A strain of Rhizopus delbrueckii producing multiple pyrazines and its screening and cultivation method and application

Abstract

The present invention relates to a strain of Rhizopus delbrueckii that produces multiple pyrazines. Rhizopus delemar ) strains and screening and cultivation methods and applications thereof, the said Dale Rhizopus strain producing multiple pyrazines is named JSY-F002 strain, the deposited unit is China Center for Type Culture Collection (CCTCC), the deposited time is March 20, 2024, and the deposited number is CCTCC No.M 2024533. Through headspace solid phase microextraction combined with comprehensive two-dimensional gas chromatography-time of flight mass spectrometry (HS-SPME-GC×GC-TOFMS) detection and analysis, the strain can produce nearly 9 pyrazine substances after high temperature culture on wheat / barley / pea raw material culture medium, and is a good flavor strain, which is used in the process of liquor koji making or related fermented food brewing, solving the problem of insufficient functional flavor strain resources in the field of liquor koji making and traditional fermented food brewing.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial fermentation, and specifically relates to a strain of Rhizopus delavirdii that produces multiple pyrazines ( Rhizopus delemar ) strains and their screening, culture methods and applications. Background Art

[0002] Pyrazines are six-membered heterocyclic compounds containing nitrogen at the 1 and 4 positions. Pyrazines are classified into different types according to the different substituents on the four carbon atoms on the six-membered heterocyclic ring of pyrazine. There are more than 70 known alkylated pyrazines. 2,6-Dimethylpyrazine, trimethylpyrazine and 2-ethyl-3,5-dimethylpyrazine are representative pyrazines and their derivatives, which have characteristic aromas similar to fried nuts, roasted peanuts, and barbecue, and are widely used in light industry and medicine.

[0003] In the medical field, pyrazines are structural units of many antibiotics, neurological drugs and anticancer drugs, and usually have analgesic, antibacterial and antiviral activities. At the same time, pyrazines have nutritional and health functions, such as pyrazine nucleotides, which can enhance immunity, regulate blood pressure and lower blood sugar; tetramethylpyrazine, which has the effects of dilating blood vessels, improving microcirculation and inhibiting platelet aggregation. Secondly, in the industrial field, pyrazines are also widely used, such as pyrazine red is a commonly used red dye; carbazole is a commonly used sunscreen; pyrazine diol is a commonly used moisturizer. In addition, in the field of traditional fermented foods in China, pyrazines have the effect of enhancing flavor. For example, white wine contains a large amount of pyrazines, and the pyrazine component in the aroma components of sauce-flavored white wine is higher than that of other flavors, which is one of the main flavor components; among the flavor components of high-salt dilute soy sauce, pyrazines have a low aroma threshold in the air (range: 0.01-3ng / L), which makes an outstanding contribution to the flavor of soy sauce.

[0004] At present, most of the patented strains producing pyrazine compounds used in traditional fermented foods are bacteria, a small number are yeasts, and filamentous fungi are reported the least. For example, CN115386525B discloses a strain of Bacillus subtilis that can produce tetramethylpyrazine in fermented materials or fermented foods; CN113999799B discloses a strain of Bacillus amyloliquefaciens used for liquor brewing, which has the ability to produce high acid-resistant α-amylase activity and high yield of tetramethylpyrazine and other sauce-flavored flavors; CN113817650B discloses a strain of thermophilic actinomycetes that produces flavor components such as tetramethylpyrazine, trimethylpyrazine, 2,5-dimethylpyrazine, and 2,3-dimethylpyrazine; CN113583902B discloses a strain of Bacillus licheniformis that produces high tetramethylpyrazine; CN112662597B discloses a strain of Bacillus pumilus that produces high trimethylpyrazine and tetramethylpyrazine, etc. Yeast, such as CN115747085B discloses a Kazakh yeast strain that produces multiple pyrazines and its application; CN114480150B discloses a salt-tolerant yeast strain that increases the content of pyrazine compounds in soy sauce and its application; CN113215007B discloses a highly acid-tolerant Schizosaccharomyces pombe strain that helps to increase the production of tetramethylpyrazine.

[0005] However, molds are also indispensable in the brewing of traditional fermented foods (soy sauce, vinegar, and liquor), providing amylase, saccharifying enzyme, protease, lipase, and cellulase. During the fermentation process, the type, quantity, and proportion of molds directly affect the flavor and quality of the final product. More importantly, the Liquor Industry Terminology stipulates that liquor shall not directly or indirectly add color, aroma, and flavor substances that are not produced by its own fermentation.

[0006] Therefore, screening functional filamentous fungi of pyrazine substances and strengthening their application in the brewing process of liquor koji or related fermented foods, and regulating the growth and metabolism of microorganisms towards the synthesis of pyrazine substances are of great significance for increasing the content of pyrazine compounds in the product and thus improving the flavor quality. Summary of the invention

[0007] The purpose of the present invention is to provide a strain of Rhizopus deltoides that produces multiple pyrazines, and a screening and cultivation method and application thereof. The Rhizopus deltoides strain can produce nearly 9 pyrazine substances after high-temperature cultivation on a wheat / barley / pea raw material culture medium, thereby solving the problem of insufficient functional flavor strain resources in the field of liquor koji making and traditional fermented food brewing.

[0008] To achieve the purpose of the present invention, the present invention adopts the following technical scheme: a strain of Dale Rhizopus ( Rhizopus delemar) strain, named JSY-F002 strain, deposited by China Center for Type Culture Collection (CCTCC), with accession number CCTCC No. M 2024533, deposit date March 20, 2024, and deposit address: Wuhan University Collection Center, Wuhan, China.

[0009] Wherein, the pyrazine is: 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2-methylpyrazine, 2,6-dimethylpyrazine, 2,5-dimethylpyrazine, 2,3-dimethylpyrazine, 2-ethyl-6-methylpyrazine, 3-ethyl-2,5-methylpyrazine, pyrazine.

[0010] Wherein, the screening and culturing method of the Rhizopus delbrueckii strain producing multiple pyrazines as described above comprises the following steps:

[0011] (1) Mix the Daqu sample with sterile physiological saline to obtain a bacterial suspension;

[0012] (2) diluting the bacterial suspension obtained in step (1) in a gradient manner and applying the dilution on a sterile solid culture medium for culturing to obtain colonies;

[0013] (3) Pick the hyphae at the edge of the colony in step (2), separate and purify them on a sterile solid culture medium to obtain a single pure colony, and then screen out the Dale strain that produces multiple pyrazines.

[0014] Preferably, in step (1), the Daqu is high-temperature Daqu produced by Jiangsu Jinshiyuan Wine Industry Co., Ltd.

[0015] Preferably, in step (2) and step (3), the solid culture medium is BM solid culture medium, comprising 2.5 g / L lignin, 10 g / L yeast extract, 20 g / L glucose, 15 g / L agar, the solvent is water, and the pH value is 7.0.

[0016] Preferably, in step (3), the separation and purification method is: picking hyphae at the edge of the colony in step (2), and performing streak culture on a sterile solid culture medium for 6-8 times to achieve separation and purification.

[0017] Preferably, in step (3), the screening includes determination of pyrazine species produced and molecular biological identification.

[0018] Preferably, the method for determining the type of pyrazine produced is: picking a single colony for liquid culture, preparing seed liquid, inoculating it on a wheat / barley / pea raw material culture medium, and after high-temperature culture at 60°C, detecting and analyzing the product by HS-SPME-GC×GC-TOFMS.

[0019] Preferably, the molecular biological identification method is: identification using an ITS rDNA sequence method, and the primer sequences of the Rhizopus delbrueckii strain are: ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0020] The advantages of the present invention are:

[0021] 1. The strain JSY-F002 was screened from the Jinshiyuan Daqu sample, which showed good flavor characteristics. After high-temperature culture on wheat / barley / pea raw material culture medium, it metabolized and produced nearly 9 pyrazine substances, including 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2-methylpyrazine, 2,6-dimethylpyrazine, 2,5-dimethylpyrazine, 2,3-dimethylpyrazine, 2-ethyl-6-methylpyrazine, 3-ethyl-2,5-methylpyrazine, and pyrazine. The product had a prominent aroma, indicating that the strain had good research and application potential in food fermentation and liquor brewing.

[0022] 2. It also produces flavor factors such as ethyl acetate, ethyl caproate, acetoin, and phenylethyl alcohol, which can improve the flavor quality of products during the process of making liquor or related fermented foods.

[0023] 3. The screening and culturing method of the Rhizopus delbrueckii strain producing multiple pyrazines of the present invention is simple in process and is suitable for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Colony morphology of JSY-F002 strain;

[0025] Figure 2 : Phylogenetic tree of JSY-F002 strain;

[0026] Figure 3 : Radar chart of sensory evaluation of fermentation products of JSY-F002 strain;

[0027] Figure 4 : Chromatogram of flavor substances produced by JSY-F002 strain.

[0028] Biomaterial deposit information: The strain JSY-F002 of the present invention belongs to Rhizopus delavayi ( Rhizopus delemar ), the preservation unit is China Center for Type Culture Collection (CCTCC), the preservation time is March 20, 2024, the preservation number is CCTCC No. M 2024533, and the preservation address is: Wuhan University Collection Center, Wuhan, China. DETAILED DESCRIPTION

[0029] The technical scheme of the present invention is further illustrated by specific examples below. Those skilled in the art should understand that the examples are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0030] The Daqu used in the following examples comes from the high-temperature Daqu produced by Jiangsu Jinshiyuan Wine Industry Co., Ltd.

[0031] Example 1: Screening and culturing a strain of Rhizopus deltoides that produces multiple pyrazines according to the following steps

[0032] (1) Grinding the high-temperature Daqu into powder using a pulverizer;

[0033] (2) Weigh 10 g of the Daqu powder obtained in step (1) and mix it with 90 mL of sterile saline to obtain a bacterial suspension, and incubate it in a constant temperature shaker at 30°C and 150 r / min for 30 min; the sterile saline is prepared by weighing 9 g of sodium chloride and adding it to 1000 mL of distilled water, and sterilizing it at 121°C for 15 min;

[0034] (3) Dilute the bacterial suspension after incubation in step (2) to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 Gradient, 100 μL of each gradient dilution was spread on a sterile solid culture medium, and cultured in a constant temperature incubator at 30°C for 48 hours to obtain colonies; the solid culture medium was BM solid culture medium, including 2.5 g / L lignin, 10 g / L yeast extract, 20 g / L glucose, 15 g / L agar, and the solvent was water, with a pH of 7.0;

[0035] (4) picking up hyphae at the edge of the colony in step (3), isolating and purifying them on BM solid medium, and obtaining a single pure colony by streaking 6-8 times;

[0036] (5) The pure strain colony obtained in step (4) was selected and inoculated into 50 mL of PDA liquid culture medium, and the culture was carried out in a constant temperature shaker at 30°C and 150 r / min for 48 h to prepare seed liquid; 50 mL of seed liquid was inoculated into 1000 g of wheat / barley / pea raw material culture medium, and the culture was carried out at a constant temperature of 30°C for 24 h and then at a high temperature of 60°C for 72 h, and the product was subjected to pyrazine species detection and molecular biological identification, and finally a Dale Rhizopus strain JSY-F002 producing multiple pyrazines was obtained; the PDA liquid culture medium comprises: 30% potato extract powder and 2% glucose; the raw material culture medium comprises 1000 g of crushed raw material (passed through a 40-mesh sieve, and the proportion of the sieve material is in the range of 18-23%), and a water content of 35%; the raw material combination and ratio are: pure wheat, pure barley, pure pea, wheat and barley (7:2), wheat and pea (7:1), and wheat and barley and pea (7:2:1).

[0037] Example 2: Colony morphology observation and molecular biological identification of the Dale Rhizopus JSY-F002 strain screened in Example 1

[0038] 1. Morphological observation: Inoculate the JSY-F002 strain into solid culture medium and observe the morphological characteristics of the colonies after 72 h of culture. Figure 1 As shown, the hyphae of JSY-F002 grow prostrately and produce rhizoids that are fixed on the substrate. Sporangium stalks grow upward from the rhizoids, and sporangia are formed at the top. The hyphae are white and the sporangia are black or light brown.

[0039] 2. Molecular Biology Identification:

[0040] (1) Use the 10 Mmol NaOH alkaline solution lysis method. Pipette 100 μL of NaOH alkaline solution into a PCR tube, then use a sterile white gun tip (toothpick) to pick up a few pure colonies into the above tube, cover the lid, mark it, and put it into the PCR instrument for lysis.

[0041] (2) PCR amplification and sequencing: The rDNA sequence of JSY-F002 strain was amplified using universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). The PCR product was detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The phylogenetic tree is shown in Figure 2. Figure 2 shown.

[0042] The PCR amplification system was as follows: 0.5 µL each of ITS1 and ITS4 primers, 12.5 µL 2 × premix Taq mix, 10.5 µL ddH2O, and 1 µL genomic DNA template.

[0043] PCR amplification program: 94 ℃ pre-denaturation for 4 min, 35 cycles including 94 ℃ denaturation for 40 s, 55 ℃ annealing for 50 s, 72 ℃ extension for 40 s, and finally 72 ℃ extension for 4 min; NCBI sequence alignment: alignment found that JSY-F002 was similar to Rhizopus delavirdii ( Rhizopus delemar ) had the highest similarity; combining morphological and molecular biological characteristics, JSY-F002 was identified as Rhizopus dauricus.

[0044] The sequence of the JSY-F002 strain is:

[0045] >TCTTAGTACTGCGGAGACATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTG GTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGA GTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTAATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGG CTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTCTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGCAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAAAAGCCGGAAGGAAA

[0046] (3) Preservation: The JSY-F002 strain was submitted to the China Center for Type Culture Collection (CCTCC) for preservation on March 20, 2024, with the preservation number CCTCC No. M 2024533. The preservation address is: Wuhan University Collection Center, Wuhan, China.

[0047] Example 3: Aroma evaluation of the fermentation product of the JSY-F002 strain screened in Example 1 and identified in Example 2

[0048] The JSY-F002 strain was inoculated on a wheat / barley / pea raw material culture medium and cultured at 60°C. The detailed culture method is shown in Example 1. A total of 7 professional wine tasters and technical R&D personnel of the company were invited to conduct aroma evaluation to examine the grain aroma, baking aroma, aromatic, herbal aroma, sauce aroma, and sweet aroma index of the fermentation product (score 0-10 points).

[0049] The scoring results are shown in Table 1, and the radar comparison chart is shown in Figure 3 As shown, the fermentation product of the strain of the present invention has a significant roasted aroma and has a sauce aroma, grain aroma and fragrance, which fully reflects the potential of the strain of the present invention in improving the flavor and aroma of the fermentation product.

[0050] Table 1 Aroma evaluation of fermentation products of JSY-F002 strain

[0051]

[0052] Example 4: Analysis of flavor substances produced by the JSY-F002 strain screened in Example 1 and identified in Example 2

[0053] The JSY-F002 strain was inoculated on a wheat / barley / pea raw material culture medium and cultured at 60°C. The detailed culture method is shown in Example 1. 2 g of the product was placed in a 20 mL headspace sample bottle and the sample bottle was tightened. The extraction head was aged at 210°C for 30 min and then inserted into the sample bottle, equilibrated at 50°C for 10 min, extracted for 45 min, and the extraction head was desorbed at 210°C at the GC injection port for 5 min.

[0054] SPME extraction tip: Supelco, 50 / 30um DVB / CAR / PDMS, Stableflex (2 cm).

[0055] Chromatographic conditions: The chromatographic column was a DB-WAX elastic quartz fiber capillary column (60 m×0.25 mm, 0.25 μm); the temperature program was: 50 ℃ for 4 min, increased to 80 ℃ at 4 ℃ / min, maintained for 0 min, increased to 210 ℃ at 8 ℃ / min, maintained for 15 min; the carrier gas (He, 99.999%) flow rate was 1.0 mL / min, and the injection was non-split.

[0056] Mass spectrometry conditions: electron bombardment ion source; electron bombardment energy 70 eV; transfer line temperature 250 °C; ion source temperature 200 °C; mass scan range m / z 35-500.

[0057] After GC-MS flavor analysis, the JSY-F002 strain produced a large amount of flavor substances ( Figure 4 ), which contains many pyrazines (Table 2) and other flavor factors (Table 3); among them, pyrazines are characterized by flavors such as roasted potatoes, fried peanuts, walnuts, nuts, and soil, and have chocolate and cocoa flavors. They are also allowed to be used as edible spices according to GB2760-86 of my country, and are widely used in the preparation of meat, beverages, chocolate, popcorn, pudding and other foods; other flavor factors, such as acetoin, have the aroma of butter and are important precursors of tetramethylpyrazine; ethyl acetate is a clear and slightly fruity wine aroma, which is an indispensable flavor component in liquor and the main raw material of fruit flavors such as pineapple and strawberry and flavors such as cream; phenylethanol has the floral aroma of roses and is the most important aroma substance in rice-flavor liquor; ethyl caproate is the main aroma of Chinese strong-flavor liquor, and its content plays a decisive role in the quality of liquor. It has a strong fruity and cellar aroma, giving strong-flavor liquor a unique flavor.

[0058] Table 2 Statistics of pyrazines produced by strain JSY-F002

[0059]

[0060] Table 3 Statistics of other flavor factors produced by JSY-F002 strain

[0061]

[0062] It can be seen that after high-temperature culture on wheat / barley / pea raw material culture medium, the strain of the present invention not only produces nearly 9 pyrazine substances, but also produces other flavor factors such as ethyl acetate, ethyl caproate, acetoin, phenylethanol, etc., showing good flavor characteristics, and has great application value in the process of liquor koji making or related fermented food brewing.

Claims

1. A strain of Rhizopus delavayi producing multiple pyrazines ( Rhizopus delemar )JSY-F002, characterized by, It was deposited in the China Center for Type Culture Collection on March 20, 2024, with the accession number CCTCC No. M 2024533.

2. The use of a strain of Rhizopus delbrueckii JSY-F002 producing multiple pyrazines as claimed in claim 1, characterized in that: Used in the process of making liquor koji.

Images