KASP molecular marker primer group for identifying saline-alkaline tolerance of rape and application of KASP molecular marker primer group

By designing KASP molecular marker primer sets and kits, the genotype of SNP sites in the BnaA02.CDKE1 gene of rapeseed was determined, solving the problems of simplicity and accuracy in identifying the salt and alkali tolerance of rapeseed and supporting the rapid progress of rapeseed breeding.

CN121575145APending Publication Date: 2026-02-27HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512006709.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

The lack of simple and efficient molecular marker detection technology in the current technology for the application of the BnaA02.CDKE1 gene in rapeseed hinders the progress of salt-alkali tolerance breeding in rapeseed.

Method used

A KASP molecular marker primer set and kit were designed and provided. Through PCR amplification and fluorescence signal detection, the SNP site genotype of the BnaA02.CDKE1 gene in rapeseed was determined, which can be used to identify the salt and alkali tolerance of rapeseed.

Benefits of technology

It enables accurate, rapid, and low-cost identification of rapeseed's salt and alkali tolerance, supports efficient rapeseed breeding, and simplifies the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575145A_ABST
    Figure CN121575145A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker primer group for identifying saline-alkaline tolerance of rape and application of the KASP molecular marker primer group, and belongs to the technical field of molecular marker-assisted breeding. Comprising a first primer (SEQ ID NO.2), a second primer (SEQ ID NO.3) and a universal primer (SEQ ID NO.4), the primer group is designed based on a key SNP site (A / T) of a BnaA02. CDKE1 gene, and rapid and accurate typing of rape genotypes can be realized through a KASP technology. The invention also provides a kit containing the primer group, an application of the kit in saline-alkaline resistance identification of rape, and a corresponding identification method. The method has the advantages of simplicity and convenience in operation, stable result, high flux, low cost and the like, and is suitable for large-scale auxiliary breeding and molecular identification of saline-alkaline tolerant rape varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to a molecular marker primer set for identifying salt and alkali tolerance in Brassica napus and its application. Background Technology

[0002] Rapeseed (Brassica napus L.) is a globally important oilseed crop, and its planting scale and yield directly affect the stability of my country's grain and oil supply. Soil salinization has various harmful effects on rapeseed, with high concentrations of sodium... + and Cl - Salt stress can lead to yellowing leaves, delayed flowering, reduced plant height, and even death. To cope with salt stress, plants have evolved various adaptive regulatory mechanisms, including the conserved salt-overly sensitive (SOS) signaling pathway composed of SOS3, SOS2, and SOS1 proteins. Besides activating the SOS pathway to maintain cellular ion homeostasis, a particularly noteworthy subunit in the mediator complex, CDKE1, plays a positive regulatory role in plant immunity, abscisic acid (ABA) signaling pathways, and drought stress responses. Multiple studies have shown that CDKE1 can regulate stress-responsive gene expression through interactions with various transcription factors.

[0003] Our research group previously conducted a genome-wide association analysis on the aboveground dry weight of 505 rapeseed seedlings under salt treatment. The results showed that a major salt-alkali tolerance QTL was found on linkage group A02. qWL.A02 This confirmed that BnaA02.CDKE1 This is a key gene in this QTL that participates in regulating salt and alkali tolerance. Therefore, BnaA02.CDKE1 This gene can provide important genetic resources for the breeding of new salt-tolerant rapeseed varieties, and has significant breeding value. However, to date, there are no reports on the development and application of molecular markers targeting this gene. BnaA02.CDKE1 To effectively integrate genes into the molecular breeding practice of rapeseed with salt tolerance, there is an urgent need to establish a simple and efficient molecular marker detection technology and related application system. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to salt and alkali tolerance in rapeseed and its application, which can detect the level of salt and alkali tolerance in rapeseed, thereby assisting in the selection and breeding of salt and alkali tolerant superior varieties and accelerating the rapeseed breeding process.

[0005] In a first aspect, the present invention provides a method for detecting genes related to salt and alkali tolerance in rapeseed. BnaA02.CDKE1 A haplotype KASP molecular marker primer set, the primer set comprising: The first primer has the nucleotide sequence shown in SEQ ID NO.2; The second primer has the nucleotide sequence shown in SEQ ID NO.3; Universal primers, the nucleotide sequences of which are shown in SEQ ID NO.4; Wherein, the first primer and the second primer are respectively targeted BnaA02.CDKE1 The design of alleles A and T at SNP loci of the gene, the BnaA02.CDKE1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; When the genotype of the SNP locus is AA, it corresponds to the salt-tolerant haplotype HapA; when the genotype is TT or AT, it corresponds to the salt-intolerant haplotype HapB.

[0006] Secondly, this invention provides a method for detecting genes related to salt and alkali tolerance in rapeseed. BnaA02.CDKE1 A haplotype kit comprising the aforementioned KASP molecular marker primer set.

[0007] Furthermore, the kit also includes the PARMS master mix.

[0008] Thirdly, the present invention provides the application of the KASP molecular marker primer set or kit in the identification of salt and alkali tolerance in rapeseed.

[0009] Fourthly, the present invention provides a method for identifying the salt and alkali tolerance of rapeseed, comprising the following steps: (1) Extract genomic DNA from the rapeseed plants to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer set described above; (3) Detect the fluorescence signal of the PCR amplification product obtained in step (2); (4) Determine the genotype of the SNP site based on the fluorescence signal: if the signal indicates that the genotype is AA, then the plant is determined to be salt-tolerant or a candidate salt-tolerant type; if the signal indicates that the genotype is TT or AT, then the plant is determined to be salt-intolerant or a candidate salt-intolerant type.

[0010] Further, the PCR amplification reaction system in step (2) contains, in 10 μL: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM first primer; 0.15 μL of 10 μM second primer; 0.4 μL of 10 μM universal primer; 10-100 ng of DNA template; and the remainder is ddH2O.

[0011] Further, the PCR amplification reaction procedure in step (2) is as follows: pre-denaturation at 94°C for 20 minutes; 10 cycles of decreasing amplification, each cycle including denaturation at 94°C for 20 seconds, and annealing / extension at 65°C to 57°C for 1 minute, decreasing by 0.8°C per cycle; followed by 32 cycles of amplification, each cycle including denaturation at 94°C for 20 seconds, and annealing / extension at 57°C for 1 minute; and finally storage at 4°C.

[0012] Further, in step (3), the fluorescence signal of the PCR amplification product is read using an enzyme-linked immunosorbent assay (ELISA) reader, and the fluorescence signal is analyzed using genotyping software to determine the genotype of the SNP site.

[0013] Furthermore, the determination of the genotype is as follows: if the fluorescence signal analysis result is close to the FAM fluorescence signal axis, the genotype is determined to be AA; if the fluorescence signal analysis result is close to the HEX fluorescence signal axis, the genotype is determined to be TT; if the fluorescence signal analysis result is located between the FAM and HEX fluorescence signal axes, the genotype is determined to be AT.

[0014] The beneficial effects of this invention are: This invention is based on BnaA02.CDKE1 Haplotype analysis was performed and corresponding molecular markers were designed to detect the salt and alkali tolerance of rapeseed. This allows for assisted selection and breeding of highly salt- and alkali-tolerant varieties, accelerating the process of breeding highly salt- and alkali-tolerant rapeseed. In the identification of salt- and alkali-tolerant rapeseed varieties, this invention also has advantages such as accurate results, simplicity and speed, low cost, and insensitivity to environmental factors. Attached Figure Description

[0015] Figure 1 Schematic diagram of the average aboveground dry weight distribution of Brassica napus seedlings under high salt stress in a related population.

[0016] Figure 2 Phenotypic differences in average aboveground dry weight at the seedling stage between the two haplotypes.

[0017] Figure 3 The genotyping of 68 rapeseed materials was detected using the molecular marker KASP_CDKE1. FAM represents AA genotype, HEX represents TT genotype, and the black sample in the lower left corner is the blank control. Detailed Implementation

[0018] To facilitate understanding of the present invention, a more comprehensive description will be provided below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Unless otherwise specified, the techniques used in the embodiments are conventional techniques well known to those skilled in the art. Unless otherwise specified, the reagents used in the embodiments are commercially available.

[0019] Example 1 1. Planting of related populations and determination of aboveground dry weight of seedlings under high salt stress During the seedling stage, 505 natural germplasm samples of Brassica napus were subjected to high salt stress treatment (215 mM NaCl solution), with 6 biological replicates for each variety. First, 25-30 uniform and healthy seeds were selected and germinated in a mesh screen. After 10 days, uniform seedlings were selected and transferred to 10 L black pots containing Hoagland nutrient solution. The plants were cultured in the nutrient solution for approximately 2 weeks, then the solution was replaced with Hoagland nutrient solution containing 215 mM NaCl. After 2 weeks of salt treatment, the aboveground dry weight of the plants was measured. The distribution of aboveground dry weight at the seedling stage in the 505 Brassica napus related populations is shown below. Figure 1 As shown in the figure. The results indicate that the aboveground dry weight of all natural germplasm of Brassica napus varied significantly at the seedling stage and generally approximates a normal distribution.

[0020] 2. Candidate genes BnaA02.CDKE1 Haplotype identification and molecular marker development In related groups BnaA02.CDKE1 Analysis of the promoter, 3'-UTR, and coding region sequences identified two haplotypes (HapA and HapB). The average aboveground dry weight of haplotype A under salt stress was 0.1429 ± 0.0088 g, while that of haplotype B was 0.1357 ± 0.0049 g. The phenotypic differences in aboveground dry weight between the two haplotypes were significant. Figure 2 ).

[0021] BnaA02.CDKE1 The gene sequence is as follows: CGGAATTGACCAAATGTATATCTAACT Note: Underlined sites are SNP sites located in the 3'-UTR region of the gene; wavy lines represent primers.

[0022] 3. Based on BnaA02.CDKE1 Based on the haplotype sequence, the KASP molecular marker was designed and developed. The primer nucleotide sequences are as follows: First primer: GAAGGTGACCAAGTTCATGCTCGGAATTGACCAAATGTATATCTAACT Second primer: GAAGGTCGGAGTCAACGGATTGGAATTGACCAAATGTATATCTAACA Universal primer: ACACAATGTGCTAGTCTTGAATATCA Note: Single underline indicates the universal tag sequence of the fluorescence signal; wavy line indicates the specific binding primer sequence of the target site; bold text indicates SNP sites.

[0023] The above primer set was designed based on the principle of competitive allele-specific PCR (KASP) and is used for the detection of PCR in Brassica napus. BnaA02.CDKE1 Genotyping is performed using key SNPs (A / T) in genes. The working principle is as follows: Two allele-specific primers (the first primer corresponds to the A allele, and the second primer corresponds to the T allele) are designed with their 3' end bases targeting the SNP site. During the PCR annealing stage, only primers whose 3' ends perfectly match the template SNP site can stably bind and initiate extension, achieving allele-specific competitive amplification. The 5' ends of both primers carry universal tag sequences that do not participate in template binding but serve only as "fluorescent signal receiving addresses." Two universal fluorescent probes (FAM and HEX labels) are present in the reaction system, their sequences complementary to the aforementioned universal tags. When a primer successfully extends, the corresponding fluorescent probe hybridizes to its 5' end and is subsequently hydrolyzed by the 5'→3' exonuclease activity of DNA polymerase, releasing the fluorescent signal (FAM or HEX) corresponding to that primer. Genotyping is achieved by detecting the FAM and HEX fluorescence intensity in each reaction well using a microplate reader.

[0024] 4. DNA was extracted from rapeseed leaves using the CTAB method. Take 1cm of young leaves from each plant. 2Place the mixture into a 2 mL centrifuge tube, add steel balls, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB into the centrifuge tube. Incubate the homogenate in a 65°C water bath for 60 minutes, shaking every 15 minutes. After homogenization, cool to room temperature and add a 24:1 (v / v) chloroform:isoamyl alcohol mixture to the centrifuge tubes. Gently invert and mix for 15 minutes, then centrifuge at 12000 rpm for 10 minutes. Place the centrifuged tubes on a control plate in order and transfer the supernatant to a new 1.5 mL centrifuge tube (500 μL). Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice-cold ethanol. Cap the centrifuge tubes and gently shake a few times to thoroughly mix the ice-cold ethanol with the supernatant. Place the tubes in a -20°C freezer for 20-30 minutes to allow genomic DNA precipitation. After standing, centrifuge the tubes at 12000 rpm for 6 minutes, discard the supernatant, and add 500 μL of... Add 75% ethanol and let stand for 5 minutes. Discard the supernatant and repeat once. The precipitate is the genomic DNA. Place the centrifuge tube containing the DNA in a fume hood to dry. The genomic DNA of each plant is obtained. Add 200 μL ddH2O to the dried centrifuge tube containing the DNA to dissolve the DNA. Store at -20℃ after dissolution.

[0025] 5. PCR amplification of molecular markers PCR amplification was performed, and the reaction system is shown in Table 1.

[0026] Table 1: PCR amplification reaction system

[0027] The PCR reaction program was as follows: 94℃ pre-denaturation for 20 min, 1 cycle; 94℃ denaturation for 20 s, annealing at 65-57℃ (-0.8℃ / Cycle) for 1 min, 10 cycles; 94℃ extension for 20 s, 57℃ extension for 1 min, 32 cycles; finally, storage at 4℃.

[0028] 6. Identification of amplification products After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the converted fluorescence signal was analyzed using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping diagram, and the genotype results were output according to the different colors. Then, the genotype of the rapeseed to be tested (i.e., whether the SNP site is A or T) is determined according to the following principles: If the fluorescence signal data of the amplification product of the rapeseed to be tested is close to the X-axis (FAM signal) according to the Douglas genotyping software, then the genotype of the KASP_CDKE1 site in the rapeseed genome is AA homozygous; if the fluorescence signal data of the amplification product of the rapeseed to be tested is close to the Y-axis (HEX signal) according to the Douglas genotyping software, then the genotype of the KASP_CDKE1 site in the rapeseed genome is TT homozygous; if the fluorescence signal data of the amplification product of the rapeseed to be tested is located between the X-axis and Y-axis (HEX and FAM signals) according to the Douglas genotyping software, then the genotype of the KASP_CDKE1 site in the rapeseed genome is AT heterozygous.

[0029] Amplification results showed that the KASP_CDKE1 marker could produce stable PCR products in 68 known materials, and both A and T isotopes could be detected. Figure 3 Of the 27 salt-tolerant rapeseed materials (average aboveground dry weight at seedling stage 0.1630±0.0360g), all were of the AA genotype, while of the 41 salt-intolerant rapeseed materials (average aboveground dry weight at seedling stage 0.1267±0.0370g), all were of the TT genotype. Therefore, this molecular marker can be used for the breeding of different salt-tolerant rapeseed varieties.

Claims

1. A method for detecting genes related to salt and alkali tolerance in rapeseed. BnaA02.CDKE1 The haplotype KASP molecular marker primer set is characterized by, The primer set includes: The first primer has the nucleotide sequence shown in SEQ ID NO.2; The second primer has the nucleotide sequence shown in SEQ ID NO.3; Universal primers, the nucleotide sequences of which are shown in SEQ ID NO.4; Wherein, the first primer and the second primer are respectively targeted BnaA02.CDKE1 The design of alleles A and T at SNP loci of the gene, the BnaA02.CDKE1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; When the genotype of the SNP locus is AA, it corresponds to the salt-tolerant haplotype HapA; when the genotype is TT or AT, it corresponds to the salt-intolerant haplotype HapB.

2. A method for detecting genes related to salt and alkali tolerance in rapeseed. BnaA02.CDKE1 A haplotype reagent kit, characterized in that, The kit contains the KASP molecular marker primer set as described in claim 1.

3. The kit according to claim 2, characterized in that, The kit also includes the PARMS master mix.

4. The application of the KASP molecular marker primer set according to claim 1 or the kit according to claim 2 in the identification of salt and alkali tolerance in rapeseed.

5. A method for identifying the salt and alkali tolerance of rapeseed, characterized in that, Includes the following steps: (1) Extract genomic DNA from the rapeseed plants to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer set described in claim 1; (3) Detect the fluorescence signal of the PCR amplification product obtained in step (2); (4) Determine the genotype of the SNP site based on the fluorescence signal: if the signal indicates that the genotype is AA, then the plant is determined to be salt-tolerant or a candidate salt-tolerant type; if the signal indicates that the genotype is TT or AT, then the plant is determined to be salt-intolerant or a candidate salt-intolerant type.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system in step (2) contains, in 10 μL: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM first primer; 0.15 μL of 10 μM second primer; 0.4 μL of 10 μM universal primer; 10-100 ng of DNA template; and the remainder is ddH2O.

7. The method according to claim 5, characterized in that, The PCR amplification reaction procedure in step (2) is as follows: pre-denaturation at 94°C for 20 minutes; 10 cycles of decreasing amplification, each cycle including denaturation at 94°C for 20 seconds, and annealing / extension at 65°C to 57°C for 1 minute, decreasing by 0.8°C per cycle; followed by 32 cycles of amplification, each cycle including denaturation at 94°C for 20 seconds, and annealing / extension at 57°C for 1 minute; and finally storage at 4°C.

8. The method according to claim 5, characterized in that, In step (3), the fluorescence signal of the PCR amplification product is read using an enzyme-linked immunosorbent assay (ELISA) reader, and the fluorescence signal is analyzed using genotyping software to determine the genotype of the SNP site.

9. The method according to claim 5, characterized in that, The genotype determination is as follows: if the fluorescence signal analysis result is close to the FAM fluorescence signal axis, the genotype is determined to be AA; if the fluorescence signal analysis result is close to the HEX fluorescence signal axis, the genotype is determined to be TT; if the fluorescence signal analysis result is located between the FAM and HEX fluorescence signal axes, the genotype is determined to be AT.