A DRAP1 protein for early flowering and altering fatty acid composition, its encoding gene, and applications thereof

Abstract

The present invention provides a protein for promoting early flowering and altering fatty acid composition, its coding gene and applications, belonging to the field of biotechnology, and specifically discloses the application of the gene of Macadamia integrifolia in promoting early flowering and altering fatty acid composition. By studying the gene of the NF-YB family in Macadamia integrifolia, the present invention helps to understand the flowering and fatty acid synthesis mechanisms of Macadamia integrifolia, and uses genetic engineering techniques and the like to induce plants to flower early and alter fatty acid composition, thereby providing a theoretical basis and reference for the research on the mechanisms of regulating flowering and fatty acid synthesis accumulation. DRAP1 and its coding gene and applications, belonging to the field of biotechnology, and specifically discloses the application of the gene of Macadamia integrifolia in promoting early flowering and altering fatty acid composition. DRAP1 By studying the gene of the NF-YB family in Macadamia integrifolia, the present invention helps to understand the flowering and fatty acid synthesis mechanisms of Macadamia integrifolia, DRAP1 and uses genetic engineering techniques and the like to induce plants to flower early and alter fatty acid composition, thereby providing a theoretical basis and reference for the research on the mechanisms of regulating flowering and fatty acid synthesis accumulation.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to plant transgenic biotechnology breeding, in particular to a DRAP1 protein for promoting early flowering and changing fatty acid composition, its encoding gene and applications. Background Art

[0002] Macadamia integrifolia, also known as macadamia nut or Australian walnut, belongs to the genus Macadamia F.Muell of the family Proteaceae, and is native to the subtropical rainforest areas along the southeastern coast of Queensland and the northeastern coast of New South Wales in Australia. The fat content of Macadamia integrifolia is 70-79%, and 80% of which are unsaturated fatty acids. Long-term consumption of Macadamia integrifolia is beneficial to reducing the levels of plasma total cholesterol and low-density lipoprotein cholesterol, and thus effectively preventing the occurrence of diseases such as hypercholesterolemia and coronary atherosclerosis. In addition, Macadamia integrifolia is not only rich in lipids, but also rich in various nutrients such as protein, carbohydrates, multiple vitamins and multiple mineral elements. Because of its comprehensive nutrition, high calories and containing various essential nutrients for the human body, it is known as the "king of dried fruits". As one of the most popular nuts in the world, Macadamia integrifolia was introduced into China in the 1970s. Currently, the planting area in Yunnan Province of China exceeds 252,700 hectares, accounting for 51% of the world and 82.5% of the country. China has become the country with the largest planting scale and the fastest growth rate of Macadamia integrifolia in the world. However, at present, there are generally problems in the production of Macadamia integrifolia in China, such as low yield per unit area, uneven quality and unobvious economic benefits. Research shows that advancing the flowering period of Macadamia integrifolia can improve the fruit setting rate, increase the yield and stabilize the kernel quality. Therefore, studying the genes related to Macadamia integrifolia flowering and exploring their functions and regulatory mechanisms are of great significance for improving the growth period, yield, quality, etc. of Macadamia integrifolia.

[0003] NF-Y protein (nuclear factor-Y), also called nuclear factor Y, CCAAT-binding factor (CBF protein) or heme activator protein (HAP protein), is a class of transcription factors that can bind to the CCAAT box in the promoter sequence and widely exists in eukaryotes. NF-Y is composed of three different subunits: NF-YA, NF-YB and NF-YC. The core region of NF-YA is highly conserved, but the core sequences of NF-YB and NF-YC subunits are not conserved.

[0004] In plants, NF-YB has been reported to be widely involved in processes such as plant flowering, seed development, drought response, and salt tolerance. AtNF-YB can bind to the promoter of FT and participate in regulating the flowering time of Arabidopsis thaliana. In rice, OsNF-YB7 not only functions in the vegetative growth stage but also participates in the regulation of floral meristems. Overexpression of OsNF-YB7 / L1L results in dwarf plants with abnormal inflorescence axis development. In barley, overexpression of HvNF-YB1 causes the plant to flower earlier. In Arabidopsis thaliana, maize, and wheat, overexpression of the homologous genes AtNF-YB1, ZmNF-YB2, and TaNF-YB2 can all improve the drought stress tolerance of plants. Wheat TaDRAP1 and TaDRAP2 both belong to the NF-YB class of transcription factors and have been confirmed to be involved in drought response. AtNF-YB9 / AtLEC1 (LEAFYCOTYLEDON 1) and AtNF-YB6 / AtL1L (LEC1-like gene) are both involved in seed development.

[0005] NF-YB is a ubiquitous superfamily of transcription factors in plants, with numerous family members and complex functions. However, there is no reported NF-YB transcription factor that simultaneously participates in the regulation of flowering and fatty acid synthesis. Plant seeds are the key organs for oil storage, and flowering is the starting point of seed development. Therefore, exploring genes related to the simultaneous regulation of flowering and fatty acid synthesis and accumulation not only plays a significant role in the cultivation of high-quality, high-unsaturated fatty acid varieties of Macadamia integrifolia, but also has a reference role in the breeding of high-quality varieties of other oil crops. Summary of the Invention

[0006] In view of the above problems, the present invention provides a DRAP1 protein for advancing flowering and changing fatty acid composition, its coding gene, and applications.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A DRAP1 protein for advancing flowering and changing fatty acid composition, wherein the DRAP1 protein is a MtDRAP1 protein, and its amino acid sequence is as shown in SEQ ID NO: 1;

[0009] Its CDS region is 603 bp long and encodes a total of 200 amino acids after translation, and its protein sequence is most similar to the NF-YB class of proteins;

[0010] The protein sequence similarity between the MtDRAP1 protein sequence and its orthologous gene OsDRAP1_NF-YB in rice reaches 21.23%;

[0011] The protein sequence similarity between the MtDRAP1 protein sequence and its orthologous gene TaDRAP1 in wheat reaches 15.45%;

[0012] The protein sequence similarity between MtDRAP1 and its orthologous gene NnDRAP1_NF-YB in lotus is 41.36%.

[0013] The protein sequence similarity between MtDRAP1 and its orthologous gene CaDRAP1_NF-YB in pepper is 26.1%.

[0014] The protein sequence similarity between MtDRAP1 and its paralogous gene MtDRAP2_NF-YB in macadamia nut is 55.97%.

[0015] The MtDRAP1 protein belongs to the NF-YB subfamily.

[0016] A DRAP1 gene encoding the above DRAP1 protein for early flowering and altering fatty acid composition, the DRAP1 gene is the MtDRAP1 gene, and its coding sequence is as shown in SEQ ID NO: 2.

[0017] Furthermore, the cDNA sequence of the MtDRAP1 gene is as shown in SEQ ID NO: 3.

[0018] Furthermore, the open reading frame of the MtDRAP1 gene is as SEQ ID NO: 4.

[0019] A plasmid containing the DRAP1 gene, the plasmid containing the DRAP1 gene is plasmid pEASY-Blunt-MtDRAP1, which is obtained by ligating the above MtDRAP1 gene to the cloning vector pEASY-Blunt Zero.

[0020] A plant expression vector containing the DRAP1 gene, the plant expression vector containing the DRAP1 gene is obtained by ligating the above plasmid containing the DRAP1 gene with a vector;

[0021] Furthermore, the plant expression vector containing the DRAP1 gene is a plant expression vector driven by the 35S promoter for MtDRAP1, which is obtained by using the plasmid containing the DRAP1 gene as a PCR template, amplifying the MtDRAP1 PCR fragment containing adapters, and then ligating it with the pMDC202 vector digested with Xba I and Kpn I.

[0022] An Agrobacterium competent cell containing the DRAP1 gene, the Agrobacterium competent cell containing the DRAP1 gene is obtained by introducing the above plant expression vector containing the DRAP1 gene into Agrobacterium.

[0023] Application of a DRAP1 gene in advancing flowering and altering fatty acid composition, wherein the DRAP1 gene is the MtDRAP1 gene.

[0024] Furthermore, the application is to transform Arabidopsis thaliana or Proteaceae plants with Agrobacterium competent cells containing the DRAP1 gene for advancing flowering and altering fatty acid composition;

[0025] Proteaceae plants include but are not limited to Macadamia integrifolia;

[0026] The process of the application is to transform Agrobacterium competent cells containing the DRAP1 gene into Arabidopsis thaliana or Proteaceae plants, disinfect and sow the harvested T0 generation seeds, cultivate them, retain the positive seedlings and continue to screen until the T2 generation, and harvest the seeds of the homozygous lines; plant the obtained seeds of the homozygous lines and verify the function of the MtDRAP1 gene through phenotypic identification.

[0027] Furthermore, the application is to transform Arabidopsis thaliana or Macadamia integrifolia with Agrobacterium competent cells containing the DRAP1 gene for advancing flowering and altering fatty acid composition;

[0028] The process of the application is to transform Agrobacterium competent cells containing the DRAP1 gene into Arabidopsis thaliana or Macadamia integrifolia, disinfect and sow the harvested T0 generation seeds, cultivate them, retain the positive seedlings and continue to screen until the T2 generation, and harvest the seeds of the homozygous lines; plant the obtained seeds of the homozygous lines and verify the function of the MtDRAP1 gene through phenotypic identification.

[0029] The beneficial effects of a DRAP1 protein, its coding gene, and the application for advancing flowering and altering fatty acid composition according to the present invention are as follows:

[0030] By studying the MtDRAP1 gene of the NF-YB family in Macadamia integrifolia, the present invention helps to understand the flowering and fatty acid synthesis mechanisms of Macadamia integrifolia, and uses genetic engineering techniques, etc. to induce plants to flower earlier and alter fatty acid composition, thereby providing a theoretical basis and reference for the research on the mechanisms of regulating flowering and fatty acid synthesis accumulation;

[0031] By extracting total RNA and cDNA of Macadamia integrifolia from Macadamia integrifolia; analysis shows that the expression level of the MtDRAP1 gene is the highest in the young leaves of Macadamia integrifolia and lower in the kernels; and it is verified that the MtDRAP1 protein is NF-YB, which has certain guiding significance for guiding related plants to flower earlier and alter fatty acid composition;

[0032] In the present invention, a plant expression vector containing MtDRAP1 and competent Agrobacterium containing the MtDRAP1 gene were constructed, and the MtDRAP1 gene was successfully introduced into heterologous Arabidopsis thaliana to analyze the function of the MtDRAP1 gene in Arabidopsis thaliana. The results showed that after overexpression of the MtDRAP1 gene in Arabidopsis thaliana, it had obvious functions of early flowering and changing fatty acid components. Therefore, the MtDRAP1 gene disclosed in the present invention not only has important application value in improving the early flowering and changing fatty acid components of the original Macadamia integrifolia and plants of the same family Proteaceae, but also can be applied to heterologous Arabidopsis thaliana. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is the gel electrophoresis detection result and protein structure characteristics of the CDS fragment of the MtDRAP1 gene in Example 1 of the present invention. Among them, Figure A is the gel electrophoresis detection result of the CDS fragment of the MtDRAP1 gene; on the far left in Figure A is the gel electrophoresis detection result of Marker, and in the middle and on the right are the parallel detection results of the gel electrophoresis of the CDS fragments of three groups of MtDRAP1 genes; Figure B is the protein structure characteristics of the CDS fragment of the MtDRAP1 gene.

[0034] Figure 2 It is the comparative analysis of the MtDRAP1 protein sequence with homologous protein sequences of rice, maize, lotus, pepper and Arabidopsis thaliana in Example 1 of the present invention. Among them, MtDRAP1 represents the MtDRAP1 protein sequence of Macadamia integrifolia in the present invention, MtDRAP2_NF-YB represents the paralogous homologous protein sequence of Macadamia integrifolia, OsDRAP1_NF-YB represents the homologous protein sequence of rice, BdDRAP1_NF-YB represents the homologous protein sequence of Brachypodium distachyon, NnDRAP1_NF-YB represents the homologous protein sequence of lotus; CaDRAP1_NF-YB represents the homologous protein sequence of pepper; TaDRAP1 represents the protein sequence of wheat; Consensus represents the consensus protein sequence.

[0035] Figure 3 It is the phylogenetic analysis of the MtDRAP1 gene with NF-YB and NF-YA of other species in Example 1 of the present invention. Among them, Nn represents lotus, Ca represents pepper, Os represents rice, Zm represents maize, Mt represents Macadamia integrifolia, Sb represents sorghum, Bv represents sugar beet, Bd represents Brachypodium distachyon.

[0036] Figure 4 It is the relative expression levels of the MtDRAP1 gene of Macadamia integrifolia in flowers, young fruits, young leaves, old leaves and nuts in Example 1 of the present invention.

[0037] Figure 5It is the structure and restriction enzyme verification result of the plant expression vector pMDC202-MtDRAP1 in Example 1 of the present invention; among them, Figure A is the structure of the plant expression vector pMDC202-MtDRAP1, and Figure B is the PCR verification result of the plant expression vector pMDC202-MtDRAP1;

[0038] Figure 6 It is the positive seedling screening and expression level detection result of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene in Example 2 of the present invention; among them, Figure A is the positive seedling screening result diagram of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene, and Figure B is the expression level detection result diagram of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene by real-time quantitative PCR;

[0039] Figure 7 Phenotype result diagram of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene in Example 2 of the present invention; among them, Figure A is the phenotype result of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene Figure 1 and Figure B is the phenotype result of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene Figure 2 ; WT represents wild-type Arabidopsis thaliana (Col-0) plants, and OE-1, OE-2, and OE-3 respectively represent three groups of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene;

[0040] Figure 8 Diagram of the content change of each fatty acid component in Arabidopsis thaliana plants overexpressing the MtDRAP1 gene in Example 2 of the present invention; among them, WT represents wild-type Arabidopsis thaliana (Col-0) plants, and OXMtDRAP1 represents Arabidopsis thaliana plants overexpressing the MtDRAP1 gene. Detailed implementation manners

[0041] The technical solutions in the embodiments of the present invention are clearly and completely described below. Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar generalizations without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments for those skilled in the art to understand.

[0042] In addition, for those not specifying specific techniques or conditions in the specific embodiments disclosed below, they shall be carried out according to the techniques or conditions described in the literature in the field (for example, referring to "Molecular Cloning Experiment Guide" written by Sambrook et al. and translated by Huang Peitang et al., the third edition, Science Press) or according to the product instructions. Reagents not indicating the manufacturer are all conventional products that can be purchased.

[0043] Material: The total RNA extraction material of Macadamia integrifolia was selected from the smooth-shelled variety 'H2'.

[0044] The wild-type Arabidopsis thaliana (Col-0) and Arabidopsis thaliana plants overexpressing the MtDRAP1 gene required for the experiment were both planted in a culture room at 22 °C with a 16 h / 8 h (light / dark) cycle.

[0045] The kits used in this experiment included the Novizan polysaccharide and polyphenol plant RNA extraction kit, the Aikerui reverse transcription kit, the Takara high-specificity qPCR kit, the Magen gel extraction kit, the Escherichia coli competent cells (DH5α) and Agrobacterium tumefaciens GV3101 competent cells from Shanghai Weidi Biotechnology Co., Ltd.

[0046] Example 1 Cloning of the Macadamia integrifolia MtDRAP1 Gene and Construction of a Plant Expression Vector

[0047] The Macadamia integrifolia MtDRAP1 gene belongs to one of the DRAP1 genes. The specific process of its cloning and construction of a plant expression vector is as follows:

[0048] 1) Cloning of the Macadamia integrifolia MtDRAP1 gene

[0049] The Macadamia integrifolia MtDRAP1 gene was cloned from Macadamia integrifolia (smooth-shelled variety 'H2') by RT-PCR amplification technology, as follows:

[0050] 11) RNA extraction and reverse transcription

[0051] After grinding the leaves of Macadamia integrifolia into powder in liquid nitrogen, the total RNA was extracted using the Novizan polysaccharide and polyphenol plant RNA extraction kit (DNA-free residue type), and then the RNA was reverse transcribed into cDNA using the Aikerui reverse transcription kit. The obtained total RNA and cDNA of Macadamia integrifolia were stored in an -80 °C refrigerator for later use. Among them, the cDNA sequence of the Macadamia integrifolia MtDRAP1 gene is shown in SEQ ID NO: 3.

[0052] 12) Gene cloning

[0053] Using the cDNA of Macadamia integrifolia as a template, the expression frame of MtDRAP1 was cloned by RT-PCR with MtDRAP1-F1 and MtDRAP1-R1. The pair of primers used for RT-PCR amplification were MtDRAP1-F1: 5'-ATGCAGCTGGTGATGATAGACCTG-3' and MtDRAP1-R1: 5'-TCATCCATCTTCATCATAATCTTCTTCATCCTCC-3';

[0054] The RT-PCR amplification program was as follows: 95°C (pre-denaturation), 5 min; 98°C (denaturation), 10 s; 60°C (annealing), 30 s; 72°C (extension), 1 min; 34 cycles; 72°C (final extension), 5 min. Then, the amplified product was recovered and purified using the Magen Gel Extraction Kit. After detecting the product by gel electrophoresis, the target gene MtDRAP1 (i.e., the purified PCR product) was obtained.

[0055] The amplified target gene MtDRAP1 was ligated to the cloning vector pEASY-Blunt Zero, and the cloned gene was sequenced. Among them, the ligation reaction system was: 2 μL of purified PCR product, 0.5 μL of cloning vector pEASY-Blunt Zero, and 2.5 μL of ddH2O. The obtained ligation reaction system was placed in a PCR instrument and reacted at 25°C for 20 min.

[0056] After the ligation reaction was completed, it was sent to the company for sequencing. After the sequencing of MtDRAP1 was correct, the plasmid pEASY-Blunt-MtDRAP1 with correct sequencing (i.e., the plasmid containing the DRAP1 gene) was obtained.

[0057] Among them, the coding sequence of the MtDRAP1 gene with correct sequencing is shown in SEQ ID NO: 2, and the open reading frame of the MtDRAP1 gene is shown in SEQ ID NO: 4.

[0058] The nucleic acid sequence of the MtDRAP1 gene with correct sequencing was translated into a protein sequence (i.e., MtDRAP1 protein), and the amino acid sequence of the MtDRAP1 protein is shown in SEQ ID NO: 1.

[0059] Gel electrophoresis detection was performed on the CDS fragment of MtDRAP1 cloned from the cDNA of Macadamia integrifolia (smooth shell variety 'H2'). The results are shown in Figure 1 Figure A in Figure 1 In Figure A of , on the left side is the gel electrophoresis detection result of the Marker, and in the middle and on the right side are the parallel detection results of the gel electrophoresis of three groups of CDS fragments of the MtDRAP1 gene. The results are consistent with the expected size. The sequencing results show that its CDS region is 603 bp long and encodes a total of 200 amino acids after translation, as shown in Figure 1 Figure B in

[0060] As shown in Figure 2As shown, the protein sequence similarity between MtDRAP1 and its orthologous gene OsDRAP1_NF-YB in rice is 21.23%; the protein sequence similarity between MtDRAP1 and its orthologous gene TaDRAP1 in wheat is 15.45%; the protein sequence similarity between MtDRAP1 and its orthologous gene NnDRAP1_NF-YB in lotus is 41.36%; the protein sequence similarity between MtDRAP1 and its orthologous gene CaDRAP1 NF-YB in pepper is 26.1%; the protein sequence similarity between MtDRAP1 and its paralogous gene MtDRAP2_NF-YB in macadamia nut is 55.97%.

[0061] 13) Bioinformatics analysis of the MtDRAP1 gene

[0062] The online website NCBI (https: / / www.ncbi.nlm.nih.gov / ) was used for homologous blast to further confirm that the isolated gene belongs to the NF-YB family. The NF-YB homologous protein sequences were retrieved through the online websites Phytozome (https: / / phytozome-next.jgi.doe.gov / ) and NCBI (https: / / www.ncbi.nlm.nih.gov), and MEGA was used for multiple sequence alignment and phylogenetic tree construction (neighbor-joining method).

[0063] The phylogenetic tree was constructed using the MtDRAP1 protein sequence of macadamia nut and partial NF-YB and NF-YA protein sequences of rice (Oryza sativa), maize (Zea mays), lotus (Nelumbo nucifera), pepper (Capsicum annuum), sugar beet (Beta vulgaris), sorghum (Sorghumbicolor), and Brachypodium distachyon. The results are as Figure 3 shown, indicating that the MtDRAP1 protein belongs to the NF-YB subfamily.

[0064] 14) Analysis of tissue expression specificity of MtDRAP1

[0065] To explore the expression of the MtDRAP1 gene in different organs of macadamia nut, the expression abundance of MtDRAP1 in the transcriptomes of macadamia nut flowers, young fruits, young leaves, old leaves, and kernels was analyzed. The specific analysis steps are as follows:

[0066] After grinding the flowers, young fruits, young leaves, old leaves and kernels of Macadamia integrifolia into powder in liquid nitrogen, total RNA was extracted using the Novizan Polysaccharide Polyphenol Plant RNA Extraction Kit (DNA-free residue type), and then the RNA was reverse transcribed into cDNA using the Aike Rui Reverse Transcription Kit; the relative expression level of the MtDRAP1 gene was detected using the Bio-Rad CFX Real-Time Fluorescent Quantitative PCR Instrument. The quantitative PCR primers for the MtDRAP1 gene were qMtDRAP1-F: 5'-TGGTCGAGGCAGGTTAACAA-3', qMtDRAP1-R: 5'-TCCCATTTTCCAGCCCTTCG-3'; the internal reference primers were qMtactin-F: 5'-TGCCCTTGATTACGAGCAGG-3', qMtactin-R: 5'-CGGAACCTCTCAGCACCAAT-3'.

[0067] The kit used for Real-time PCR was the Takara High Specificity qPCR Kit. The reaction system consisted of 10.0 μL of SYBR Premix Ex Taq (2×), 0.7 μL of forward primer (10 μM), 0.7 μL of reverse primer (10 μM), 1.5 μL of template cDNA, and 7.0 μL of ddH2O;

[0068] The Real-time PCR program was as follows:

[0069] (1) 95°C for 5 min,

[0070] (2) 95°C for 10 s,

[0071] (3) 56°C for 15 s,

[0072] (4) Read the fluorescence signal,

[0073] (5) Repeat 40 cycles

[0074] (6) Melting curve: 95°C for 10 s, 60°C for 20 s, hold for 1 s,

[0075] (7) Store at 8°C.

[0076] After the detection, the 2-ΔΔCT method was used to calculate the final expression level.

[0077] (CT: the cycle number when the fluorescence intensity reaches the threshold)

[0078] The specific analysis results are shown in Figure 4 , indicating that the expression level of the MtDRAP1 gene is relatively high in the young leaves and young fruits of Macadamia integrifolia, and relatively low in the kernels, suggesting that MtDRAP1 may be involved in fruit development.

[0079] 2) Construction of plant expression vector

[0080] Using plasmid pEASY-Blunt-MtDRAP1 as the PCR template, with primer pair MtDRAP1-F2: 5'-GGAGAGGACCTCGACTCTAGAATGCAGCTGGTGATGATAGACCTG-3' and MtDRAP1-R2: 5'-CTCATTTTTTCTACCGGTACCTCATCCATCTTCATCATAATCTTCTTCAT CCTCC-3', the MtDRAP1 PCR fragment containing adapters was amplified, and then ligated with the vector pMDC202 (kanamycin resistance) digested with Xba I and Kpn I to obtain a plant expression vector driven by the 35S promoter for MtDRAP1 (i.e., plant expression vector pMDC202-MtDRAP1, which is also a plant expression vector containing the DRAP1 gene). The specific structure is as Figure 5 shown in Figure A in

[0081] Among them, the PCR amplification program for amplifying the MtDRAP1 PCR fragment containing adapters is: 95°C (pre-denaturation), 5 min; 98°C (denaturation), 10 s; 60°C (annealing), 30 s; 72°C (extension), 1 min; cycle 34 times; 72°C (final extension), 5 min.

[0082] The double digestion reaction system is 1.5 μL of pMDC202 vector, 1 μL of Xba I, 1 μL of Kpn I, 5 μL of 10×FastDigest buffer, and 41.5 μL of ddH2O. The obtained double digestion reaction system was incubated in a PCR instrument at 37°C for 30 min, and then the digestion products were separated by 1.5% agarose gel electrophoresis to obtain the pMDC202 (kanamycin resistance) vector digested with Xba I and Kpn I.

[0083] The pMDC202 ligation reaction system ligated with the pMDC202 (kanamycin resistance) vector digested with Xba I and Kpn I is 1 μL of vector plasmid, 0.5 μL of the MtDRAP1 PCR fragment containing adapters, 1 μL of 5×CEⅡBuffer, 0.5 μL of recombinase (Exnase II), and 2 μL of ddH2O. The obtained pMDC202 ligation reaction system was incubated in a PCR instrument at 37°C for 30 min.

[0084] 3) Verification of the plant expression vector

[0085] The ligation system obtained in the previous step was transformed into Escherichia coli. After transformation into Escherichia coli, single clone colonies were picked, and PCR verification was carried out using primers MtDRAP1-R1 / MtDRAP1-F1 to verify the correctness of the clone.

[0086] Among them, the transformation method of transferring the ligation system of the plant expression vector (pMDC202-MtDRAP1) into Escherichia coli is as follows:

[0087] Place the Escherichia coli competent DH5α on ice to melt, add 5 μL of the ligation system, gently flick the centrifuge tube wall to mix evenly, and successively incubate in ice bath for 30 min, heat shock at 42 °C for 90 s, ice bath for 5 min, then add 500 μL of LB liquid medium, shake and culture in a shaker at 37 °C for 3 h, then centrifuge at 5000 rpm for 5 min, remove part of the supernatant, leave about 10 μL of supernatant, gently pipette and resuspend, and spread on an LB plate (added with kanamycin, final concentration is 50 μg / mL), and incubate inverted at 37 °C for 1 day. After monoclonal colonies grow on the plate, pick well-grown single colonies for PCR verification.

[0088] The RT-PCR amplification program during PCR verification is: 95 °C (pre-denaturation), 5 min; 98 °C (denaturation), 10 s; 60 °C (annealing), 30 s; 72 °C (extension), 1 min; cycle 34 times; 72 °C (final extension), 5 min.

[0089] The verification result is as shown in Figure 5 Figure B in, it can be seen that the plant expression vector pMDC202-MtDRAP1 contains the target band (i.e., contains the MtDRAP1 gene), indicating that the cloning is correct.

[0090] 4) Construct the competent state of Agrobacterium tumefaciens GV3101 transformed with the plant expression vector pMDC202-MtDRAP1 (i.e., construct the competent state of Agrobacterium tumefaciens containing the MtDRAP1 gene)

[0091] Introduce the verified correct plant expression vector pMDC202-MtDRAP1 into the competent state of Agrobacterium tumefaciens GV3101 to obtain the competent state of Agrobacterium tumefaciens GV3101 transformed with the plant expression vector pMDC202-MtDRAP1, which is used for the subsequent infection of Arabidopsis thaliana.

[0092] Among them, the specific steps of introducing the plant expression vector pMDC202-MtDRAP1 into the competent state of Agrobacterium tumefaciens GV3101 are as follows:

[0093] The Agrobacterium tumefaciens GV3101 competent cells were thawed on ice, 1 μg of the plant expression vector pMDC202-MtDRAP1 was added, and the tube wall of the centrifuge was flicked gently to mix evenly. Then, it was successively ice-bathed for 20 min, quick-frozen in liquid nitrogen for 5 min, heat-shocked at 37 °C for 5 min, and ice-bathed for 5 min. Then, 500 μL of LB liquid medium was added, and it was shaken and cultured on a shaker at 28 °C for 2 h. Then, it was centrifuged at 5000 rpm for 5 min, part of the supernatant was removed, and about 10 μL of the supernatant was taken and gently pipetted and resuspended and spread on an LB plate (added with kanamycin and rifampicin, with final concentrations of 50 μg / ml each), and cultured upside down at 28 °C for 2 - 3 days. After monoclonal colonies grew on the plate, well-grown single colonies were picked for PCR verification to obtain the Agrobacterium tumefaciens GV3101 competent cells transformed with the plant expression vector pMDC202-MtDRAP1 (i.e., the Agrobacterium tumefaciens competent cells containing the DRAP1 gene).

[0094] Example 2 Screening, Phenotypic Identification and Statistics of MtDRAP1-Transformed Arabidopsis thaliana Plants

[0095] S1. Screening and Phenotypic Identification of MtDRAP1-Transformed Arabidopsis thaliana Plants

[0096] The Agrobacterium tumefaciens GV3101 competent cells were transformed with the plant expression vector pMDC202-MtDRAP1, and wild-type Arabidopsis thaliana (Col-0) was transformed by the floral dip method. The harvested T0 generation seeds were disinfected and sown on a 1 / 2 MS solid medium plate containing hygromycin resistance for screening, and cultured under full light at 22 °C. Then, the obtained resistant plants were transferred to a plug tray and continued to be cultured in a greenhouse at 22 °C with a 16 h / 8 h (light / dark) cycle. DNA detection was performed on the resistant plants, and positive seedlings were retained and continued to be screened until the T2 generation. The T2 generation seeds were harvested for screening of high-expression homozygous lines.

[0097] Real-time quantitative PCR was used to analyze the expression level of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene. The analysis method was as follows:

[0098] After the RNA of Arabidopsis thaliana leaves was reverse-transcribed into cDNA, the obtained template cDNA was used to detect the relative expression level of the MtDRAP1 gene by a Bio-Rad CFX real-time fluorescence quantitative PCR instrument. The quantitative PCR primers for the MtDRAP1 gene were qMtDRAP1-F: 5'-TGGTCGAGGCAGGTTAACAA-3', qMtDRAP1-R: 5'-TCCCATTTTCCAGCCCTTCG-3'; the internal reference primers were qactin-F: 5'-GGTAACATTGTGCTCAGTGGTGG-3', qactin-R: 5'-AACGACCTTAATCTTCATGCTGC-3'.

[0099] The kit used for real-time PCR is the Takara high-specificity qPCR kit. The reaction system consists of 10.0 μL of SYBR Premix Ex Taq (2×), 0.7 μL of forward primer (10 μM), 0.7 μL of reverse primer (10 μM), 1.5 μL of template cDNA, and 7.0 μL of ddH2O;

[0100] The real-time PCR program is as follows:

[0101] (1) 95°C for 5 min,

[0102] (2) 95°C for 10 s,

[0103] (3) 56°C for 15 s,

[0104] (4) Read the fluorescence signal,

[0105] (5) Repeat 40 cycles

[0106] (6) Melting curve: 95°C for 10 s, 60°C for 20 s, hold for 1 s,

[0107] (7) Store at 8°C.

[0108] After the detection, the 2-ΔΔCT method is used to calculate the final expression level.

[0109] (CT: the cycle number when the fluorescence intensity reaches the threshold)

[0110] The identification results of the final expression level analysis are as Figures 6 to 7 shown. Among them, Figure 6 Figure A in shows the screening results of positive seedlings of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene grown from transgenic line seeds. Positive lines (i.e., Arabidopsis thaliana plants overexpressing the MtDRAP1 gene) can be screened out and can grow on 1 / 2 MS solid medium containing hygromycin resistance;

[0111] Figure 6 Figure B in shows the detection results of the expression level of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene by real-time quantitative PCR, indicating that the expression levels of the MtDRAP1 gene in three groups of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene, OE-1, OE-2, and OE-3, are significantly increased and can be used for subsequent phenotype analysis (i.e., analysis of flowering time, plant height, and number of rosette leaves).

[0112] Figure 7 is the phenotype result diagram of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene. It can be seen that overexpression of the MtDRAP1 gene causes Arabidopsis thaliana to bolt and flower earlier, and at the time of bolting, Arabidopsis thaliana plants overexpressing the MtDRAP1 gene have more rosette leaves and a higher plant height.

[0113] The above experiments and results can fully prove that the MtDRAP1 gene has the function of advancing the heading (flowering) of plants.

[0114] S2. Detection of fatty acid components

[0115] S21. Fatty acid extraction

[0116] To explore the effect of the MtDRAP1 gene on plant oil synthesis, seeds of three groups of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene with relatively high relative expression levels in RT-qPCR quantitative analysis (i.e., OE-1, OE-2, and OE-3) were selected for GC-MS detection of fatty acid components. In the detection, five key fatty acid components were focused on: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3), and the contents of the five key fatty acid components were counted.

[0117] The seeds of three groups of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene were mixed and ground into powder in liquid nitrogen (labeled as OE), and the seeds of wild-type Arabidopsis thaliana (Col-0) were ground into powder in liquid nitrogen (labeled as WT). Weighed 0.2 g and put it into a 10 mL centrifuge tube, added 5 mL of chromatographic methanol and soaked for 2 h, centrifuged at 10000 r for 10 min, extracted twice and combined the supernatant to obtain the methanol supernatant and the seed powder after methanol soaking.

[0118] Another 5 mL of chloroform was added to the seed powder after methanol soaking, mixed well and soaked for 2 h, centrifuged at 10000 r for 10 min, filtered with a syringe, extracted twice and combined the supernatant to obtain the chloroform supernatant.

[0119] Take 2.5 mL of the methanol supernatant and the chloroform supernatant respectively into a centrifuge tube and mix well, dry it with a nitrogen blower, add 1 mL of sodium hydroxide-methanol solution with a concentration of 14 wt%, shake well, heat in a water bath at 60 °C for 30 min, take it out and cool to room temperature, then add 3 mL of boron trifluoride-methanol solution with a concentration of 14 wt%, shake well, heat in a water bath at 60 °C for 3 min, cool to room temperature, and finally add 2.5 mL of n-hexane, shake well, let it stand, and obtain the supernatant to be measured.

[0120] S22. Gas chromatography analysis

[0121] Take the supernatant to be measured for GC-MS (gas chromatography-mass spectrometry) analysis;

[0122] Among them, the gas chromatography conditions are as follows:

[0123] The Agilent capillary column is DB-225ms, 30 m × 0.25 mm × 0.25 μm.

[0124] Gas phase conditions: Injection port: 280 °C, split ratio 20:1, temperature program: initial temperature 50 °C; heated to 200 °C at 5 °C / min, then heated to 230 °C at 2 °C / min and held for 10 minutes; carrier gas: He, carrier gas flow rate: 1.0 mL / min;

[0125] Mass spectrometry conditions: Ion source temperature 230 °C, quadrupole temperature 150 °C, ionization mode EI, electron energy 70 eV, scanning mass range 35 - 800 m / z.

[0126] The injection volume was 1 μL.

[0127] The results are as Figure 8 shown. In the seeds of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene, the proportions of fatty acid components changed significantly. Compared with the seeds of wild - type Arabidopsis thaliana (WT), the contents of palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1) and linolenic acid (C18:3) in the seeds of Arabidopsis thaliana plants overexpressing the MtDRAP1 gene all increased significantly, while the content of linoleic acid (C18:2) decreased significantly. This result indicates that the MtDRAP1 gene is involved in regulating the oil synthesis process, and further shows that the MtDRAP1 gene is involved in regulating the oil synthesis process of Macadamia integrifolia.

[0128] In summary, since the MtDRAP1 gene can be overexpressed in heterologous Arabidopsis thaliana and can achieve the functions of advancing plant (flowering) heading and regulating the oil synthesis process (i.e., changing fatty acid components), it can also be overexpressed in the native Macadamia integrifolia and the plants of Proteaceae to which Macadamia integrifolia belongs, and can achieve the functions of advancing plant (flowering) heading and regulating the oil synthesis process (i.e., changing fatty acid components).

[0129] Other parts not described in detail are prior art. Although the above - mentioned embodiments describe the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. Those of ordinary skill in the art can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for early flowering and changing fatty acid composition DRAP1 A protein, characterized in that Said DRAP1 Protein MtDRAP1 The protein has an amino acid sequence as shown in SEQ ID NO:

1.

2. A method for encoding the method for early flowering and changing fatty acid composition according to claim 1 DRAP1 Protein DRAP1 A gene characterized by Said DRAP1 Gene MtDRAP1 The gene, whose coding sequence is shown in SEQ ID NO:

2.

3. A type of DRAP1 A plasmid containing a gene, characterized in that The inclusion DRAP1 The plasmid of the gene is obtained by using the DRAP1 The gene was connected to a cloning vector.

4. A type of DRAP1 A plant expression vector of a gene, characterized in that The inclusion DRAP1 The plant expression vector of the gene is a vector comprising the DRAP1 The PCR amplification product of the gene was connected with the expression vector pMDC202 to obtain.

5. A type of DRAP1 The Agrobacterium competent form of the gene is characterized in that The inclusion DRAP1 The Agrobacterium competent state of the gene is obtained by using the DRAP1 The plant expression vector of the gene is introduced into Agrobacterium to obtain it.

6. A DRAP1 The application of the gene in early flowering and changing fatty acid composition is characterized in that: Said DRAP1 Gene MtDRAP1 Gene; MtDRAP1 The coding sequence of the gene is shown in SEQ ID NO: 2; The application is to MtDRAP1 Genes were used in Arabidopsis or macadamia to advance flowering and alter fatty acid composition.

7. The use according to claim 6, characterized in that: The application is to utilize DRAP1 Agrobacterium-competent transformation of the gene was used for early flowering and altered fatty acid composition in Arabidopsis or macadamia.

Images