5. (5) The 3′ end of the primer should be G and C as much as possible to provide a stable "clamp" target. Three pairs of RAA primers were designed using DNAMAN6.0 software. According to the requirements of subsequent experiments, in order to transcribe the RAA amplification product into target ssRNA, a T7 promoter sequence (SEQ ID NO.6: 5'-TAATACGACTCACTATAGGG-3') was added to the upstream 5′ end of the primer. After the design was completed, it was synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0052] Table 4 JEV-NS1 gene RAA primers

[0053] Primers Sequence 5'-3' RAA-JEV-F1 SEQ ID NO.7: taatacgactcactataggggGAACTCATCATTCCGCATACCATAGCCGGAC RAA-JEV-F2 SEQ ID NO.8: taatacgactcactataggggGAGATGGTGTTCAGGAAAGTGAACTCATCAT RAA-JEV-F3 SEQ ID NO.9: taatacgactcactataggggCCATAGCCGGACCAAAACGCAAGCACAATCC RAA-JEV-R1 SEQ ID NO.10: AGTGGTTCTGACCGAACGGCCTCTCTTGCGA RAA-JEV-R2 SEQ ID NO.11:GTAATCAACTTTCCACTGTCAGTAGTGGTTC RAA-JEV-R3 SEQ ID NO.12: GGGCGGAAGGGAGCAACTGCGACAGCAGCAG

[0054] 5. Construction of standard positive plasmid

[0055] RNA was reverse transcribed into cDNA in vitro, and JEV-NS1 gene was used as template. PCR primers F (SEQ ID NO.13): ATGGAGCGATCATAGGCA; R (SEQ ID NO.14): CGGACCAGCAGCCATTTT were selected for amplification using high-fidelity Gflex enzyme, and the amplified fragment size was 456 bp. The reaction system was as follows:

[0056] Table 5 Positive plasmid target gene amplification reaction system

[0057] Components Volume (uL) 2xGflex Buffer 10 Upstream and downstream primers (10 μM) 0.4 each template 0.8 Gflex enzyme 0.4 <![CDATA[ddH 2 The]]> Up to 20

[0058] The PCR reaction procedure was: 94°C for 4 min pre-denaturation, 94°C for 30 s denaturation, 56°C for 30 s annealing, 72°C for 30 s extension, 35 cycles, and 72°C for 2 min extension. After the reaction, 1% agarose gel electrophoresis was performed to detect the amplification results ( Figure 5 ), after confirming that the size of the amplified fragment is correct, use the Kangwei Reagent Agarose Gel DNA Kit to perform gel recovery and purification. The purified samples are stored at -20℃ for future use.

[0059] Take a small amount of purified sample for sequencing, and compare the splicing results in NCBI's BLAST to check whether the results are correct. Since the PCR amplification using Gflex enzyme produces a flat-end DNA fragment without an A tail, it cannot be directly TA cloned. It is necessary to perform a terminal TaqDNA polymerase plus A reaction. The reaction system is as follows:

[0060] Table 6 Positive plasmid target gene plus A reaction system

[0061] Components Volume (uL) Ex-Taq Buffer 2.5 dNTP Mixture 2 PCR products 20.25 Ex-Ta enzyme 0.25 <![CDATA[ddH 2 The]]> Up to 25

[0062] The A-tailing reaction procedure is 72°C in a metal bath for 30 min. After the reaction is completed, the ligation reaction is carried out with the PMD-19T vector. The reaction system is as follows:

[0063] Table 7 Positive plasmid ligation reaction system

[0064] Components Volume (uL) Solution I 5 PMD-19T 1 Add A tail product 4

[0065] The connection reaction procedure is metal bath 16℃, 30 min. After the connection is completed, it is transferred into competent cells DH5α for transformation and amplification. The plasmid is extracted using the plasmid extraction kit of Quanshijin Company. The standard positive plasmid is named PMD-19T-JEV. The extracted plasmid is sent for appropriate sequencing to ensure the successful construction of the recombinant plasmid for subsequent experiments.

[0066] 6. RAA Amplification

[0067] The RAA nucleic acid amplification kit of Jiangsu Qitian Gene Biotechnology Co., Ltd. was used, and the standard positive plasmid PMD-19T-JEV was used as the template. The primers in Table 4 were selected for RAA amplification, and the most suitable pair of primers was screened according to the amplification results. The reaction procedure was 37°C, 20 minutes. After the reaction was completed, 5uL was taken for agarose gel electrophoresis. The results were as follows: Figure 6 The results showed that the RAA primer combination F1 / R1 had the highest amplification efficiency and the least non-specific products, so this RAA primer combination was selected for subsequent experiments.

[0068] Table 8 RAA body reaction system

[0069] Components Volume (uL) Upstream and downstream primers (10 μM) 2.1 each template 2 Buffer 25 Starter 3 <![CDATA[RNase-free dH 2 The]]> Replenish to 50

[0070] 7. T7 in vitro transcription

[0071] The RAA amplified product was transcribed into target ssRNA, transcribed in vitro at 37°C for 5 h, and RNase-free DNase I was used to degrade the excess DNA template, and then purified using a column RNA purification kit (Shanghai Shenggong Biotechnology Co., Ltd.). After purification and concentration determination, the aliquots were stored at -80°C. The in vitro amplification reaction system is shown in Table 8, the DNase in vitro digestion system is shown in Table 9, and the RNA T7 in vitro transcription reaction system is shown in Table 10.

[0072] Table 9 DNaseⅠ digestion system

[0073] Components Volume (uL) DNase I 2 Reaction Buffer 2 Ribonuclease inhibitor 1 RNA ALL <![CDATA[RNase-free ddH 2 The]]> Replenish to 30

[0074] Table 10 T7 in vitro transcription system

[0075] Components Volume (uL) 5X Transcription Buffer 4 NTP Solution (A, C, G, U) 1.5 each Enzyme Mix 1.5 RNase inhibitor 0.5 template 1 μg <![CDATA[RNase-free ddH 2 The]]> Up to 20

[0076] 8. Establishment of a detection method for porcine Japanese encephalitis virus based on CRISPR-Cas13d technology

[0077] 8.1 Activity verification of crRNA and Cas13d protein

[0078] First, the Cas13d protein activity verification system was configured using purchased RNase inhibitors (provided by Sangon) and the standard positive plasmid pMD-19T-JEV. The positive plasmid was diluted as a template and used in the experiment to ensure that the reaction system was prepared correctly. A complete detection system was set up using purified EsCas13d protein and specially designed crRNA, as well as a fluorescent RNA reporter probe of 5′-FAM-UUUUUU-BHQ1-3′. The experiment was divided into two tube reactions: the first step was RAA amplification using RAA primers and pMD-19T-JEV plasmids, and the resulting amplification products were then transcribed into target ssRNAs by T7 in vitro transcription at 37°C for 1 hour. These ssRNAs were then reacted with Cas13d protein, crRNA, and fluorescent RNA reporter probes at 37°C for another 1 hour. In order to deeply analyze the importance of each component, 8 sets of variables were designed, including a complete reaction system and a reaction group that deliberately lacked protein, crRNA, fluorescent RNA reporter probe, and amplification products. These experimental settings are designed to verify the impact of each component on the entire detection system. After the experiment, all samples were placed under a blue light gel imager for observation to detect whether they emitted fluorescent signals.

[0079] Table 11 crRNA and Cas13d protein activity verification system

[0080] Components Dosage Cas13d protein 100nM Protein Reaction Buffer 5uL crRNA 100nM RNA fluorescent reporter probe 5μM RNase inhibitor 2uL ssRNA template 2ul RNase free water Make up to 25uL

[0081] The experimental results showed that crRNA-1 had good reactivity, so crRNA-1 was used to establish the subsequent detection method. The specific experimental results are shown in Figure 7 .

[0082] 8.2 Establishment of a porcine JE virus detection method combining RAA and CRISPR-Cas13d technology and clinical sample testing

[0083] The crRNA (crRNA1) with the strongest fluorescence signal was selected to establish the RAA-based CRISPR-Cas13d detection method. The RAA reaction and Cas13d verification system were combined. The product after the first step RAA reaction was added to the CRISPR-Cas13d reaction system, as shown in Table 12. The qPCR instrument was set at 37°C, the fluorescence value was read every minute, and the cycle was repeated 60 times to verify the specificity and sensitivity, respectively.

[0084] A DNA / RNA co-extraction kit (Tiangen Biochemical Technology Co., Ltd.) was used to extract nucleic acids from JEV-positive samples (tissue samples). The same method was used to extract the genomes of porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), classical swine fever virus (CSFV), Japanese encephalitis virus (JEV), and porcine parvovirus (SVV) (provided by the Biotechnology Center of Sichuan Agricultural University). The specificity of the reaction system was verified with a negative control (without nucleic acid template). The specific results are shown in Figure 8 .

[0085] The positive plasmid pMD-19T-JEV was quantified and diluted 10-fold to prepare a template concentration of 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 The copy number was 10. 0 The number of copies / uL can still be visualized. For specific results, see Fig. 9 .

[0086] After the reaction is completed, the system is placed under blue light / ultraviolet conditions for observation. The experimental results show that the positive experimental results in the qPCR instrument are consistent with the visual observation. For specific experimental results, see Fig. 9 and Fig.10 .

[0087] The experimental results show that the JEV detection system based on RAA and CRISPR-Cas13d technology can complete the detection of clinical JEV samples, and it has clinical sample specificity in 7 different viruses that can cause reproductive disorders. The minimum template detection sensitivity can reach 1 copy number / uL, and visualization can also be achieved.

[0088] Table 12 JEV detection system combining RAA and CRISPR-Cas13d technology

[0089] Components Dosage Cas13d protein 100nM Reaction buffer 4uL crRNA 100nM RNA fluorescent reporter probe 5μM RNase inhibitor 1uL RAA products 4uL NTP Mix 3uL T7 transcriptase 1uL RNase free water Make up to 25uL

[0090] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A kit for detecting porcine Japanese encephalitis virus based on the CRISPR-Cas13d system, characterized in that: The kit contains a crRNA molecule, a Cas13d protein, a fluorescent RNA reporter probe, and an upstream primer SEQ ID NO.7 and a downstream primer SEQ ID NO.10 for recombinase polymerase nucleic acid amplification. The sequence of the crRNA molecule is shown in SEQ ID NO.3; the fluorescent RNA reporter probe is 5′-FAM-UUUUUU-BHQ1-3′.

2. Use of the kit described in claim 1 in the preparation of a product for detecting porcine Japanese encephalitis virus.

3. The use according to claim 2, characterized in that: The method of using the kit is as follows: (1) The sample DNA is used as a template to amplify the product, which is then transcribed into ssRNA in vitro; (2) reacting the ssRNA, Cas13d protein, fluorescent RNA reporter probe and crRNA molecule obtained in step (1) in a CRISPR-Cas13d reaction system; (3) After the reaction in step (2) is completed, the reaction system is placed under blue light / ultraviolet light to observe the test results.

Images