A kit and method for detecting antibodies

Abstract

The present application relates to a kit and method for detecting antibodies, specifically a kit and method for detecting the biological activity of antibodies against TIM‑3, involving the use of modified Jurkat cells as effector cells and Raji cells as target cells.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to a kit and method for detecting antibodies. Background Art

[0002] In recent years, immune checkpoint blockade therapy has become one of the research focuses of tumor immunotherapy. T cell immunoglobulin domain and mucin domain-3 (TIM-3) is a promising inhibitory receptor among many emerging immune checkpoints. TIM-3, also known as HAVCR2, belongs to the TIM family of immunomodulatory proteins and is a class of T cell surface inhibitory molecules that can cause T cell exhaustion during cancer and chronic viral infection. TIM-3 is composed of 281 amino acids and consists of an extracellular region, a single transmembrane domain, and a C-terminal cytoplasmic tail. TIM-3 is selectively expressed on IFN-γ-secreting helper T cells (Th1 and Th17), regulatory T cells (Treg), dendritic cells (DCs), monocytes, mast cells, NK cells, tumor infiltrating lymphocytes (TILs), and is also expressed on tumor cells, such as melanoma, gastric cancer, and B cell lymphoma.

[0003] Current methods for detecting the biological activity of antibodies against TIM-3 have many disadvantages. For example, animal model testing requires a lot of time, money and resources. Testing using primary immune cells is limited in material sources and the experimental process is complicated. The entire experiment usually takes 5-7 days, and the repeatability of the experiment itself is also poor.

[0004] Therefore, there is an urgent need for a convenient, fast and effective detection method to test the biological activity of antibodies against TIM-3. Summary of the invention

[0005] The present application provides a kit and method for detecting the biological activity of an antibody against TIM-3, wherein the modified Jurkat cells and Raji cells used are easy to store and culture. The method is not only easy to use, but also can simplify the experimental process and reduce costs, and has one or more of the following advantages: high sensitivity, high specificity, high accuracy and repeatability.

[0006] In one aspect, the present application provides a kit for detecting the biological activity of an antibody against TIM-3, comprising:

[0007] (a) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation

[0008] Therefore, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises a luciferase; and

[0009] (b) Raji cells.

[0010] In some embodiments, the kit further comprises a culture medium, an assay buffer and / or a reporter gene detection reagent. In some embodiments, the culture medium comprises an initial cell culture medium, a cell growth culture medium and / or a cell freezing culture medium.

[0011] In certain embodiments, the assay buffer comprises RPMI medium with a FBS concentration of 0%-20%.

[0012] In certain embodiments, the assay buffer comprises RPMI medium with a FBS concentration of 20%, 10%, 5%, 2%, 1%, or no FBS.

[0013] In certain embodiments, the assay buffer comprises RPMI medium with a FBS concentration of 1%.

[0014] In certain embodiments, the reporter gene detection reagent comprises fluorescein.

[0015] In certain embodiments, the biological activity against TIM-3 includes the ability of the antibody to block the binding of TIM-3 to its ligand.

[0016] In certain embodiments, the TIM-3 ligand comprises phosphatidylserine (PS).

[0017] On the other hand, the present application provides a method for detecting the biological activity of an antibody against TIM-3, which comprises the following steps:

[0018] a) Co-cultivation:

[0019] (i) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises luciferase; and

[0020] (ii) Raji cells;

[0021] b) adding the antibody to be detected; and

[0022] c) detecting a signal from the reporter gene.

[0023] In certain embodiments, the signal from the reporter gene is detected before, simultaneously with, and / or after the addition of the antibody to be detected.

[0024] In certain embodiments, the method further comprises the step of comparing the signal from before, simultaneously with and / or after the addition of the antibody to be tested to determine the activity of the antibody to be tested.

[0025] In certain embodiments, the method further comprises comparing the signal from the reporter gene to a control.

[0026] In certain embodiments, the control comprises a signal from a reporter gene generated by an antibody known to have biological activity against TIM-3.

[0027] In certain embodiments, the ratio of the co-cultured modified Jurkat cells to the Raji cells is 3:1-1:3.

[0028] In certain embodiments, the ratio of the co-cultured modified Jurkat cells to the Raji cells is 3:1, 2:1, 1:1, 1:2 or 1:3.

[0029] In certain embodiments, the biological activity against TIM-3 includes the ability of the antibody to block the binding of TIM-3 to its ligand.

[0030] In certain embodiments, the TIM-3 ligand comprises phosphatidylserine (PS).

[0031] On the other hand, the present application provides a method for detecting the biological activity of an antibody against TIM-3, which comprises using the kit described in the present application.

[0032] On the other hand, the present application provides a method for identifying an anti-TIM-3 antibody, comprising the following steps:

[0033] a) Co-cultivation:

[0034] (i) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises luciferase; and

[0035] (ii) Raji cells;

[0036] b) adding the antibody to be detected; and

[0037] c) detecting a signal from the reporter gene.

[0038] In certain embodiments, the signal from the reporter gene is detected before, simultaneously with, and / or after the addition of the antibody to be detected.

[0039] In certain embodiments, the method further comprises the step of comparing the signal from before, simultaneously with and / or after the addition of the antibody to be tested to determine the activity of the antibody to be tested.

[0040] In certain embodiments, the method further comprises comparing the signal from the reporter gene to a control.

[0041] In certain embodiments, the control includes a reporter gene signal generated by an antibody known to have the ability to block binding of TIM-3 to its ligand.

[0042] In certain embodiments, the ratio of the co-cultured modified Jurkat cells to the Raji cells is 3:1-1:3.

[0043] In certain embodiments, the ratio of the co-cultured modified Jurkat cells to the Raji cells is 3:1, 2:1, 1:1, 1:2 or 1:3.

[0044] In certain embodiments, the biological activity against TIM-3 includes the ability of the antibody to block the binding of TIM-3 to its ligand.

[0045] In certain embodiments, the TIM-3 ligand comprises phosphatidylserine (PS).

[0046] On the other hand, the present application provides a method for identifying a TIM-3 antibody, comprising the kit described in the present application.

[0047] On the other hand, the present application provides a use of the kit described in the present application in preparing a product for detecting the biological activity of an antibody against TIM-3.

[0048] On the other hand, the present application provides a use of the kit described in the present application in preparing a product for identifying anti-TIM-3 antibodies.

[0049] In another aspect, the present application provides a cell composition comprising

[0050] a) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprising a NFAT promoter, the reporter gene comprising luciferase; and

[0051] b) Raji cells.

[0052] On the other hand, the present application provides a use of the cell composition described in the present application in detecting the biological activity of antibodies against TIM-3.

[0053] On the other hand, the present application provides a use of the cell composition described in the present application in identifying anti-TIM-3 antibodies.

[0054] Those skilled in the art can easily perceive other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of the present application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which the present application relates. Accordingly, the description in the drawings and specification of the present application is merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The specific features of the invention involved in this application are shown in the attached claims. The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0056] Figure 1 Shown is a schematic diagram of the Tim-3 expression cassette used to construct the modified Jurkat cells described in this application.

[0057] Figure 2 Shown are the results of FACS detection of TIM-3 positivity in the modified Jurkat cells described in the present application.

[0058] Figure 3 Shown are the FACS detection results of the modified Jurkat cell monoclone described in the present application.

[0059] Figure 4 Shown are the results of the comparison of the effects of the modified Jurkat cells described in the present application on different target cells.

[0060] Figure 5 Shown are the comparative results of the effects of the modified Jurkat cells and Raji cells described in the present application under different effector-target ratios.

[0061] Figure 6 Shown are the results of the comparison of the effects of the modified Jurkat cells and Raji cells described in the present application under different FBS concentration conditions.

[0062] Figure 7Shown are the results of using Sabatolimab to verify the feasibility of the detection method described in the present application, from top to bottom are the detection results of the cell population of the modified Jurkat cells described in the present application, the modified Jurkat cell monoclone sc1-A2 described in the present application, and the modified Jurkat cell monoclone sc1-A3 described in the present application. DETAILED DESCRIPTION

[0063] The following is an explanation of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0064] Definition of terms

[0065] In the present application, the term "TIM-3 (T cell immunoglobulin domain and mucin domain-3)" is also referred to as T lymphocyte immunoglobulin mucin 3, Tim-3, TIM3, HAVCR2, KIM-3, TIMD3 and FLJ14428, and generally refers to a T helper cell type 1 specific cell surface protein and / or a gene encoding it. The nucleotide and protein sequences of TIM-3 of many species are known, for example, the amino acid sequence of human TIM-3 (hTIM-3) can be found under Uniprot accession number Q8TDQ0. The ligands of TIM-3 may include galectin-9 (Gal-9), carcinoembryonic antigen cell adhesion molecule-1 (CEACAM-1), high mobility group protein B1 (HMGB1) and phosphatidylserine (PS). In the present application, the term "TIM-3" also includes variants, isoforms, species homologs, and analogs having at least one common epitope with TIM3. In the present application, the term "TIM-3" may also include a fragment of TIM-3, for example, an extracellular domain, a transmembrane domain and / or a cytoplasmic tail of TIM-3. For example, human TIM-3 may include an extracellular domain of human TIM-3, the extracellular domain comprising approximately amino acids 22 to 202 of human TIM-3.

[0066] In the present application, the term "antibody" is used in the broadest sense, specifically covering human, non-human (e.g., mouse) and humanized monoclonal antibodies (including, full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies and antibody fragments, as long as they display the desired biological activity. Antibodies can exist as complete immunoglobulins or as various forms of modifications, including, for example, Fab, Fab', F(ab')2, scFv, nanobodies, CDR-transplanted antibodies or full-length antibodies containing two full-length heavy chains and two full-length light chains, etc. The antibody can be of animal (particularly mouse or rat) or human origin or can be chimeric or humanized. As used herein, the term "antibody" includes these various forms.

[0067] In the present application, the term "anti-TIM-3 antibody" or "antibody comprising an antigen binding site that binds to TIM-3" generally refers to an antibody that can bind to TIM-3 with sufficient affinity, especially a TIM-3 polypeptide expressed on the surface of a cell. For example, the anti-TIM-3 antibody can be used as an antibody for a diagnostic and / or therapeutic agent targeting TIM-3. In one embodiment, the degree of binding of the anti-TIM-3 antibody to an unrelated, non-TIM-3 protein is less than about 10% of the binding of the antibody to TIM-3, and the binding can be measured by methods known in the art, such as by radioimmunoassay (RIA), flow cytometry (FACS), surface plasmon resonance assay, using a biosensor system, etc. In certain embodiments, the binding affinity of the anti-TIM-3 antibody for human TIM-3 is ≤1 μM, ≤100nM, ≤10nM, ≤1nM, ≤0.1nM, ≤0.01nM, or ≤0.001nM (e.g., 10 -8 M or lower, e.g. 10 -7 M to 10 -13 M, for example 10 -9 M to 10 -13 M). For example, the corresponding KD value of the binding affinity can be determined using the extracellular domain (ECD) of human TIM-3 in a surface plasmon resonance assay. The term "anti-TIM-3 antibody" also encompasses bispecific antibodies capable of binding to TIM-3 and a second antigen. In certain embodiments, the anti-TIM-3 antibodies described herein include TIM-3 blocking antibodies. "Blocking" antibodies or "antagonistic" antibodies inhibit or reduce the biological activity of the antigen to which it binds. In some embodiments, blocking antibodies or antagonistic antibodies substantially or completely inhibit the biological activity of the antigen. For example, TIM-3 blocking antibodies block signal transduction via TIM-3 to restore the functional response of T cells to antigen stimulation (e.g., proliferation, cytokine production, target cell killing, etc.).

[0068] In the present application, the term "biological activity against TIM-3" generally refers to the interaction with TIM-3, and further to the specific biological effects caused by the interaction with TIM-3 in the biological system. For example, the biological activity against TIM-3 may include the ability to bind to TIM-3, the ability to inhibit the binding of TIM-3 to its ligand, the ability to regulate the expression of TIM-3, the effect on T cell activity, the ability to regulate cytokines produced by T cells and other immune cells, the effect on tumor growth and metastasis, and / or the regulation of immune cell infiltration and activity. For example, the biological activity against TIM-3 may include the ability to inhibit the binding of TIM-3 to phosphatidylserine (PS).

[0069] As used in this application, the expression "cell" may include a single cell, a cell line and / or a cell culture. A cell may include the offspring of a single cell. Due to natural, accidental or intentional mutations, the offspring may not necessarily be identical (morphologically or genomically) to the original parent cell.

[0070] In the present application, "Jurkat cells" are terms understood by those skilled in the art, meaning human leukemia T lymphocytes, which are derived from the peripheral blood of a 14-year-old boy. For example, Jurkat cells can be taken from the American Type Culture Collection (ATCC; ATCC TIB-152). In the present application, "modified Jurkat cells" generally refer to Jurkat cells after genetic engineering of wild-type Jurkat cell lines. For example, modified Jurkat cells can express TIM-3, TCR, and a reporter gene operably connected to a promoter in response to T cell activation. Modified Jurkat cells can include single cells, cell lines and / or cell cultures, and modified Jurkat cells can also include progeny of cells. There may be differences in morphology or genome between single modified Jurkat cells, or between parent modified Jurkat cells and progeny cells, but as long as they can express TIM-3 and have a reporter gene operably connected to a promoter in response to T cell activation, they are included in the scope of the present application.

[0071] In the present application, "Raji cells" is a term understood by those skilled in the art, meaning human Burkitt's lymphoma cells, which are derived from Burkitt's lymphoma in the left maxilla of an 11-year-old black boy. For example, Raji cells can be obtained from the American Type Culture Collection (ATCC; ATCC CCL-86). Unless otherwise specified, the Raji cells described in the present application generally refer to wild-type Raji cells.

[0072] The genetic engineering described in this application generally refers to changing the genome by artificial intervention, which may include the expression of exogenous genes, editing, deleting or downregulating existing genes, etc.

[0073] In the present application, the term "kit" generally refers to a combination of reagents and other materials. For example, the reagents may include modified Jurkat cells and / or Raji cells described in the present application. The kit is expected to include reagents such as buffers, protein stabilizing reagents, signal generating systems (e.g., fluorescent signal generating systems), control samples, and test containers (e.g., microtiter plates, etc.). The term "kit" is not intended to be limited to a specific combination of reagents and / or other materials. For example, the kit also includes instructions for using the reagents. The kit can be packaged in any suitable manner, typically having components in a single container or (if necessary) in multiple containers and a sheet of instructions for testing. For example, the kit may also include positive and / or negative control samples. The kit may be prepared by a variety of methods known in the art. For example, the positive control may include an antibody known to have biological activity against TIM-3, and the negative control may include an antibody known not to have biological activity against TIM-3.

[0074] In the present application, the term "T cell receptor" or "TCR" generally refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigens. TCR can be responsible for recognizing antigens that are bound to major histocompatibility complex molecules. TCR can be composed of heterodimers of alpha (α) and beta (β) chains, or composed of gamma and delta (γ / δ) chains. TCR can exist in α / β and γ / δ forms, which are structurally similar, but have unique anatomical locations and functions. For example, TCR can be a modified TCR on any cell that includes TCR.

[0075] In the present application, the term "promoter responsive to T cell activation" generally refers to a promoter that can be regulated by T cell activation signals and initiate gene transcription in the process, which generally contains transcription factor binding sites associated with T cell activation, such as NF-κB, AP-1, and NFAT, etc. In the present application, the term "activated T cell (NFAT) promoter" generally refers to a promoter that contains an NFAT binding site and is regulated by NFAT signals.

[0076] In the present application, "nuclear factor of activated T cells promoter" or "NFAT promoter" generally refers to a sequence comprising one or more NFAT binding elements, consisting essentially of one or more NFAT binding elements, or consisting of one or more NFAT binding elements. The nucleotide sequence of the NFAT binding element may be as shown in SEQ ID NO: 4 (GGAGGAAAAACTGTTTCATACAGAAGGCGT). For example, the NFAT promoter includes a promoter having 3 or more NFAT binding elements. NFAT (Nuclear factor of activated T-cells, nuclear factor of activated T cells) generally refers to a family of transcription factors that are expressed in a variety of cell types, including T cells, B cells, NK cells, etc., and are involved in regulating important physiological processes such as activation, differentiation and self-tolerance of immune cells. The binding of the NFAT promoter to the NFAT transcription factor (e.g., NFATc1, NFATc2, NFATc3, NFATc4 or NFAT5) can increase or promote the transcription of downstream sequences (e.g., reporter genes). For example, the NFAT promoter can initiate the expression of downstream genes when T cells are activated.

[0077] In this application, the term "operably linked" generally refers to the arrangement of two or more nucleic acid sequence elements that are physically linked and have a functional relationship with each other. In this application, operably linked can refer to the arrangement of a coding sequence and a transcription control element, which can include a promoter. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.

[0078] In this application, the term "reporter gene" generally refers to a gene that encodes a detectable product. The expression product that the reporter gene can produce can be easily detected or measured directly or indirectly by conventional assays. In this application, the reporter gene is operably linked to the promoter, so that the expression of the reporter gene shows the activation of the promoter. The reporter gene described in this application can include a luciferase, which emits light as a byproduct of substrate catalysis, and the light can be measured experimentally. For example, the luciferase can include firefly luciferase, beetle luciferase, NanoLuciferase, etc. TM Luciferase, Renilla luciferase, bacterial luciferase, etc. are enzymes that can catalyze a specific substrate and emit fluorescence. For example, the luciferase can include a luciferase from the species Photinus pyralis.

[0079] In the present application, the term "reporter gene detection reagent" generally refers to a reagent for directly or indirectly detecting the expression of a reporter gene. For example, when the reporter gene is luciferase, the reporter gene detection reagent may include a luciferin substrate. The luciferin substrate emits a fluorescent signal when reacting with the luciferase, and its intensity is proportional to the expression amount of the reporter gene. Therefore, by measuring the intensity of the fluorescent signal of luciferin, the expression level of the reporter gene can be indirectly assessed.

[0080] In the present application, the term "assay buffer" generally refers to a reagent that provides suitable detection conditions. For example, the assay buffer can be used to maintain the activity of the cells and / or maintain the activity of the sample to be tested. For example, the assay buffer can provide a suitable pH to ensure that the reagent system achieves the best reaction effect under specific pH conditions. For example, the assay buffer can also contain an appropriate ion concentration to maintain the stability of the reagent system and can provide the required ionic strength and ion type.

[0081] In this application, the term "and / or" is generally used as a specific disclosure of each of two specified features or components, either alone or together. Thus, the term "and / or" used in phrases such as "A and / or B" herein is generally intended to include "A and B", "A or B", "A" (alone) and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is generally intended to include each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone) and C (alone).

[0082] In this application, the terms "include", "comprising", "containing" or "including" are interpreted as specifying the presence of the features, integers, steps or components, but do not exclude the presence or addition of one or more other features, integers, steps or components or groups thereof. When used herein, "comprising" is synonymous with "including", "containing", "having" or "characterized by", or sometimes when used herein, it can be replaced by the term "having".

[0083] In this application, the term "about" generally refers to a variation within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0084] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. DETAILED DESCRIPTION OF THE INVENTION

[0086] The kit, detection method and identification method described in the present application, its basic principle is that when the modified Jurkat cells and Raji cells are co-cultured, the modified Jurkat cells are used as effector cells (Effector cell), and Raji cells are used as target cells (Target cell), and the target cells provide low-level stimulation to the effector cells through TCR, and TIM-3 binds to the target cell surface ligand at the same time. The joint stimulation of TCR and TIM-3 induces promoter-mediated reporter gene luciferase activation and luminescence, and the substance with biological activity for TIM-3 can prevent TIM-3 signal transduction and reduce promoter-mediated luciferase activity, and the activity of luciferase can be detected by fluorescent signal, so that the biological activity of antibody for TIM-3 can be detected by quantitative analysis of fluorescent signal.

[0087] The use of the modified Jurkat cells and Raji cells described in the present application to evaluate the biological activity of candidate substances against TIM-3 is not only easy to use, but also can simplify the experimental process and reduce costs compared to other methods, and has one or more of the following advantages: high sensitivity, high specificity, high accuracy and repeatability.

[0088] Modified Jurkat cells and cell compositions

[0089] On the one hand, the present application provides a modified Jurkat cell and its use, wherein the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor and a reporter gene operably linked to a promoter responsive to T cell activation.

[0090] In certain embodiments, the modified Jurkat cells are capable of expressing TIM-3 and / or fragments thereof. For example, the TIM-3 and / or fragments thereof are capable of being expressed on the cell membrane of the modified Jurkat cells. For example, the TIM-3 may be human TIM-3 (hTIM-3). For example, the gene encoding human TIM-3 (hTIM-3) and / or fragments thereof may comprise the nucleotide sequence shown in SEQ ID NO: 1.

[0091] In certain embodiments, obtaining the modified Jurkat cells may include inserting a gene sequence encoding TIM-3 and / or its fragments into the genome of the Jurkat cells, so that the cells can stably express TIM-3 and / or its fragments. The gene sequence encoding TIM-3 and / or its fragments may also include elements required for gene expression of TIM-3 and / or its fragments, such as promoters and terminators. Methods for inserting the gene sequence are known in the art, such as by a lentiviral packaging vector system.

[0092] In certain embodiments, the engineered cells are capable of expressing a reporter gene operably linked to a promoter that is responsive to T cell activation.

[0093] In some embodiments, the promoter corresponding to T cell activation may include NFAT promoter, and the reporter gene may include luciferase. For example, the luciferase may include firefly luciferase, beetle luciferase, NanoLuciferase, TM Luciferase, Renilla luciferase, bacterial luciferase, etc. are enzymes that can catalyze a specific substrate and emit fluorescence. For example, the luciferase can include a luciferase from the species Photinus pyralis.

[0094] In certain embodiments, obtaining the modified Jurkat cells may include the step of inserting a gene sequence comprising a promoter sequence responsive to T cell activation and a reporter gene operably linked thereto into the genome of the Jurkat cells. The gene sequence comprising a promoter sequence responsive to T cell activation and a reporter gene operably linked thereto may also include elements required for expression of the reporter gene, such as a terminator, etc. Methods for inserting the gene sequence are known in the art, such as by a lentiviral packaging vector system, etc.

[0095] In certain embodiments, obtaining the modified Jurkat cells described herein may include the step of inserting a gene sequence encoding TIM-3 and / or a fragment thereof into the genome of the cell, and the step of inserting a gene sequence encoding a reporter gene operably linked to a promoter sequence responsive to T cell activation into the genome of the cell.

[0096] On the other hand, the present application provides a method of using the modified Jurkat cells described in the present application, such as detecting the biological activity of antibodies against TIM-3, identifying anti-TIM-3 antibodies, preparing products for detecting the biological activity of antibodies against TIM-3, and / or preparing products for identifying anti-TIM-3 antibodies. On the other hand, the present application provides a method of using the modified Jurkat cells described in the present application, such as detecting the biological activity of antibodies against TIM-3, identifying anti-TIM-3 antibodies, preparing products for detecting the biological activity of antibodies against TIM-3, and / or preparing products for identifying anti-TIM-3 antibodies.

[0097] On the other hand, the present application provides a cell composition of the modified Jurkat cells and Raji cells described in the present application and uses thereof.

[0098] In certain embodiments, the modified Jurkat cells display TIM-3 on their surface and comprise a TCR and a reporter gene operably linked to a promoter responsive to T cell activation; and the Raji cells are wild-type Raji cells.

[0099] In certain embodiments, Raji cells (i.e., "target cells") have the potential to activate the modified Jurkat cells (i.e., "effector cells"), thereby causing the expression of a reporter gene operably linked to a promoter responsive to T cell activation, but in the presence of an antibody with biological activity against TIM-3, the activation ability of Raji cells to the modified Jurkat cells and the expression of reporter genes are suppressed. In certain embodiments, the biological activity against TIM-3 is inversely proportional to the expression of the reporter gene.

[0100] In certain embodiments, in the cell composition, the modified Jurkat cells and Raji cells can be provided in different containers, respectively.

[0101] On the other hand, the present application provides a cell composition of modified Jurkat cells and Raji cells described in the present application for detecting the biological activity of antibodies against TIM-3, identifying anti-TIM-3 antibodies, preparing products for detecting the biological activity of antibodies against TIM-3, and / or preparing products for identifying anti-TIM-3 antibodies. On the other hand, the present application provides a method for using the cell composition of modified Jurkat cells and Raji cells described in the present application, such as detecting the biological activity of antibodies against TIM-3, identifying anti-TIM-3 antibodies, preparing products for detecting the biological activity of antibodies against TIM-3, and / or preparing products for identifying anti-TIM-3 antibodies.

[0102] Reagent test kit

[0103] On the other hand, the present application provides a kit comprising:

[0104] (a) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface, and comprises a T cell receptor (TCR) and a reporter gene operably linked to an inducible promoter, the inducible promoter comprises a NFAT promoter, and the reporter gene comprises luciferase; and

[0105] (b) Raji cells.

[0106] In the kit described in the present application, the modified Jurkat cells and Raji cells can be provided in a suitable manner. For example, the cells can be provided in a frozen or frozen state, and the cells can be thawed, propagated, and banked for long-term use, and the user can thaw the required number of cells according to experimental needs. For example, the modified Jurkat cells and Raji cells in the kit are provided in different containers in a frozen or frozen state.

[0107] In some embodiments, in addition to the modified Jurkat cells and Raji cells, the kit may also include accessories (e.g., containers, plates, etc.), instructions, other reagents (e.g., buffer, controls, culture media, reporter gene detection reagents, etc.), etc. For convenience or other considerations, the components in the kit may be packaged together or separately in separate containers. In some embodiments, the user provides one or more components required for the detection or identification described herein using the components of the kit (e.g., culture media, test samples, reporter gene detection reagents, etc.).

[0108] In certain embodiments, the kit further comprises culture medium, assay buffer and / or reporter gene detection reagent.

[0109] The culture medium may include an initial cell culture medium, a cell growth medium, and / or a cell freezing medium. It is known in the art that a suitable culture medium formula can be selected according to the type of cell. The initial culture medium is used in the recovery phase after cell thawing, and usually contains nutrients, growth factors, vitamins, minerals, and serum or serum-free additives required to support cell survival and resume growth. Its formula is intended to reduce cell stress that may occur during the thawing process to help cells smoothly transition from a frozen state to a growth state. Cell growth medium is used in the cell expansion phase, and usually contains nutrients that promote cell division, such as amino acids, vitamins, inorganic salts, glucose, and serum or serum substitutes that are often added to support long-term growth of cells and maintain their phenotypic characteristics. Cell freezing medium is designed to freeze cells under low temperature conditions and usually contains cryoprotectants, such as dimethyl sulfoxide (DMSO), glycerol, or propylene glycol, which can prevent cells from forming ice crystals during the freezing process, thereby reducing the risk of cell damage.

[0110] The assay buffer may include any reagent for providing suitable detection conditions. For example, the assay buffer may include a buffer for maintaining the activity and / or physiological state of the modified Jurkat cells and / or Raji cells and / or maintaining the activity of the sample to be tested. For example, the assay buffer may include a buffer for providing a suitable pH. For example, the assay buffer may include an RPMI culture medium with an FBS concentration of 0%-20%. For example, the assay buffer may include an RPMI culture medium with an FBS concentration of 20%, 10%, 5%, 2%, 1% or without FBS. For example, the assay buffer includes an RPMI culture medium with an FBS concentration of 1%.

[0111] When the reporter gene is luciferase, the reporter gene detection reagent can include a luciferase substrate. Luciferase substrates corresponding to different luciferases are known in the art. For example, when the reporter gene is firefly luciferase, the luciferase substrate is luciferin (D-Luciferin). For example, when the reporter gene is Renilla luciferase, the luciferase substrate is coelenterazine (Coelenterazine). For example, when the reporter gene is NanoLuc TM When luciferase is used, the luciferase substrate is furimazine. In addition, the reporter gene detection reagent may also include other reagents for detecting reporter gene signals, such as cell lysate.

[0112] On the other hand, the present application provides a kit described in the present application for detecting the biological activity of an antibody against TIM-3, identifying an anti-TIM-3 antibody, preparing a product for detecting the biological activity of an antibody against TIM-3, and / or preparing a product for identifying an anti-TIM-3 antibody. On the other hand, the present application provides a method for using the kit described in the present application, such as detecting the biological activity of an antibody against TIM-3, identifying an anti-TIM-3 antibody, preparing a product for detecting the biological activity of an antibody against TIM-3, and / or preparing a product for identifying an anti-TIM-3 antibody.

[0113] method

[0114] On the other hand, the present application provides a method for detecting the biological activity of an antibody against TIM-3 or identifying an anti-TIM-3 antibody, comprising the following steps:

[0115] (a) Co-cultivation:

[0116] (i) a modified Jurkat cell, wherein the modified Jurkat cell displays TIM-3 on its surface, and

[0117] It comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, the reporter gene comprises luciferase; and

[0118] (ii) Raji cells;

[0119] (b) adding the antibody to be detected; and

[0120] (c) detecting a signal from the reporter gene.

[0121] In some embodiments, the detection antibody for the biological activity of TIM-3 may include the presence, absence and / or level of the biological activity of the detection antibody for TIM-3. In some embodiments, the biological activity for TIM-3 may include the ability to bind to TIM-3, the ability to inhibit TIM-3 from binding to its ligand, the ability to regulate TIM-3 expression, the effect on T cell activity, the ability to regulate cytokines produced by T cells and other immune cells, the effect on tumor growth and metastasis, and / or the regulation of immune cell infiltration and activity. For example, the biological activity for TIM-3 may include the ability to inhibit TIM-3 from binding to phosphatidylserine (PS).

[0122] In certain embodiments, the method may include detecting the signal of the reporter gene generated by the same antibody to be detected at different concentrations, thereby evaluating the level of biological activity of the antibody to be detected against TIM-3, for example, knowing the IC value of the antibody to be detected against TIM-3. 50 value.

[0123] In certain embodiments, the identification of the anti-TIM-3 antibody may include determining whether the antibody is an anti-TIM-3 antibody. For example, determining whether the antibody to be detected is a TIM-3 blocking antibody. For example, by comparing the signal of the reporter gene generated by the positive control or negative control antibody to determine whether the antibody to be identified is an anti-TIM-3 antibody. For example, to determine whether the antibody to be identified is an anti-TIM-3 blocking antibody.

[0124] In certain embodiments, the method may include detecting a signal from the reporter gene before, simultaneously with, and / or after adding the antibody to be detected.

[0125] In certain embodiments, the method may include a step of comparing signals from before, during and / or after the addition of the antibody to be detected to determine the activity of the antibody to be detected. For example, a decrease in the signal of the reporter gene after the addition of the antibody to be detected relative to before the addition of the antibody indicates that the antibody may have biological activity against TIM-3, for example, blocking activity against TIM-3.

[0126] In certain embodiments, the method may include comparing with a control in a parallel test. For example, the control may include a positive control, i.e., a signal of a reporter gene generated by an antibody known to have biological activity against TIM-3. For example, the control may also include a negative control, i.e., a signal of a reporter gene generated by an antibody known not to have biological activity against TIM-3. For example, if the level of the reporter gene signal generated by the antibody to be tested is comparable to that of the positive control, it indicates that the antibody may be an anti-TIM-3 antibody, such as a TIM-3 blocking antibody.

[0127] In certain embodiments, the modified Jurkat cells and the Raji cells can be co-cultured at a certain initial ratio of cell numbers. For example, the ratio of the co-cultured modified Jurkat cells and the Raji cells can be 3:1-1:3. For example, the ratio of the co-cultured modified Jurkat cells and the Raji cells can be 3:1, 2:1, 1:1, 1:2 or 1:3.

[0128] Without intending to be bound by any theory, the following examples are merely intended to illustrate the kit, detection method and use of the present application, and are not intended to limit the scope of the invention of the present application.

[0129] Example

[0130] The experimental materials used in the examples of this application include:

[0131]

[0132] Example 1 Construction of modified Jurkat cells

[0133] The modified Jurkat cells described in the present application can be constructed according to the following steps:

[0134] 1.1 Plasmid construction

[0135] a) Enzyme digestion of the lentiviral expression vector and PCR&DNACleanup Kit protocol was used to purify and recover the vector backbone after enzyme digestion;

[0136] Table 1 Enzyme digestion system

[0137] Reagents Dosage (ug or ul) Lentiviral expression vector 1ug 5x CutSmart buffer 5ul CIP 1ul <![CDATA[H2O]]> Make up the volume to 50ul

[0138] b) Synthesize Tim-3 sequence and design primers according to The TIM-3 sequence was amplified by PCR using the High-Fidelity 2X PCR MasterMix protocol and PCR&DNACleanup Kit protocol was used to purify and recover the PCR product;

[0139] Table 2 TIM-3 and primer nucleotide sequences

[0140]

[0141] c) According to The PCR product was connected to the restriction endonuclease vector backbone using the HiFi DNA Assembly Master Mix protocol to construct a viral packaging master plasmid vector expressing Tim-3 (the schematic diagram of the Tim-3 expression cassette is shown in Figure 2). Figure 1 shown);

[0142] d) Take competent cells and place them on ice to thaw, add 2ul of ligation product, flick gently to mix, place on ice for 10min, and spread on solid LB plates with ampicillin resistance at 37℃ overnight. The next day, select single clones and extract plasmids for sequencing to ensure that the plasmid construction is correct.

[0143] 1.2 Virus packaging and infection

[0144] Day 1: Collect Hek293T cells and plate them in 6-well plates, adding 1e6 cells / 3mL to each well.

[0145] Day 2: When the cell confluence reaches 80%, transfection is performed. Transfection system preparation (per well): 0.5ug pMD2.G, 1.5ug psPAX2, and 2ug Tim-3 virus packaging main plasmid vector are added to 100ul opti-MEM, mixed evenly, and 12ul Fugene HD transfection reagent is added. Gently blow and mix, let stand at room temperature for 15min, and add dropwise to the 6-well plate. The 6-well plate is placed in a 37℃ 5% CO2 incubator and cultured for 48h.

[0146] Day 4: Collect and concentrate the virus. Take out the 6-well plate, collect the virus and filter it through a 0.45 μm filter, add 4xLenti-X Concentrator, mix gently, and concentrate at 4°C overnight.

[0147] Day5: Infect cells with viruses. Centrifuge the concentrated virus at 1500xg for 45 minutes at 4°C. A white precipitate will be visible at the end of the centrifugation. Carefully remove the supernatant and resuspend the precipitate with 80ul of RPMI1640 containing 10mM HEPES, 8ug / ml Polybrene and 10% FBS. At the same time, collect NFAT-Luc / Jurkat and adjust the cell density to 2e6 cells / ml with RPMI1640 containing 10mM HEPES, 8ug / ml Polybrene and 10% FBS. Add 50ul of cell suspension (1e5 cells / well) to a 96-well plate, and add the resuspended virus concentrate, mix gently, and centrifuge at 32°C 2400rpm for 2h for virus infection. After centrifugation, the supernatant was removed, and the cells were washed twice with RPMI1640 containing 10% FBS, and then transferred to a 48-well plate. After further culture in an incubator at 37°C and 5% CO2 for 48 hours, the transfection efficiency was detected (the infected cells are the modified Jurkat cells described in this application, hereinafter named Jurkat-Tim3-NFAT, and pool means a mixed cell population).

[0148] Day7: FACS detection of virus infection efficiency. Jurkat-Tim3-NFAT pool and control cell NFAT-Luc / Jurkat were collected, washed twice with FACS buffer (PBS containing 2% FBS) and stained at 4°C for 30 minutes. After staining, the cells were washed twice with FACS buffer, resuspended in 200ul FACS buffer and tested for Tim3 positivity. The test results are as follows: Figure 2 As shown, the results showed that the Tim3 positivity rate in the Jurkat-Tim3-NFAT pool reached 96.9%.

[0149] 1.3 Monoclonal selection and detection

[0150] a) Jurkat-Tim3-NFAT pool was collected and cell density was adjusted to 5 cells / ml with RPMI1640 containing 10% FBS, and single cells were plated in 96-well plates (100 ul / well). The 96-well plates were placed in a 37°C 5% CO2 incubator for continued culture.

[0151] b) After the cells are expanded, perform FACS detection. Collect monoclonal cells and control cells NFAT-Luc / Jurkat, wash twice with FACS buffer (PBS containing 2% FBS), and then stain at 4°C for 30 minutes. After staining, wash twice with FACS buffer, resuspend the cells in 200ul FACS buffer, and detect Tim3 signals on the machine. The detection results are as follows Figure 3 As shown, monoclonal cells with high Tim3 signal and stable transfection were obtained by screening.

[0152] Example 2 Detection effects of different target cell lines

[0153] This example studies the activation of the Tim3 signaling pathway after co-incubation of different target cells with Jurkat-Tim3-NFAT pool. When the two cells are co-incubated, co-stimulation of the TCR and Tim3 signaling pathways can induce NFAT-mediated activation and luminescence of luciferase. RPMI1640 containing 10% FBS was used as assay buffer, and the effector:target ratio was 1:1. Target cells, Jurkat-Tim3-NFAT pool and NFAT-Luc / Jurkat cells were collected, and the cell density was adjusted to 2e6 cells / ml with assay buffer. 25ul / well target cells and 25ul / well Jurkat-Tim3-NFAT pool were added to a 96-well cell culture plate as the positive group, and 25ul / well target cells and 25ul / well NFAT-Luc / Jurkat were added as the negative group. After overnight co-incubation of cells, an equal volume of Luciferase detection reagent (Vkeybio, A2000102N) was added, and the luminescent signal value was read after incubation at room temperature for 5 minutes. The results are shown in the following table and Figure 4 shown.

[0154] Table 3 Luminescence signal detection after co-incubation of different target cells

[0155]

[0156] This example compares the co-stimulatory effects of Raji, Daudi and CHO-PDL1-TCRa on TCR and Tim3 signaling pathways after co-incubation with Jurkat-Tim3-NFATpool effector cells. The results show that using Raji and CHO-PDL1-TCRa as target cells can effectively co-activate TCR and Tim3 pathways, and NFAT-mediated luciferase luminescence is enhanced. Compared with S / B (Lum positive / Lum negative), the difference is more significant when Raji cells are used as target cells.

[0157] Example 3 Detection effect under different detection conditions

[0158] 3.1 Ratio of effector cells to target cells

[0159] This example studies the effect of different effector-target ratios on the detection signal. RPMI1640 containing 10% FBS was used as the assay buffer, and the effector-target ratio (Effector:Target) was set to 3:1, 2:1, 1:1, 1:2, and 1:3, respectively. Raji, Jurkat-Tim3-NFAT pool, and NFAT-Luc / Jurkat cells were collected, and the Assay buffer was used to adjust the cell density to an appropriate level. A 96-well cell culture plate was added with 25ul / well target cells and 25ul / well Jurkat-Tim3-NFAT pool as a positive group (ensuring that the total number of cells was 1e5 / well), 25ul / well target cells and 25ul / well NFAT-Luc / Jurkat as a negative group (total number of cells was 1e5 / well), and the cells were incubated overnight and then an equal volume of Luciferase detection reagent (Vkeybio, A2000102N) was added. The luminescent signal value was read after incubation at room temperature for 5 minutes. The results are shown in the following table and Figure 5 As shown, the results show that the modified Jurkat cells and Raji cells described in the present application can achieve good detection effects at different co-culture ratios; when the effector-target ratio is 1:2, S / B (Lum positive / Lum negative )optimal.

[0160] Table 4 Luminescence signal detection after co-incubation with different effector-target ratios

[0161]

[0162]

[0163] 3.2 FBS concentration

[0164] This example studies the effect of FBS concentration on the detection signal. RPMI1640 was used to prepare the assay buffer, and the FBS concentration gradient was set to 20%, 10%, 5%, 2%, 1% and 0%, the effector: target ratio was 1:2, Raji was collected and the cell density was adjusted to 1.2e6 cells / ml, Jurkat-Tim3-NFAT pool and NFAT-Luc / Jurkat cells were collected and the cell density was adjusted to 2.4e6 cells / ml, 25ul / well Raji and 25ul / well Jurkat-Tim3-NFAT pool were added to a 96-well cell culture plate as the positive group, 25ul / well Raji and 25ul / well NFAT-Luc / Jurkat were added as the negative group, and the cells were incubated overnight and then an equal volume of Luciferase detection reagent (Vkeybio, A2000102N) was added, and the luminescent signal value was read after incubation at room temperature for 5 minutes. The results are shown in the following table and Figure 6 As shown, the results indicate that the modified Jurkat cells and Raji cells described in the present application can achieve good detection effects in assay buffers with different FBS concentrations; reducing the FBS concentration in the assay buffer can effectively enhance the activation of luciferase, resulting in enhanced chemiluminescent signals, and the best effect is achieved when the FBS concentration is 1%.

[0165] Table 5 Luminescence signal detection after using different concentrations of FBS

[0166]

[0167]

[0168] Example 4: Verification of detection effect using positive antibodies

[0169] Raji was used as the target cell, the effector-target ratio was 1:2, and RPMI1640 containing 1% FBS was used as the assay buffer of this example. This example used commercial Sabatolimab to verify the feasibility of the method, and compared the Jurkat-Tim3-NFAT pool and Jurkat-Tim3-NFAT stable cells.

[0170] Sabatolimab is a high-affinity humanized IgG4 antibody targeting Tim-3. Raji cells were collected and the cell density was adjusted to 1.2e6 cells / ml. Jurkat-Tim3-NFAT pool, Jurkat-Tim3-NFAT stable cell lines or NFAT-Luc / Jurkat cells were collected and the cell density was adjusted to 2.4e6 cells / ml. Sabatolimab was diluted to different concentrations (30, 6, 0.24, 0.0096, 0ug / ml). A 96-well plate was taken. 25ul Raji cells, 25ul Jurkat-Tim3-NFAT pool or Jurkat-Tim3-NAFT stable cells and 25ul Sabatolimab of different concentrations were added to the antibody treatment group. 25ul Raji cells, 25ul Jurkat-Tim3-NFAT pool or Jurkat-Tim3-NAFT stable cells and 25ul Assay buffer were added to the positive control group. 25ul Raji cells, 25ul NFAT_Luc / Jurkat and 25ul Assay buffer, after the cell culture plate was placed in an incubator at 37°C and 5% CO2 for overnight culture, an equal volume of Luciferase detection reagent (Vkeybio, A2000102N) was added, and the luminescent signal value was read after incubation at room temperature for 5 minutes.

[0171] The experimental results are as follows Figure 7 As shown, this embodiment uses Sabatolimab as a positive control to verify the feasibility of the method for detecting the biological activity of anti-Tim-3 described in the present application. Sabatolimab can effectively inhibit the binding of Tim-3 to the ligand PtdSer, reduce the luciferase chemiluminescent signal and have a dose-dependent relationship. In addition, comparing the pool and the stably transfected cells, the results of Sabatolimab in this method are consistent, and there is basically no difference in IC50. Different effector cells only affect the strength of the luminescent signal, indicating that the cell population and monoclonal clone of the modified Jurkat cells constructed in this application can achieve good detection effects. Therefore, this method can be used to detect the biological activity of antibodies against Tim-3.

Claims

1. A kit for detecting the biological activity of an antibody against TIM-3, comprising: (a) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface, and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises luciferase; and (b) Wild-type Raji cells.

2. The kit according to claim 1, further comprising a culture medium, an assay buffer and / or a reporter gene detection reagent.

3. The kit according to claim 2, wherein the culture medium comprises an initial cell culture medium, a cell growth medium and / or a cell freezing medium. The kit according to claim 2 , wherein the assay buffer comprises RPMI medium with a FBS concentration of 0%-20%.

5. The kit according to claim 2, wherein the assay buffer comprises RPMI medium with a FBS concentration of 20%, 10%, 5%, 2%, 1% or without FBS. The kit according to claim 2 , wherein the assay buffer comprises RPMI medium with a FBS concentration of 1%. The kit according to claim 2 , wherein the reporter gene detection reagent comprises fluorescein.

8. The kit according to any one of claims 1 to 7, wherein the biological activity against TIM-3 comprises the ability of the antibody to block the binding of TIM-3 to its ligand.

9. The kit according to claim 8, wherein the TIM-3 ligand comprises phosphatidylserine (PS).

10. A method for detecting the biological activity of an antibody against TIM-3 and / or identifying a TIM-3 antibody, comprising the following steps: (a) Co-cultivation: (i) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises luciferase; and (ii) wild-type Raji cells; (b) adding the antibody to be detected; and (c) detecting a signal from the reporter gene. The method according to claim 10 , wherein the signal from the reporter gene is detected before, simultaneously with and / or after the addition of the antibody to be detected.

12. The method according to claim 11, further comprising the step of comparing signals from before, simultaneously with and / or after the addition of the antibody to be detected to determine the activity of the antibody to be detected.

13. The method of claim 11, further comprising comparing the signal from the reporter gene to a control.

14. The method of claim 13, wherein the control comprises a signal of a reporter gene generated by an antibody known to have biological activity against TIM-3.

15. The method according to claim 10, wherein the ratio of the co-cultured modified Jurkat cells to the Raji cells is 3:1-1:

3.

16. The method of claim 10, wherein the ratio of the modified Jurkat cells to the Raji cells in co-culture is 3:1, 2:1, 1:1, 1:2 or 1:

3.

17. The method according to any one of claims 10-16, wherein the biological activity against TIM-3 comprises the ability of the antibody to block the binding of TIM-3 to its ligand.

18. The method of claim 17, wherein the TIM-3 ligand comprises phosphatidylserine (PS).

19. A method for detecting the biological activity of an antibody against TIM-3 and / or identifying a TIM-3 antibody, comprising using the kit according to any one of claims 1 to 9.

20. Use of the kit according to any one of claims 1 to 9 in the preparation of a product for detecting the biological activity of an antibody against TIM-3 and / or identifying an anti-TIM-3 antibody.

21. A cell composition comprising (a) a modified Jurkat cell, the modified Jurkat cell displays TIM-3 on its surface, and comprises a T cell receptor (TCR) and a reporter gene operably linked to a promoter responsive to T cell activation, the promoter responsive to T cell activation comprises a NFAT promoter, and the reporter gene comprises luciferase; and (b) Wild-type Raji cells.

22. Use of the cell composition according to claim 21 in detecting the biological activity of antibodies against TIM-3 and / or identifying anti-TIM-3 antibodies.

Images