A method for creating polyploid fish by knocking out the spo11 gene
By knocking out the spo11 gene using the CRISPR/Cas9 system, stable polyploid zebrafish were successfully created, solving the problems of low induction rate and difficult embryo hatching in the creation of polyploid fish, and realizing efficient production and application of polyploid fish.
Patent Information
- Application Number
- CN202410590581.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-13
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-05-13
AI Technical Summary
Existing methods for creating polyploid fish suffer from problems such as low induction rate, difficulty in embryo hatching, and low survival rate of larvae, making it difficult to effectively realize the production and application of polyploid fish.
The spo11 gene was knocked out using the CRISPR/Cas9 system, and polyploid fish were obtained through genotyping and breeding, including homozygous and heterozygous spo11 knockout. Stable polyploid fish were obtained by microinjection of fertilized eggs using gene editing technology.
It significantly improved the induction efficiency of polyploid fish, obtained stable triploid and tetraploid zebrafish, provided a good animal model, laid the foundation for the production and application of polyploid fish, and avoided biosafety issues caused by gene editing.
Smart Images

Figure CN118525810B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for creating polyploid fish through gene knockout, belonging to the field of fish genetic breeding. Background Technology
[0002] Polyploids possess unparalleled advantages over diploids, including faster growth, higher yields, and stronger disease and stress resistance, significantly enhancing their economic value and application potential. Furthermore, the sexual sterility of triploids effectively controls overpopulation in farmed fish while protecting natural germplasm resources. Therefore, polyploid fish are of great significance to the sustainable development of aquaculture, and the artificial creation of polyploid fish has long been a research hotspot in the aquaculture industry, presenting both new opportunities and challenges.
[0003] Currently, the creation of polyploid fish mainly involves two methods: artificial induction and distant hybridization. Artificial induction of polyploidy includes methods such as temperature shock, hydrostatic pressure treatment, and chemical treatment. Temperature shock induces chromosome doubling through a rapid change in water temperature; hydrostatic pressure treatment uses a high-pressure water column to apply pressure to the fish eggs to inhibit spindle formation, thereby achieving chromosome doubling; chemical treatment uses chemicals such as colchicine at appropriate stages of fertilized egg development to achieve chromosome doubling. Distant hybridization refers to crossing fish of different species, genera, or families to obtain offspring with new genetic characteristics. Distant hybridization can create new gene combinations and induce chromosome doubling, thus obtaining polyploid fish. Although there are many methods for inducing polyploidy, these methods all suffer from low polyploidy induction rates, difficulties in embryo hatching, and low larval survival rates, which severely restricts the production and application of polyploid fish.
[0004] Existing research indicates that polyploidy is closely related to meiotic abnormalities. As one of the key genes for chromosome recombination during meiosis, spo11 plays a crucial role in initiating meiosis, inducing DNA strand breaks and forming double-strand breaks. By knocking out this gene, artificial polyploidy can be created by artificially inducing meiotic defects, providing a new and feasible approach for inducing polyploidy in fish. Summary of the Invention
[0005] The purpose of this invention is to provide a method for creating polyploid fish by knocking out the spo11 gene, so as to overcome the defects and deficiencies in the above-mentioned background technology and provide solid technical support for the artificial creation of polyploid fish.
[0006] To achieve the above objectives, the present invention proposes the following technical solution:
[0007] A method for creating polyploid fish by knocking out the spo11 gene includes the following steps:
[0008] 1) The spo11 gene in wild-type diploid fish was knocked out using the CRISPR / Cas9 system. Homozygous knockout diploid 2N spo11 was obtained through genotyping and selection. - / - spo11 heterozygous knockout diploid 2N spo11 + / - ;
[0009] 2) Place female 2N spo11 - / - With male 2N spo11 + / - After mating, the offspring developed to three months of age, and through genotyping and flow cytometry analysis, homozygous knockout triploids of spo11 (3N spo11) were selected. - / - / - ;
[0010] 3) Place female 3N spo11 - / - / - When mated with wild-type diploid males, the offspring, at three months of age, were screened using genotyping and flow cytometry to obtain 4N spo11 heterozygous knockout tetraploids. + / - / - / - ;
[0011] 4) Add 4N spo11 + / - / - / - When mated with wild-type diploids, they reproduce to produce a large number of offspring, which are genetically controlled triploid fish.
[0012] The method for knocking out the spo11 gene includes the following steps:
[0013] 1) Based on the gene knockout principle of the CRISPR / Cas9 system, and according to the spo11 gene sequence and the target design principle, spo11 gene knockout target sites are designed in the exon region of the gene.
[0014] 2) Design upstream and downstream primers for the spo11 gene knockout target site, use wild-type diploid fish cDNA as a template for PCR amplification, and obtain gRNA after in vitro transcription and purification.
[0015] 3) Using a linearized Cas9 plasmid as a template, Cas9 mRNA was obtained through in vitro transcription and purification;
[0016] 4) Microinject gRNA and Cas9 mRNA into the fertilized eggs of fish, then hatch and cultivate the fertilized eggs, test the gene knockout efficiency of the embryos, and cultivate the embryos with effective spo11 gene knockout to adulthood to obtain F0 individuals.
[0017] In the zebrafish gene knockout process, the spo11 gene knockout target site sequence is shown in SEQ ID NO. 1. Further, the upstream primer sequence for the spo11 gene knockout target site is shown in SEQ ID NO. 4, and the downstream primer sequence is shown in SEQ ID NO. 5.
[0018] The injection concentration of the gRNA was 40 ng / μL, the injection concentration of the Cas9 mRNA was 550 ng / μL, the injection dose was 2.5 nL, and the injection site was the embryonic animal pole.
[0019] Among them, the 2N spo11 - / - and 2N spo11 + / - The breeding method includes the following steps:
[0020] 1) The spo11 gene knockout F0 individuals were mated with wild-type opposite sexes, and the offspring developed to three months of age were genotyped and screened to obtain F1 individuals with effective mutations at the target site.
[0021] 2) Self-cross F1 individuals with the same mutation type, and perform genotyping on the offspring that develop to three months of age to screen for 2N spo11. / - and 2N spo11 + / - .
[0022] Using the above method, this invention successfully obtained tetraploid and triploid zebrafish that can be stably inherited. Zebrafish is a common model fish in aquatic research. The knockout target gene spo11 is highly conserved in the evolution of fish. Therefore, the method of this invention can also be applied to create other polyploid fish.
[0023] This invention further provides the application of a reagent for knocking out the spo11 gene in the creation of polyploid fish. Specifically, the reagent includes a Cas9 gene-editing protein or its expression vector, and a gRNA or its expression vector that guides the Cas9 gene-editing protein to specifically bind to the spo11 gene.
[0024] The beneficial effects of this invention are:
[0025] 1. This invention utilizes the CRISPER / Cas9 knockout system to successfully obtain triploid and tetraploid zebrafish adult fish by knocking out the spo11 gene, significantly improving the efficiency of artificially inducing polyploid fish and providing a new feasible solution and experience reference for inducing polyploidy in fish.
[0026] 2. The polyploid zebrafish obtained by this invention is an autopolyploid, which has a more stable genetic background and provides a good animal model for the study of biological polyploidization mechanisms and the production and application of fish polyploids.
[0027] 3. The polyploids obtained by this invention exhibited varying degrees of fertility changes due to the deletion of the spo11 gene. This demonstrates that the fertility of gene-edited fish can be precisely controlled by artificially manipulating mutations in the spo11 gene, effectively avoiding biosafety issues such as gene pollution in natural populations that may result from gene knockout, thus ensuring ecological safety. The technical method involved in this invention opens up broader prospects for the application of artificially induced polyploid fish. Attached Figure Description
[0028] Figure 1 A schematic diagram illustrating the process of creating polyploid zebrafish for an example.
[0029] Figure 2 This invention describes the spo11 homozygous knockout zebrafish mutant type obtained through construction.
[0030] Figure 3 The appearance of diploid and tetraploid adult fish, offspring of spo11 homozygous knockout triploid zebrafish females mated with wild-type males, and the ploidy peak diagram of tetraploid adult fish.
[0031] Figure 4 The images show the embryonic development of offspring from male spo11 heterozygous knockout tetraploid zebrafish mated with wild-type females, the ploidy peaks of the offspring hatching larvae, and the karyotypes of the offspring embryos. Detailed Implementation
[0032] The present invention will now be described in detail with reference to specific embodiments. For ease of description, in the embodiments, when representing genotypes, homo represents homozygous mutants and hetero represents heterozygous mutants, such as 2N-homo representing diploid homozygotes (spo11). - / - ), 2N-hetero represents diploid heterozygote (spo11) + / - ), 3N-homo represents triploid homozygote (spo11) - / - / - ), 3N-hetero represents triploid heterozygote (spo11) + / - / - )wait.
[0033] The ploidy detection and chromosome karyotype analysis of spo11 knockout zebrafish involved in the examples are routine procedures in the art, and the specific methods are as follows:
[0034] 1. Ploid detection of spo11 knockout mutant
[0035] To analyze the ploidy composition of the offspring of the spo11 mutant, a ploidy analyzer was used to detect the ploidy of the hatching offspring larvae of the knockout mutant. The specific procedure is as follows:
[0036] 1) Using a clean pipette, transfer the hatched larvae into sterile EP tubes, one larva per tube. Add 500 μL of 1×PBS buffer (NaCl 137 mM, KCl 2.7 mM, Na2HPO4 4.3 mM, KH2PO4 1.4 mM) to the sample tube. Place the grinding pestle into the EP tube containing the sample and grind thoroughly by rotating it left and right. Place the obtained cell suspension on ice for later use.
[0037] 2) Ploidy determination was performed using the relative cellular DNA content method. Before ploidy determination, wild-type hatching larvae at the same developmental stage were used for ploidy labeling. Before loading the samples onto the analyzer, 100 μL of DAPI dye was added to the cell suspension obtained from grinding, the solution was mixed, and stained in the dark for 5 min. The ploidy analyzer was then used to detect the samples, comparing the peak value of the wild-type sample with that of the target sample to determine the ploidy of the larvae.
[0038] To obtain a large population of offspring for use as parents in polyploid zebrafish, the mutant line was bred multiple times, and the offspring were raised to sexual maturity (3 months of age). Plurality testing was performed on the surviving adult fish. The sample processing method was the same as the instrumental testing method: adult caudal fins were used as the sample type for adult larvae. Plurality calibration samples were caudal fins of sexually mature wild-type adult fish; 0.3 cm of caudal fin was sufficient for instrumental testing.
[0039] 2. Chromosomal karyotype analysis of offspring embryos
[0040] The specific steps for preparing embryonic chromosomes of mutant offspring and analyzing their karyotypes are as follows:
[0041] 1) When the embryo develops to the point where pigment begins to accumulate in the eyes, select 10-15 embryos as a parallel group and prepare a total of 3 parallel treatment groups for statistical analysis. Before processing the samples, carefully remove the egg membrane with a syringe to avoid damaging the embryo.
[0042] 2) Use a clean pipette to transfer the embryos into a culture dish containing 0.1% colchicine solution and soak at room temperature for 45 minutes;
[0043] 3) Use a syringe to remove the colchicine solution from the culture dish, add 0.8% sodium citrate solution to immerse the embryo, and allow it to immerse in hypotonic solution for 20 minutes, changing the hypotonic solution once during this period;
[0044] 4) After the hypotonic treatment, fix the embryos with pre-cooled Carno fixative (methanol: glacial acetic acid = 3:1) for 15 minutes each time, for a total of 3 fixation sessions;
[0045] 5) After fixation, transfer the embryos to a 2.0 mL EP tube containing fresh fixative and store at -20°C overnight;
[0046] 6) The next day, discard the fixative in the tube, add 1-2 drops of 50% glacial acetic acid to dissociate the sample, tear the embryo into pieces with a syringe to prepare a single-cell suspension, add an appropriate amount of freshly prepared Carno fixative, prepare the chromosome phase by dropping the slide, fix the slide by heat, and let it dry naturally at room temperature.
[0047] 7) Wright-Giemsa staining, microscopic observation and photography, and counting of embryonic chromosome phases.
[0048] Example 1: Knockout of the spo11 gene in zebrafish
[0049] 1. Design of CRISPR / Cas9 knockout target sites
[0050] The genomic nucleic acid sequence of the zebrafish spo11 gene was obtained from the NCBI database. Following basic target site design principles, target sites were designed in the fifth exon region of the zebrafish spo11 gene. Figure 2 The knockout target sequence selected in this invention is GAGGATGTTGGATTCCATCGT (as shown in SEQ ID NO.1). Detection primers spo11-F / R are designed around the knockout target site to amplify the fragment containing the target sequence. The upstream detection primer spo11-F sequence is CTGATATAGGGAGCAGGTGGA (as shown in SEQ ID NO.2), and the downstream detection primer spo11-R sequence is CAGAAGCCTCGAGAAAAGCA (as shown in SEQ ID NO.3).
[0051] PCR amplification of the spo11 gene target site fragment was performed using enzyme-containing PCR premix from Shanghai Yisheng Biotechnology Co., Ltd. The reaction mixture was prepared in centrifuge tubes as follows (total volume 20 μL):
[0052]
[0053] The PCR amplification program was set as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 22 s, 35 amplification cycles; 72℃ final extension for 10 min.
[0054] The amplified product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. The sequencing sequence of the amplified product was compared with the sequence in NCBI, and the results were the same, indicating that the target site was available and subsequent steps could be performed.
[0055] 2. gRNA preparation
[0056] Design upstream primers and matching downstream primers for gRNA containing the zebrafish spo11 gene target site sequence. The upstream primer gRNA-F is tgtaatacgactcactataGAGGATGTTGGATTCCATCGTgttttagagctagaaatagc (as shown in SEQ ID NO.4); the downstream primer gRNA-R sequence is AAAGCACCGACTCGGTGCCA (as shown in SEQ ID NO.5).
[0057] Prepare the following reaction system in a sterile PCR tube to synthesize gRNA (total volume 50 μL):
[0058]
[0059] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 amplification cycles; and a final extension at 72℃ for 10 min.
[0060] The amplified gRNA fragments were washed and recovered using the AxyPrep PCR Cleaning Kit from AXYGEN. The specific steps were as follows:
[0061] 1) Add 150 μL of Buffer PCR-A to the sample tube containing the transzyme-digested vector, mix well, and transfer the liquid to a centrifuge column for later use.
[0062] 2) Place the centrifuge column in a 2mL centrifuge tube and centrifuge at 12000r / min for 1min;
[0063] 3) Discard the filtrate, add 700 μL of Buffer W2 to the centrifuge column, and centrifuge at 12000 r / min for 1 min;
[0064] 4) Discard the filtrate, transfer the centrifuge column to a clean 1.5 mL collection tube, add 25 μL of preheated Eluent to the center of the centrifuge column filter membrane, and let stand at room temperature for 1 min to fully dissolve the DNA.
[0065] 5) Centrifuge at 12000 r / min for 1 min, and the resulting filtrate is the plasmid DNA recovered from washing.
[0066] After obtaining the purified gRNA, it was processed using Ambion's... The T7 Kit immediately performs external transcription of gRNA, with the following steps:
[0067] 1) Prepare the following reaction system (total volume 20.0 μL) in a sterile EP tube:
[0068]
[0069] After thorough mixing, treat in a 37°C water bath for 1 hour;
[0070] 2) Add 1.0 μL of TURBO DNase to the tube and treat in a 37°C water bath for 15 min to remove excess DNA template.
[0071] Using Ambion's mirVana TM The miRNA Isolation Kit recovers gRNA transcribed in vitro. The specific steps for recovery and purification are as follows:
[0072] 1) Dilute the gRNA to 300 μL using RNase-free water, and add an equal volume of anhydrous ethanol;
[0073] 2) Transfer the above solution to the recovery column and centrifuge at 10000 r / min for 15 s;
[0074] 3) Discard the filtrate, add 700 μL miRNA Wash Solution I, and centrifuge at 10000 r / min for 10 s;
[0075] 4) Discard the filtrate, add 500 μL Wash Solution II, centrifuge at 10000 r / min for 10 s, and repeat the operation once;
[0076] 5) Discard the filtrate, centrifuge the empty column at 10000 r / min for 1 min to remove the residual liquid in the recovery column;
[0077] 6) Add an appropriate amount of RNase-free water preheated to 95℃, centrifuge at 13000r / min for 30s, collect the gRNA, detect the concentration, and store it in an ultra-low temperature freezer at -80℃ for later use.
[0078] 3. Cas9 mRNA preparation
[0079] The pSP6-2sNLS-spCas9 vector was linearized by XbaI digestion (37℃ water bath digestion, treatment time ≥ 4h). 1 μL of the digested product was subjected to agarose gel electrophoresis to confirm complete vector linearization. The digested vector was washed and recovered using the AxyPrep PCR cleaning kit from AXYGEN. Cas9 mRNA was then transcribed in vitro using the purified vector as a template. The transcribed product was purified, and the Cas9 mRNA solution was collected. After concentration determination, it was stored at -80℃ for later use. The washing and recovery of the linearized vector, in vitro transcription, and purification of the transcribed product were performed using the same methods as in step 2.
[0080] 4. In vitro microinjection of zebrafish embryos
[0081] The night before injection, wild-type zebrafish individuals with well-developed glands and obvious secondary sexual characteristics were selected as parents at a female-to-male ratio of 1:1 to 1:2 and placed in a breeding tank with a partition for overnight rearing in the dark. The next morning, the partition was removed, and light stimulation was provided to encourage the male and female parents to chase each other and lay eggs. After the parents laid eggs, fertilized eggs were aspirated onto a microinjection plate using a clean pipette, and microinjected into the 1-cell stage fertilized eggs using a microinjector. Before microinjection, Cas9 mRNA and gRNA were mixed to a final concentration of 550 ng / μL and 40 ng / μL, respectively. The amount of drug injected per fertilized egg was 2.5 nL, and the injection site was the animal pole of the embryo. After injection, the fertilized eggs were placed in aerated water at a constant temperature of 28°C for incubation until the embryos hatched. The injected embryos were the F0 generation individuals.
[0082] 5. F0 generation knockout efficiency test
[0083] After the F0 generation develops and hatches, five larvae are randomly selected, and their genomic DNA is extracted using the ammonium acetate method. The specific steps are as follows:
[0084] 1) Add 400 μL of cell lysis buffer TES (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 7.5, 1% SDS) and 6 μL of proteinase K to a 1.5 mL sterile EP tube containing the sample. Vortex to mix, then transfer to a 65°C constant temperature water bath for lysis and digestion for 2-3 h until the tissue is completely gone.
[0085] 2) After complete digestion, cool the sample to room temperature, add 200 μL of ammonium acetate solution to the sample tube, let it stand on ice for 5-10 min, and then centrifuge at 12000 r / min for 10 min at room temperature.
[0086] 3) Transfer 400 μL of the supernatant after centrifugation to a new 1.5 mL EP tube, add an equal amount of isopropanol, mix by inverting the tube, and place on ice for 1 min.
[0087] 4) Centrifuge at 12000 r / min for 10 min at room temperature, then discard the supernatant;
[0088] 5) Add 500 mL of 75% ethanol to the EP tube to wash the DNA;
[0089] 6) Centrifuge at 12000 r / min for 5 min at room temperature, then discard the supernatant;
[0090] 7) Wash the DNA again with 100% ethanol, and repeat steps 5) and 6);
[0091] 8) After air-drying at room temperature and discarding the supernatant, the precipitate at the bottom of the EP tube will precipitate for 5-10 minutes. Then add 10 μL of double-distilled water to dissolve the precipitate. The resulting solution is the sample genomic DNA.
[0092] After obtaining the F0 generation genomic DNA, PCR amplification was performed using the detection primers spo11-F / R, with the PCR amplification system and reaction conditions identical to those in step 1. The amplified products were then sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. Based on the sequencing results, individuals exhibiting a double peak near the spo11 knockout target site, with the double peak extending to the end of the sequence, were identified as effectively knocked-out F0 individuals.
[0093] Example 2: Breeding of Polyploid Zebrafish
[0094] 1. Cultivation and screening of F1 generation positive individuals
[0095] After the effectively knocked-out F0 embryos reach sexual maturity, they are mated with wild-type embryos to obtain F1 embryos. The F1 generation is then raised to adulthood, and 0.3cm of tail fin is harvested. Genomic DNA is extracted using the ammonium acetate method and used as a PCR template. PCR amplification is performed using the detection primers spo11-F / R. The amplified product is then sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. According to the detection results, a double peak appears near the spo11 target site in the peak diagram. Sequence alignment with the wild-type spo11 gene shows that individuals with non-triple insertion / deletion mutations are considered positive individuals in the F1 generation.
[0096] 2. Cultivation and screening of F2 generation homozygotes
[0097] After the positive F1 cells reach sexual maturity, F1 cells with the same mutation type are selected for self-pollination to obtain F2 embryos. Genotyping is then performed on the F2 individuals after they reach adulthood, using the same method as for screening positive F1 individuals. Based on the test results, individuals with a single peak in the peak diagram are either wild-type or heterozygous. Wild-type individuals are excluded by comparing their sequences with the wild-type spo11 gene sequence in the NCBI database. The remaining individuals are then homozygous F2 individuals. The homozygous F2 individuals obtained in this invention are homozygous knockout zebrafish with a 13bp deletion. Compared to the wild type, they have a 13bp deletion at the knockout target site (TGGATTCCATCGT), which causes the stop codon to appear prematurely during translation. Figure 2 ).
[0098] 3. Breeding and screening of spo11 homozygous knockout triploid zebrafish
[0099] The F2 generation contained both male and female individuals. These individuals (2N-homo females, 2N-homo males, 2N-hetero females, and 2N-hetero males) were mated with wild-type females. It was found that although 2N-homo males could produce offspring with wild-type females, none of the offspring survived, indicating that 2N-homo males are infertile. Other mutant types had normal fertility.
[0100] Using 2N-homo females and 2N-hetero males as parents, offspring embryos were obtained. A large number of embryos from this breeding combination died during development, but a small number of offspring developed normally and survived. Further analysis using a ploidy analyzer to determine the ploidy composition of the hatchlings revealed that the ploidy peaks of these larvae fluctuated between diploid and triploid. Simultaneously, karyotype analysis of the embryos from this breeding combination showed a diverse range of chromosome numbers in the offspring embryos, including aneuploidy and euploidy (diploid 2N=50, triploid 3N=75).
[0101] The above findings confirm that the eggs of 2N-homo females undergo abnormal chromosome distribution during meiosis, resulting in a large number of aneuploid eggs and a small number of euploid eggs (diploid or triploid eggs). Aneuploid eggs develop into aneuploids and die during development, while euploid eggs develop into euploids (diploid or triploid), develop normally, and survive.
[0102] The surviving triploid offspring obtained from this breeding combination included both male and female individuals. When different types of triploids (3N-homo females and 3N-hetero males) were mated with wild-type females, it was found that although 3N-hetero males could produce offspring with wild-type females, none of the offspring survived, meaning that 3N-hetero males are infertile.
[0103] 4. Breeding and screening of spo11 heterozygous tetraploid zebrafish
[0104] Hybridization was performed using 3N-homo females and wild-type males as breeding parents to produce offspring embryos. A large number of these embryos died during development, with only a small number surviving and developing normally. Plurality analysis of the hatchlings from this breeding combination revealed fluctuations between diploid and tetraploid ploidy. Furthermore, karyotype analysis of the offspring embryos from this breeding combination showed a similar pattern to the 2N-homo combination, exhibiting a diverse number of chromosomes, including aneuploid and euploid embryos (diploid 2N=50, triploid 3N=75, tetraploid 4N=100).
[0105] The above findings confirm that the eggs of 3N-homo females also exhibit abnormal chromosome allocation during meiosis, producing a large number of aneuploid eggs and a small number of euploid eggs (diploid, triploid, or tetraploid eggs). Aneuploid eggs develop into aneuploids and are lethal during development, while euploid eggs develop into euploids (diploid, triploid, or tetraploid), develop normally, and survive. Further ploidy testing of the offspring that survived to adulthood from this breeding combination revealed that the adult offspring contained both diploid and tetraploid (…). Figure 3 ).
[0106] 5. Mass breeding of genetically controlled triploid zebrafish
[0107] A 4N-hetero male and a wild-type female were used as breeding parents to cross and produce offspring embryos. Since both parents had even-numbered chromosome sets, the offspring embryos developed normally, resulting in a large number of hatched larvae. The ploidy of the hatched larvae from this breeding combination was determined using a ploidy analyzer, and embryonic karyotype analysis was also performed. The results showed that all offspring from this breeding combination were triploid with a chromosome number of 75. Figure 4 ).
[0108] Sequence list description:
[0109] SEQ ID NO.1: spo11 gene knockout target site;
[0110] SEQ ID NO.2, 3: upstream and downstream primers spo11-F / R for detecting target site sequences, which can be used to detect embryo knockout efficiency;
[0111] SEQ ID NO.4, 5: Upstream and downstream primers designed based on the spo11 gene knockout target site for the preparation of gRNA.
Claims
1. A method of knocking out spo11 The method for creating polyploid fish through gene therapy is characterized by: Includes the following steps: 1) Using the CRISPR / Cas9 system to study wild-type diploid fish spo11 Genes are knocked out, and then obtained through genotyping and selective breeding. spo11 Homozygous knockout diploid 2N spo11 - / - and spo11 Heterozygous knockout diploid 2N spo11 + / - ; 2) Place female 2N spo11 - / - With male 2N spo11 + / - After mating, the offspring, when developed to three months of age, are screened for genetic variation through genotyping and flow cytometry. spo11 Homozygous knockout triploid 3N spo11 - / - / - ; 3) Place the female 3N spo11 - / - / - When mated with wild-type diploid males, offspring developed to three months of age were screened for genetic variation through genotyping and flow cytometry. spo11 Heterozygous knockout tetraploid 4N spo11 + / - / - / - ; 4) 4N spo11 + / - / - / - By mating with wild-type diploids, they reproduce and produce a large number of offspring, which are genetically controlled triploid fish. The spo11 Gene knockout methods include the following steps: 1) Based on the gene knockout principle of the CRISPR / Cas9 system, according to spo11 Gene sequence, referencing target design principles, design within gene exon regions spo11 Gene knockout target sites, the spo11 The gene knockout target site sequence is shown in SEQ ID NO. 1; 2) Design spo11 Upstream and downstream primers for the gene knockout target site, the spo11 The upstream primer sequence for the gene knockout target site is shown in SEQ ID NO.4, and the downstream primer sequence is shown in SEQ ID NO.
5. PCR amplification was performed using cDNA from wild-type diploid fish as a template, followed by in vitro transcription and purification to obtain gRNA. 3) Using a linearized Cas9 plasmid as a template, Cas9 mRNA was obtained through in vitro transcription and purification; 4) Wild-type diploid fish fertilized eggs were microinjected with gRNA and Cas9 mRNA, then the fertilized eggs were hatched and cultured. The gene knockout efficiency of the embryos was tested, and the results were then analyzed. spo11 Embryos with effective gene knockout are cultured to adulthood to obtain F0 individuals.
2. The knockout method as described in claim 1 spo11 The method for creating polyploid fish through gene therapy is characterized by: The fish in question is a zebrafish.
3. The knockout method as described in claim 1 spo11 The method for creating polyploid fish through gene therapy is characterized by: The injection concentration of the gRNA was 40 ng / μL, and the injection concentration of the Cas9 mRNA was 550 ng / μL. The injection dose for both was 2.5 nL, and the injection site was the animal pole of the embryo.
4. The knockout method as described in claim 1 spo11 The method for creating polyploid fish through gene therapy is characterized by: The 2N spo11 - / - and 2N spo11 + / - The breeding method includes the following steps: 1) spo11 Gene knockout F0 individuals were mated with wild-type opposite sexes, and the offspring developed to three months of age were genotyped and screened to obtain F1 individuals with effective mutations at the target site; 2) Self-cross F1 individuals with the same mutation type, and perform genotyping on the offspring that develop to three months of age to select 2N offspring. spo11 - / - and 2N spo11 + / - .
Citation Information
Patent Citations
Spo11 gene knockout method
CN109402169A
Method for breeding usp54b gene deletion type zebrafish through gene knockout
CN117568409A