Silk improved by using spider silk protein gene and method for improving silk by using spider silk protein gene

Abstract

The present invention discloses a silk improved by spider silk protein gene and a method for improving silk by spider silk protein gene, wherein the silk improved by spider silk protein gene comprises a silk protein light chain, and the silk protein light chain is connected with a spider silk protein formed by fusion expression with the silk protein light chain; the amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence. The present invention realizes the expression of the pear-shaped gland silk of Astilbe punctata in Bombyx mori silk fibroin, realizes the formation of a complete spider silk protein on the silk light chain, and expands the gene editing site of the silk gland of Bombyx mori. This light chain editing silkworm can be crossbred with the heavy chain gene editing silkworm, providing technical support for further breeding and optimization of fiber performance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to silk improved by using spider silk protein genes and a method for improving silk by using spider silk protein genes. Background Art

[0002] Spider silk is a type of protein fiber secreted by the spider's spinning glands. It is used by spiders to build spider webs or nests, capture and wrap prey, and make egg sheaths. Spiders in the suborder Neothera can generally secrete more than 6 types of spider silk, which have different functions: large ampullate silk (MaSp) serves as the support and "reinforcement structure" of the spider web and has superb strength. Small ampullate silk (MiSp) serves as a scaffold for spiders to rest on the spider web, achieving a balance between strength and ductility. Whip silk (Flag) is used to capture prey with adherent protein glue. It can provide extremely high ductility and will not break easily even if stretched to several times its length. Acroporate silk (AcSp) is used to wrap captured prey and can provide high toughness. Tubular gland silk (TuSp) is the silk thread that spiders use to wrap egg sacs. It has high hardness and certain waterproof properties. Finally, at the base of the ampullate silk attachment environment, or at the junction of the large ampullate silk threads, there is a entanglement of piriform silk (PySp), which in nature acts as an adhesive between the silk threads and has the properties of high toughness and high elasticity.

[0003] Different spider silk proteins have excellent properties. For example, the strength of the most studied large ampullate gland silk (MaSp) in the field of spider silk can reach 1.6GPa, and the toughness can reach 354MJ / m-3, which is 7 times that of Kevlar 49 fiber. It can be used in outdoor equipment, bulletproof vests, parachutes and other high-tensile force scenes. Other spider silks have also attracted much attention due to their superb ductility, toughness, elasticity and other properties. However, due to the carnivorous and cannibalistic characteristics of spiders, it is very difficult to carry out large-scale breeding. In addition, different spider silks are produced simultaneously on the spider web and the yields vary. It is difficult to separate different types of spider silk fibers. These limitations greatly affect the production capacity of spider silk fibers. In the past 20 years, people have used genetic engineering technology to use microbial chassis cells such as Escherichia coli and Saccharomyces cerevisiae to produce recombinant spider silk proteins, and these proteins can also be used for spinning. However, due to the limitations of their own expression systems, microorganisms find it difficult to express proteins exceeding 60KDa in large quantities, while the size of natural spider silk proteins is generally more than 300KDa. In natural silk proteins, a basic common sense is that the larger the protein and the more repeating regions, the better its physical properties. Therefore, these "mini spider silks" produced by recombinant expression cannot achieve properties close to those of natural silk threads, and are also difficult to produce on a large scale.

[0004] The silkworm (Bombyx mori) is a silk-spinning insect that has been domesticated in China for tens of thousands of years. It is an organism with a mature textile industry system and can carry large-scale silk production. Using gene editing technology, silkworms can be used as an excellent chassis for producing recombinant spider silk proteins. For example, the piggyBac transposase system used in the prior art has been used to express partial repeat sequences of large ampulla gland silk (MaSp), grape gland silk (AcSp) and pear-shaped silk (PySp) in silkworms and improve fiber performance. However, this expression method only expresses mini spider silk proteins or partial spider silk proteins less than 100kDa, and the silk thread finally produced is a blend of spider silk and silkworm silk, and its spider silk content is less than 10% on average. The transposase system randomly inserts spider silk sequences into the genome, which makes this gene-edited trait at risk of loss.

[0005] Compared with the instability of transposase, gene editing tools represented by TALEN and CRISPR-cas9 technology can accurately edit the silkworm genome to produce stable traits. Silk protein includes a heavy chain (~390kDa), a light chain (~26kDa) and glycoprotein P25, in which the heavy chain and light chain exist in a 1:1 ratio. However, since the light chain is very short, its fusion with a longer complete spider silk may affect the structure of silk, so the existing technology for silk-spider silk fusion gene editing technology is completed on the silk heavy chain. For example, it has been reported that the CRISPR-cas9 gene editing technology was used to insert the smaller MiSp complete sequence (5.3kb, about 170Kda) from the big-bellied garden spider into the heavy chain sequence to obtain a spider silk material with high toughness. However, there is currently a lack of relevant technologies for the fusion of silk light chain and spider silk protein.

[0006] In addition, the current research on recombinant spider silk expressed by gene-edited transgenic silkworms mainly focuses on the research of large ampullate silk (MaSp) and small ampullate silk (MiSp), and lacks research on the complete expression of pear-shaped silk (PySp). Pear-shaped silk was first regarded as a kind of sericin protein. Recent studies have shown that recombinant pear-shaped silk can be made into silk thread, and it has higher ductility (can be stretched 70%-200%) and higher toughness than other types of spider silk. If the complete pear-shaped silk protein can be produced and made into silk thread, superb mechanical properties will be obtained. Summary of the invention

[0007] The object of the present invention is to provide an improved silk by fusion-expressing spider silk protein on the silk protein light chain. The present invention is achieved by adopting the following technical solutions:

[0008] A silk modified by using a spider silk protein gene, wherein the silk modified by using a spider silk protein gene comprises a silk protein light chain, and the silk protein light chain is connected to a spider silk protein formed by fusion expression with the silk protein light chain;

[0009] The amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence.

[0010] Optionally, the amino acid sequence of the spider silk protein comprises, in sequence, a spider silk protein N-terminal sequence, a repeating region sequence having at least one spider silk protein repeating unit sequence, and a spider silk protein C-terminal sequence.

[0011] Optionally, the spider silk protein is Astilbe punctata silk protein;

[0012] The N-terminal sequence of the spider silk protein is the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence having at least 90% similarity to SEQ ID NO.1.

[0013] The spider silk protein repeating unit sequence is the amino acid sequence shown in SEQ ID NO.2, or an amino acid sequence having at least 90% similarity to SEQ ID NO.2.

[0014] The C-terminal sequence of the spider silk protein is the amino acid sequence shown in SEQ ID NO.3, or an amino acid sequence with at least 90% similarity to SEQ ID NO.3.

[0015] Optionally, the repeat region sequence is connected to the N-terminal sequence of the spider silk protein via an N-terminal linker sequence; the N-terminal linker sequence is the amino acid sequence shown in SEQ ID NO.4, or an amino acid sequence with at least 90% similarity to SEQ ID NO.4.

[0016] The repeat region sequence is connected to the C-terminal sequence of the spider silk protein through a C-terminal linker sequence; the C-terminal linker sequence is the amino acid sequence shown in SEQ ID NO.5, or an amino acid sequence with at least 90% similarity to SEQ ID NO.5.

[0017] Optionally, the amino acid sequence of the spider silk protein is an amino acid sequence shown by at least one of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, or a sequence with at least 90% similarity to at least one of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0018] Optionally, the nucleic acid sequence of the spider silk protein gene is an amino acid sequence shown in at least one of SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, or a sequence with at least 90% similarity to at least one of SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11.

[0019] A method for improving silk using spider silk protein genes comprises the following steps:

[0020] Step 1) constructing a Donor DNA vector for expressing a silk fibroin light chain-spider silk protein fusion gene in silkworms on a vector carrying a silk fibroin light chain gene homology arm; wherein the amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence;

[0021] Step 2) introducing the Donor DNA vector into silkworm eggs, and editing the gene encoding silk protein light chain in the genome of the silkworm eggs into a silk protein light chain-spider silk protein fusion gene through gene editing technology;

[0022] Step 3) After the gene-edited silkworm eggs are hatched, screened, and cultivated, the silk modified with the spider silk protein gene is obtained.

[0023] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is selected as a nucleotide sequence containing all exons of the silk protein light chain.

[0024] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence with at least one intron removed.

[0025] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence with all introns removed;

[0026] The nucleotide sequence of the Donor DNA vector in step 1) sequentially includes the light chain L1 N-terminal sequence, the light chain exon fusion sequence, the spider silk protein gene sequence, the silk light chain terminator, and the light chain C-terminal homology arm;

[0027] The light chain L1 N-terminal sequence is shown as SEQ ID NO.12; the light chain exon fusion sequence is shown as SEQ ID NO.13; the silk light chain terminator sequence is shown as SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown as SEQ ID NO.15.

[0028] Optionally, in the step 2), the gene encoding silk protein light chain in the genome of the silkworm egg is cut and edited using the first target site sequence and the second target site sequence;

[0029] The first target site sequence is GTAACCACATAACATCAGGT, and the second target site sequence is TTAGAACTCACATCTCAAGG.

[0030] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a complete silk protein light chain sequence including all exons and introns.

[0031] Optionally, the nucleotide sequence of the Donor DNA vector in step 1) sequentially comprises an L2 signal peptide and a light chain N-terminal sequence, a spider silk protein gene sequence, a silk light chain 3'UTR sequence, a silk light chain terminator, and a light chain C-terminal homology arm sequence;

[0032] The L2 signal peptide and light chain N-terminal sequence include silk protein light chain exon 6, silk protein light chain intron 6, and silk protein light chain exon 7;

[0033] The L2 signal peptide and light chain N-terminal sequence are shown in SEQ ID NO.16; the silk light chain 3'UTR sequence is shown in SEQ ID NO.17; the silk light chain terminator sequence is shown in SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown in SEQ ID NO.15.

[0034] Optionally, in the step 2), the gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using the first target site sequence and the second target site sequence;

[0035] The first target site sequence and the second target site sequence are the same, both are TTAGAACTCACATCTCAAGG.

[0036] Optionally, in the step 2), the CRISPR-cas9 system is used for gene editing, and the Donor DNA vector, the ptarget plasmid containing the first target site sequence and the second target site sequence, and the pCas9 plasmid for expressing cas9 are injected into silkworm eggs for gene editing;

[0037] Optionally, the nucleotide sequence of the Donor DNA vector further comprises a screening sequence between the silk light chain terminator and the light chain C-terminal homology arm sequence; the screening sequence comprises a nucleic acid sequence encoding a fluorescent protein.

[0038] Optionally, in the step 3), the silkworm eggs are hatched to obtain G0 generation silkworm seeds; the G0 generation silkworm seeds are raised, self-pollinated, silkworm eggs are collected to obtain G1 generation silkworm seeds, the endpoints of the silkworm eggs are observed under a fluorescence microscope, and eggs that emit fluorescence are selected for cultivation; after the selected silkworms are hatched, they are raised to the third instar, and the heads of the silkworms are observed under a fluorescence microscope to check whether they emit fluorescence; the G1 generation silkworm seeds that test positive are cultured into adults, self-pollinated, and silkworm eggs are collected to obtain G2 generation silkworm seeds; the G2 stage silkworms are cultured to adults, and the positively marked silkworms are selected for self-pollination to select homozygous G3 generation silkworms, and the G3 generation silkworms are used to obtain silk improved by the spider silk protein gene.

[0039] Compared with the prior art, the present invention has the following advantages and effects:

[0040] The present invention realizes the expression of Astilbe punctata pear-shaped gland silk in silkworm fibroin, realizes the formation of complete spider silk protein on the light chain of silk, and expands the gene editing sites of silkworm silk gland. This light chain edited silkworm can be crossbred with the heavy chain gene edited silkworm, providing technical support for further breeding and optimization of fiber performance.

[0041] The present invention can produce fibers with a complete spider pear-shaped gland silk structure. By testing sequences of different lengths, it is verified that the insertion of full-length spider silk improves the performance of silk. The present invention obtains fibers woven from the fusion protein of exon 7 of the light chain of the silkworm and the pear-shaped gland silk of Astilbe punctata, and the mechanical properties of the fibers are significantly improved compared with the control spider silk: the final fiber strength can reach 773.10MPa, which is 2.16 times that of the control, the fiber elongation can reach 28.17%, which is 1.59 times that of the control, and the toughness can reach 3.36 times that of the control silk. These performance data are very close to the performance of natural spider silk, which greatly improves the performance and application range of gene-edited silk. The present invention innovatively fuses the exons of the light chain together, and fuses the silk of the pear-shaped gland of Astilbe punctata, and the mechanical properties of the fiber are significantly improved compared with the control spider silk: the final fiber strength can reach 525.60MPa, which is 1.47 times that of the control, the fiber elongation can reach 30.78%, which is 1.73 times that of the control, and the toughness can reach 2.59 times that of the control silk. These performance data show that the fusion expression replacement method can also achieve a significant improvement in the performance of silk. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a schematic diagram of the design of the fusion of silk light chain protein and spider silk protein; Figure 1 A is a diagram of the overall design strategy of the fusion protein; Figure 1 B is the structure diagram of silk protein. Figure 1 C is the protein structure diagram of fusion expression.

[0043] Figure 2Example 1: Detection diagram of gene-edited silkworm genome;

[0044] Figure 3 Example 2 Stress-strain curve of gene-edited silkworm cocoon silk;

[0045] Figure 4 Example 2 Cocoon silk fluorescence observation image; Figure 4 a is the observation photo of the control silk, Figure 4 b is the observation photo of FibL1-DsRed gene-edited silk; Figure 4 c is a photo of the control silk observed under the excitation light; Figure 4 d is a photo of FibL1-DsRed gene-edited silk under excitation light; Figure 4 e is a magnified observation photo of the cross section of FibL1-DsRed gene-edited silk; Figure 4 f is a magnified observation photograph of the cross-section of FibL1-DsRed gene-edited silk under excitation light.

[0046] Figure 5 Example 3: Detection diagram of gene-edited silkworm genome;

[0047] Figure 6 Example 3 Stress-strain curve of gene-edited silkworm cocoon silk;

[0048] Figure 7 This is a comparison picture of silkworm pupae and cocoons. Figure 7 A is a comparison picture of silkworm pupae; Figure 7 B is a comparison picture of silkworm cocoons; Figure 7 C is a comparison chart of cocoon weight; Figure 7 D is a comparison chart of silk diameters. DETAILED DESCRIPTION

[0049] In order to make the purpose and technical solution of the present invention more clear, the present invention is further described in detail. The experimental methods described in the following examples are all conventional methods unless otherwise specified: if no specific techniques or conditions are specified in the examples, they are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions; the reagents and materials, unless otherwise specified, can be obtained from commercial channels.

[0050] The present invention provides a silk improved by using a spider silk protein gene, wherein the silk improved by using a spider silk protein gene comprises a silk protein light chain, and the silk protein light chain is connected to a spider silk protein formed by fusion expression with the silk protein light chain;

[0051] The amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence.

[0052] Furthermore, the amino acid sequence of the spider silk protein sequentially comprises a spider silk protein N-terminal sequence, a repeating region sequence having at least one spider silk protein repeating unit sequence, and a spider silk protein C-terminal sequence, that is, the spider silk protein is a complete spider silk protein comprising an N-terminal and a C-terminal.

[0053] The spider silk protein is specifically Astilbe maculatum pear-shaped gland silk protein.

[0054] The N-terminal sequence of the spider silk protein is shown in SEQ ID NO.1. The repeating unit sequence of the spider silk protein is shown in SEQ ID NO.2. The C-terminal sequence of the spider silk protein is shown in SEQ ID NO.3. The repeating region sequence is connected to the N-terminal sequence of the spider silk protein through the N-terminal linker sequence; the N-terminal linker sequence is shown in SEQ ID NO.4. The repeating region sequence is connected to the C-terminal sequence of the spider silk protein through the C-terminal linker sequence; the C-terminal linker sequence is shown in SEQ ID NO.5.

[0055] The present invention specifically proposes amino acid sequences in which the repeating region sequences have 3, 6, and 13 repeating units, respectively. The phytoprotein sequence of Astilbe punctata with an amino acid sequence of 3 repeating units is shown in SEQ ID NO.6, and its corresponding nucleic acid sequence is shown in SEQ ID NO.9. The phytoprotein sequence of Astilbe punctata with an amino acid sequence of 6 repeating units is shown in SEQ ID NO.7, and its corresponding nucleic acid sequence is shown in SEQ ID NO.10. The phytoprotein sequence of Astilbe punctata with an amino acid sequence of 13 repeating units is shown in SEQ ID NO.8, and its corresponding nucleic acid sequence is shown in SEQ ID NO.11.

[0056] According to the common knowledge in the art, the sequence of the amino acid repeat region of spider silk protein has a certain variability, that is, in most literature and patent disclosures, as long as the similarity of the spider silk core sequence is about 90%, the performance similar to the spider silk sequence can be obtained. We claim that this sequence and sequences with a similarity of more than 90% are protected by this patent.

[0057] Figure 1 A schematic diagram of the design of the fusion of silk light chain protein and spider silk protein is shown. Figure 1 A is the overall design strategy diagram of fusion protein. Silk light chain protein has 7 exons and the protein structure is as follows: Figure 1 As shown in B, the N-terminus, repeat region, and C-terminus of the spider silk protein are directly fused to the silk light chain. The predicted fusion structure is as follows Figure 1As shown in C, the predicted structure shows that the N-terminal structure of the silk light chain and the spider silk protein has not changed, and the spider silk N-terminal leader peptide forms a natural linker to separate the two proteins, so that the two proteins have relatively independent structures, and it can be predicted that their performance will remain consistent.

[0058] The present invention also proposes a method for improving silk using spider silk protein genes, comprising the following steps:

[0059] Step 1) constructing a Donor DNA vector for expressing the silk protein light chain-spider silk protein fusion gene in silkworms on a vector carrying a silk protein light chain gene homology arm;

[0060] The present invention proposes two construction methods, one is to retain all exons and introns of the silk light chain gene; the other is to modify the silk light chain gene and remove at least one intron. In order to be used for screening silkworms, a screening sequence for encoding fluorescent protein is also provided between the silk light chain terminator and the light chain C-terminal homology arm sequence in the nucleotide sequence of the Donor DNA vector.

[0061] Step 2) In the present invention, the CRISPR-cas9 system is used to cut the gene of silkworm, and the linearized Donor DNA and gene editing plasmid are mixed and injected into the eggs of silkworm. The pCas plasmid used in the present invention comes from the document DOI:10.1038 / srep04489. In fact, any cas9 expression vector suitable for silkworm or lepidopteran insects can be used in this scenario. Since the cutting needs to target 2 target sites, in addition to the vector encoding cas9, we also need to synthesize the ptarget vector. In fact, only the cutting needs to be completed at the target DNA, and any gene editing method can achieve this function. For example, TALEN nuclease, or ZFN zinc finger enzyme, or other DNA cutting methods (cas12a, Ago, etc.) can achieve the breakage of the target DNA. Once the DNA breakage at the corresponding site is completed, the Donor DNA can replace the original sequence by homologous recombination to complete the gene editing.

[0062] Step 3) hatching silkworm eggs to obtain G0 generation silkworm seeds; raising G0 generation silkworm seeds, self-pollinating, collecting silkworm eggs to obtain G1 generation silkworm seeds, observing the endpoints of silkworm eggs under a fluorescence microscope, and selecting and culturing eggs that emit fluorescence; after the selected silkworms are hatched, they are raised to the third instar, and the heads of the silkworms are observed under a fluorescence microscope to check whether they emit fluorescence; taking G1 generation silkworm seeds that test positive and culturing them into adults, self-pollinating, collecting silkworm eggs to obtain G2 generation silkworm seeds; culturing G2 stage silkworms to adults, selecting positively marked silkworms for self-pollination, and selecting homozygous G3 generation silkworms, and using the G3 generation silkworms to obtain silk improved by using spider silk protein genes.

[0063] Example 1

[0064] This example provides a specific scheme for the construction strategy of a fusion gene retaining all exons and introns of the silk light chain gene, and the operation steps are as follows:

[0065] Using PCR technology, Nephila pilipes genomic DNA was used as a template, and specific primers of the Pysp gene with restriction endonuclease BsmbⅠ were used to amplify Pysp with different repeating units, including 3 repeating unit structures, 6 repeating unit structures, and 13 repeating unit structures. The Pysp with different repeating units was digested with restriction endonuclease BsmbⅠ and ligated into a plasmid containing left and right homologous arms, a green fluorescent gene expression cassette driven by a 3×P3 promoter, and part of Bombyx mori silk fibroin light chain protein (FibL) exon 6, FibL intron 6, and FibL exon 7 to construct a Donor DNA vector plasmid.

[0066] Donor DNA was synthesized in the following order: MluI-L2 signal peptide and light chain N-terminal sequence-PySp spider silk sequence-silk light chain 3'UTR-silk light chain terminator-screening sequence-light chain C-terminal homology arm-MluI. MluI represents the MluI site. The L2 signal peptide and light chain N-terminal sequence are shown in SEQ ID NO.16; the silk light chain 3'UTR sequence is shown in SEQ ID NO.17; the silk light chain terminator sequence is shown in SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown in SEQ ID NO.15.

[0067] Screening sequence This sequence contains a 3xP3 promoter, a green fluorescent protein, and an SV40 terminator, and is used to screen whether the transgenic silkworm has completed gene editing. As shown in SEQ ID NO. 18. If the gene editing is completed and the sequence is successfully inserted, the silkworm moth is placed under green fluorescent excitation light for observation, and obvious green fluorescence will be displayed in the eyes of the silkworm moth.

[0068] The PySp spider silk nucleic acid sequences containing 3, 6, and 13 repeating units are shown in SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11, respectively. The Donor DNA sequence was synthesized at BGI on the pUC57 plasmid.

[0069] The sequence synthesized on the ptarget plasmid is shown in SEQ ID NO. 19, including the BmU6 promoter sequence, the target site sequence for light chain L2 cleavage, the gRNA scaffold sequence, and polyT, and the two target site sequences are both TTAGAACTCACATCTCAAGG. The above ptarget plasmid was synthesized at BGI.

[0070] Steps:

[0071] 1. Preparation of DNA for Microinjection

[0072] 1. Plasmids synthesized by the company: pCas9, ptarget1, ptarget2, Donor DNA

[0073] 2. Transformation: Pipette 5 μL of plasmid into 50 μL DH5α competent cells (TransGen), place on ice for 30 minutes, heat shock for 60 seconds, and let stand on ice for 5 minutes. Add 300 μL of antibiotic-free LB medium in a clean bench, cover tightly, and culture in a shaker for 1 hour. Set the shaker to 37°C and 200 rpm. Then, pipette 100 μL of medium onto an Amp-resistant LB plate and culture overnight in a 37°C incubator.

[0074] 3. On the second day, take out the plate, pick a single colony and place it in a 1.5mL EP tube, and culture it in a shaker at 37℃ and 200rpm for 5-6h.

[0075] 4. Take the above bacterial solution for PCR, detect the PCR product by agarose gel electrophoresis, determine the bacterial solution with the expected band, and expand the bacteria. Take an appropriate amount of 10mL centrifuge tubes, add 4mL of Amp-resistant LB liquid medium, and then inoculate 20μL of bacterial solution in 10mL centrifuge tubes respectively, and place them in a shaker at 37℃ and 200rpm for 16h.

[0076] 5. Use the endotoxin-free plasmid kit (TIANGEN) to extract the plasmid according to the instructions, with a concentration of 700ng / μL or above. (When mixing plasmids, the volume ratio of ptarget:Cas9:Donor DNA = 1:2:2)

[0077] 2. Obtaining and preparing silkworm eggs

[0078] 1. Hatching Nistarli silkworm eggs, raising them carefully after they hatch. The temperature is controlled at 26-27℃ and the humidity is 80%-90% for 1-2 instar silkworms; the temperature is controlled at 25-26℃ and the humidity is 70%-75% for 3-4 instar silkworms; the temperature is controlled at 23-24℃ and the humidity is about 70% for 5 instar silkworms. When the silkworms are on the cocoon, put them on the cocooning tools and wait for them to spin silk and make cocoons naturally.

[0079] 2. On the fifth day, you can cut open the cocoons, separate the male and female silkworm pupae, and place them separately to wait for them to emerge as moths.

[0080] 3. Brush the kraft paper with paste and let it dry.

[0081] 4. Place the moth circle on kraft paper, put the male and female moths into the moth circle in pairs, and mate in a bright environment at about 25℃ for 4-6 hours. After separating the pairs, let the female moth lay eggs in a dark environment, and use fresh silkworm eggs laid within 2-8 hours.

[0082] 5. Wet the kraft paper with fresh silkworm eggs with clean water. Use tweezers to pick up single eggs and arrange them neatly on a glass slide in an arrangement of 6×12 or 6×13 eggs. When picking up the eggs with tweezers, move them horizontally and do not flip them over. If you are worried that the eggs are not sticky enough, rub them back and forth on the kraft paper several times. Arrange the large diameter eggs vertically or in a "D" shape according to their elliptical shape.

[0083] 6. Perform microinjection on the arranged silkworm eggs.

[0084] IV. Selection and cultivation of G0 generation silkworms

[0085] 1. Place a moistened clean paper towel or cotton ball in the box to maintain humidity, and place it in the incubator to allow it to grow. Set the incubator conditions: 12 hours of light and 12 hours of darkness per day; temperature 26.5°C, humidity 80%.

[0086] 2. Check the status of silkworm eggs every day. Eggs showing signs of mold need to be disinfected with 75% alcohol in time.

[0087] 3. Collect the ants and feed the hatched larvae with leaves in time (choose the tenderest mulberry leaves with high water content), and mark and record them on the box.

[0088] 4. Carefully raise them until they form cocoons on the cocoon cluster, and after they emerge as moths, allow them to mate and lay eggs to obtain the G1 generation.

[0089] 5. Breeding of G1 Generation Silkworms

[0090] The G0 generation silkworm eggs were accelerated at 25°C and 85% humidity, raised to adults, and mated to obtain the G1 generation. After the G1 generation silkworms of the transgenic experiment were hatched, they were observed under a fluorescence microscope (Leica, LMD6, Germany) (the silkworm eggs could also be observed), and the transgenic positive silkworms expressing the fluorescent protein marker gene were screened and raised to adults. The transgenic silkworms were self-crossed and passed on to the G2 generation. Since the G2 generation, all gene-edited silkworms were self-crossed. During the egg stage, they were observed under a fluorescent stereo microscope, and gene-edited silkworms expressing the EGFP marker gene were selected, raised to adults, mated in the same moth area, and the Pysp gene was homozygous, and then the G3 and G4 generations were cultivated.

[0091] In the G3 generation, the silkworm genomic DNA was used as a template, and the target gene Pysp and the homologous arms on both sides were amplified by PCR. The amplified fragments were cloned and sequenced (such as Figure 2 The results showed that Pysp had been successfully inserted into the silkworm genome.

[0092] VI. Physical and chemical properties testing of transgenic silk fibers

[0093] The silk samples of the Pysp gene homozygous silkworms in the 3-repeat region, 6-repeat region, and 13-repeat region were obtained and recorded as 3-FibL2-Pysp, 6-FibL2-Pysp, and FibL2-Pysp, respectively.

[0094] Preparation of silk from transgenic silkworms: After degumming (0.02M sodium bicarbonate or sodium carbonate, bath ratio 2.5g:1L, 100°C boiling water bath for 5-10min), the silk from transgenic silkworms is obtained by reeling (reeling machine).

[0095] Sample preparation method: Use A4 paper to make a hollow square cardboard frame, the length and width of the inner frame are both 2cm. Use a 1cN tension clamp to fix the single fiber on the cardboard frame and fix it with glue. After the upper and lower clamps fix the paper frame, cut the crease of the cardboard and stretch it. Use a universal tensile testing machine (Instron 5967 / 3365, USA) to test the mechanical properties of the silk fiber. The test environment temperature is 24°C, the relative humidity is 50%, the stretching distance is 20mm, the stretching speed is 20mm / min, and the tension is 0.5N. Test 150 parallel samples in each group, obtain at least 100 valid data, and calculate the average and standard deviation of the stress and strain after stretching.

[0096] The results of mechanical properties test of gene-edited silkworm silk are as follows: Figure 3 As shown, the mechanical properties were significantly improved compared to the wild-type silkworm variety Nistari used as a control without the introduction of any plasmid or auxiliary plasmid.

[0097] Table 1 Example 1 Determination results of mechanical properties of gene-edited silkworm cocoon silk

[0098]

[0099]

[0100] The above results prove that the Pysp gene has been inserted into the chromosome of the gene-edited silkworm genome, and can synthesize and secrete Pysp protein in the silk gland cells of the silkworm. The protein can enter the cocoon with the spinning and cocooning behavior. This trait has been stably inherited and expressed, and the mechanical properties of the gene-edited silk have been significantly improved. The final fiber strength can reach 773.10MPa, which is 2.16 times that of the control, the fiber elongation can reach 28.17%, which is 1.59 times that of the control, and the toughness can reach 3.36 times that of the control silk. These performance data are very close to the performance of natural spider silk, achieving a significant improvement in the performance of silk.

[0101] Embodiment 2:

[0102] This example proposes a specific scheme for constructing a fusion gene to remove introns in the silk protein light chain. The operation steps are as follows:

[0103] First, the silk protein light chain exon light chain fusion gene was constructed and verified, including the following steps:

[0104] 1. Based on the reported red fluorescent protein (DsRed2) sequence as shown in SEQ ID NO.20, the gene was artificially synthesized and cloned into a plasmid containing left and right homologous arms and exon 1-7 (extron1-7) expression frames of silk fibroin light chain (FibL) to construct pMD4-FibL1-DsRed.

[0105] Specifically, Donor DNA is synthesized in the following order: MluI-light chain L1 N-terminal sequence-light chain exon 1-7 fusion sequence-red fluorescent protein sequence-silk light chain terminator-C-terminal homology arm-MluI. MluI represents the MluI site. The light chain L1 N-terminal sequence is shown in SEQ ID NO.12; the light chain exon fusion sequence is shown in SEQ ID NO.13; the silk light chain terminator sequence is shown in SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown in SEQ ID NO.15.

[0106] The ptarget plasmid includes a first ptarget site and a second ptarget site. The sequence synthesized on the first ptarget site is shown in SEQ ID NO.21, including the BmU6 promoter sequence, the target site sequence for light chain L1 cutting, the gRNA scaffold sequence, and polyT, and its target site sequence is GTAACCACATAACATCAGGT. The sequence synthesized on the second ptarget site is shown in SEQ ID NO.22, including the BmU6 promoter sequence, the target site sequence for light chain L1 cutting, the gRNA scaffold sequence, and polyT, and its target site sequence is TTAGAACTCACATCTCAAGG. The above-mentioned ptarget plasmid was synthesized at BGI.

[0107] 2. Mix the Donor DNA plasmid, Cas9 plasmid and ptarget plasmid in a molar ratio of 2:2:1 to prepare a microinjection solution with a final concentration of 200-350 ng / μL for Donor DNA plasmid and 100-150 ng / μL for ptarget plasmid, and then use the microinjection method to introduce the newly laid eggs of the wild-type silkworm variety N4. The microinjected silkworm eggs were raised to adults at 25°C and 85% humidity, and then hybridized with wild-type silkworms to pass down the G1 generation.

[0108] 3. G1 generation gene-edited positive silkworm cocoons were selected and observed using a stereo fluorescence microscope (Nikon, SMZ18, Japan). The results showed that red fluorescence was observed in the gene-edited silkworms compared with the wild-type silkworm variety N4 used as a control without any plasmid or auxiliary plasmid. Figure 4 shown.

[0109] The above results prove that the DsRed2 gene has been inserted into the chromosome of the gene-edited silkworm genome, and can synthesize and secrete DsRed2 protein in the silk gland cells of the silkworm. The protein can enter the cocoon during the spinning and cocooning behavior. This trait has been stably inherited and expressed, and red fluorescence can be observed in the gene-edited silkworm silk. This result shows that in addition to adding directly to the exon 7 of the original silk light chain, the entire light chain exon can also be used to fuse foreign proteins to replace the original silkworm light chain sequence. This method also allows the gene-edited silkworm to spin silk normally and retains the activity of foreign proteins in the fused silk protein, providing a new strategy for silkworm light chain gene editing.

[0110] Based on the above exon fusion sequence, this embodiment provides a fusion gene construction strategy for removing introns in the silk protein light chain, as follows:

[0111] Using PCR technology, the genomic DNA of the spotted widow spider (Nephila pilipes) was used as a template, and specific primers of the piriformis silk protein (Pysp) gene with an MluI restriction site were used to amplify the full-length Pysp sequence. It was then cut with MluI and connected to a plasmid containing left and right homologous arms, a green fluorescent gene expression frame driven by a 3×P3 promoter, and exons 1-7 of the silk fibroin light chain protein (FibL) of the silkworm to construct the gene editing plasmid PMD4-FibL1-Pysp.

[0112] Donor DNA was synthesized in the following order: MluI-light chain L1 N-terminal sequence-light chain CDS-PySp spider silk sequence-silk light chain terminator-screening sequence-C-terminal homology arm-MluI. The light chain L1 N-terminal sequence is shown in SEQ ID NO.12; the light chain exon fusion sequence is shown in SEQ ID NO.13; the silk light chain terminator sequence is shown in SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown in SEQ ID NO.15.

[0113] Screening sequence This sequence contains a 3xP3 promoter, a green fluorescent protein, and an SV40 terminator, and is used to screen whether the transgenic silkworm has completed gene editing. If the gene editing is completed and the sequence is successfully inserted, the silkworm moth will be placed under green fluorescent excitation light for observation, and obvious green fluorescence will be displayed in the eyes of the silkworm moth. The sequence is shown in SEQ ID NO.18.

[0114] The nucleic acid sequence of PySp spider silk containing 13 repeating units is shown in SEQ ID NO. 11. The Donor DNA sequence was synthesized at BGI on the pUC57 plasmid.

[0115] The ptarget plasmid includes a first ptarget site and a second ptarget site. The sequence synthesized on the first ptarget site is shown in SEQ ID NO.21, including the BmU6 promoter sequence, the target site sequence for light chain L1 cutting, the gRNA scaffold sequence, and polyT, and its target site sequence is GTAACCACATAACATCAGGT. The sequence synthesized on the second ptarget site is shown in SEQ ID NO.22, including the BmU6 promoter sequence, the target site sequence for light chain L1 cutting, the gRNA scaffold sequence, and polyT, and its target site sequence is TTAGAACTCACATCTCAAGG. The above-mentioned ptarget plasmid was synthesized at BGI.

[0116] The gene editing operation was performed according to the above method to cultivate transgenic silkworms.

[0117] In the G3 generation, the genomic DNA of silkworm moth was used as a template, and the target gene Pysp and the homologous arms on both sides were amplified by PCR, and the amplified fragments were cloned and sequenced. Figure 5 As shown, the results showed that Pysp had been successfully inserted into the silkworm genome.

[0118] Obtain gene-edited silkworm silk FibL1-Pysp, and the results of mechanical properties of FibL1-Pysp are as follows Figure 6 As shown in Table 2, the mechanical properties are significantly improved compared to the wild-type silkworm variety Nistari used as a control without any plasmid or auxiliary plasmid. The final fiber strength can reach 525.60MPa, which is 1.47 times that of the control, the fiber elongation can reach 30.78%, which is 1.73 times that of the control, and the toughness can reach 2.59 times that of the control silk. These performance data show that the fusion expression replacement method can also achieve a significant improvement in silk performance.

[0119] Table 2 Example 2 Determination results of mechanical properties of gene-edited silkworm cocoon silk

[0120]

[0121] The above results prove that the Pysp gene has been inserted into the chromosome of the gene-edited silkworm genome, and can synthesize and secrete pear-shaped glandular silk protein in the silk gland cells of the silkworm. This protein can enter the cocoon along with the silk-spinning behavior. This trait has been stably inherited and expressed, and the mechanical properties of gene-edited silk have been significantly improved.

[0122] Take two silkworm pupa and cocoon samples from Example 1 and Example 2 respectively to observe their morphology. Figure 7 As shown, WT represents the control group without genetic modification. The appearance of silkworm pupae and cocoons has no obvious change compared with those of genetically modified ones, indicating that the mechanical properties of the silk modified by spider silk genes in the present invention are greatly improved without obvious changes in appearance.

[0123] In addition, it should be noted that the above are only preferred embodiments of the present invention and are not limited to the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions recorded in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A silk modified by using spider silk protein gene, characterized in that: The silk modified by the spider silk protein gene comprises a silk protein light chain, and the silk protein light chain is connected to a spider silk protein formed by fusion expression with the silk protein light chain; The amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence; The spider silk protein is Astilbe punctata silk protein; the repeating unit sequence of the spider silk protein is the amino acid sequence shown in SEQ ID NO.2, or an amino acid sequence with at least 90% similarity to SEQ ID NO.

2.

2. The silk modified by using spider silk protein gene according to claim 1, characterized in that: The amino acid sequence of the spider silk protein sequentially comprises a spider silk protein N-terminal sequence, a repeating region sequence having at least one spider silk protein repeating unit sequence, and a spider silk protein C-terminal sequence.

3. The silk modified by using spider silk protein gene according to claim 2, characterized in that: The spider silk protein is Astilbe punctata silk protein; The spider silk protein N-terminal sequence is the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence having at least 90% similarity to SEQ ID NO.1; The C-terminal sequence of the spider silk protein is the amino acid sequence shown in SEQ ID NO.3, or an amino acid sequence with at least 90% similarity to SEQ ID NO.

3.

4. The silk modified by using spider silk protein gene according to claim 3, characterized in that: The repeat region sequence is connected to the N-terminal sequence of the spider silk protein through an N-terminal linker sequence; the N-terminal linker sequence is the amino acid sequence shown in SEQ ID NO.4, or an amino acid sequence with at least 90% similarity to SEQ ID NO.4; The repeat region sequence is connected to the C-terminal sequence of the spider silk protein through a C-terminal linker sequence; the C-terminal linker sequence is the amino acid sequence shown in SEQ ID NO.5, or an amino acid sequence with at least 90% similarity to SEQ ID NO.

5.

5. The silk modified by using spider silk protein gene according to claim 1, characterized in that: The amino acid sequence of the spider silk protein is at least one of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, or a sequence having at least 90% similarity to at least one of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.

8.

6. The silk modified by using spider silk protein gene according to claim 1, characterized in that: The nucleic acid sequence of the spider silk protein gene is an amino acid sequence shown in at least one of SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, or a sequence having at least 90% similarity to at least one of SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.

11.

7. A method for improving silk using spider silk protein genes, characterized in that: The steps include: Step 1) constructing a Donor DNA vector for expressing a silk fibroin light chain-spider silk protein fusion gene in silkworms on a vector carrying a silk fibroin light chain gene homology arm; wherein the amino acid sequence of the spider silk protein comprises a repeating region sequence having at least one spider silk protein repeating unit sequence; Step 2) introducing the Donor DNA vector into silkworm eggs, and editing the gene encoding silk protein light chain in the genome of the silkworm eggs into a silk protein light chain-spider silk protein fusion gene through gene editing technology; Step 3) hatching, screening, and cultivating the silkworm eggs after gene editing to obtain the silk modified by the spider silk protein gene; The spider silk protein is Astilbe punctata silk protein; the repeating unit sequence of the spider silk protein is the amino acid sequence shown in SEQ ID NO.2, or an amino acid sequence with at least 90% similarity to SEQ ID NO.

2.

8. The method for improving silk using spider silk protein gene according to claim 7, characterized in that: The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is selected as a nucleotide sequence containing all exons of the silk protein light chain.

9. The method for improving silk using spider silk protein gene according to claim 8, characterized in that: The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence with at least one intron removed.

10. The method for improving silk using spider silk protein gene according to claim 9, characterized in that: The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence with all introns removed; The nucleotide sequence of the Donor DNA vector in step 1) sequentially includes the light chain L1 N-terminal sequence, the light chain exon fusion sequence, the spider silk protein gene sequence, the silk light chain terminator, and the light chain C-terminal homology arm; The light chain L1 N-terminal sequence is shown as SEQ ID NO.12; the light chain exon fusion sequence is shown as SEQ ID NO.13; the silk light chain terminator sequence is shown as SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown as SEQ ID NO.

15.

11. The method for improving silk using spider silk protein gene according to claim 9, characterized in that: In the step 2), the gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using the first target site sequence and the second target site sequence; The first target site sequence is GTAACCACATAACATCAGGT, and the second target site sequence is TTAGAACTCACATCTCAAGG.

12. The method for improving silk using spider silk protein gene according to claim 8, characterized in that: The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a complete silk protein light chain sequence including all exons and introns.

13. The method for improving silk using spider silk protein gene according to claim 12, characterized in that: The nucleotide sequence of the Donor DNA vector in step 1) sequentially comprises an L2 signal peptide and a light chain N-terminal sequence, a spider silk protein gene sequence, a silk light chain 3'UTR sequence, a silk light chain terminator, and a light chain C-terminal homology arm sequence; The L2 signal peptide and light chain N-terminal sequence include silk protein light chain exon 6, silk protein light chain intron 6, and silk protein light chain exon 7; The L2 signal peptide and light chain N-terminal sequence are shown in SEQ ID NO.16; the silk light chain 3'UTR sequence is shown in SEQ ID NO.17; the silk light chain terminator sequence is shown in SEQ ID NO.14; and the light chain C-terminal homology arm sequence is shown in SEQ ID NO.

15.

14. The method for improving silk using spider silk protein gene according to claim 12, characterized in that: In the step 2), the gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using the first target site sequence and the second target site sequence; The first target site sequence and the second target site sequence are the same, both are TTAGAACTCACATCTCAAGG.

15. The method for improving silk using spider silk protein gene according to claim 9 or 12, characterized in that: The nucleotide sequence of the Donor DNA vector also has a screening sequence between the silk light chain terminator and the light chain C-terminal homology arm sequence; the screening sequence contains a nucleic acid sequence encoding a fluorescent protein.

16. The method for improving silk using spider silk protein gene according to claim 15, characterized in that: In the step 3), the silkworm eggs are hatched to obtain G0 generation silkworm seeds; the G0 generation silkworm seeds are raised, cultured into adults, and self-pollinated, silkworm eggs are collected to obtain G1 generation silkworm seeds, the endpoints of the silkworm eggs are observed under a fluorescence microscope, and eggs that emit fluorescence are selected for cultivation; after the selected silkworms are hatched, they are raised to the third instar stage, and the heads of the silkworms are observed under a fluorescence microscope to check whether they emit fluorescence; G1 generation silkworm seeds that test positive are cultured into adults, self-pollinated, and silkworm eggs are collected to obtain G2 generation silkworm seeds; G2 stage silkworms are cultured to adults, and positively marked silkworms are selected for self-pollination to select homozygous G3 generation silkworms, and the G3 generation silkworms are used to obtain silk improved by spider silk protein genes.

Images