A highly virulent Klebsiella pneumoniae rpoE gene deleted strain and its application in preparing attenuated live vaccine

By knocking out the rpoE gene of Klebsiella pneumoniae, a live attenuated vaccine was constructed, which solved the problem of insufficient protection of hvKP by the existing vaccine, achieved efficient immune protection against hvKP, reduced its pathogenicity and provided broad market application prospects.

CN118562700BActive Publication Date: 2025-08-15GENERAL HOSPITAL OF NUCLEAR IND
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410765240.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-14
Publication Date
2025-08-15
Estimated Expiration
2044-06-14

AI Technical Summary

Technical Problem

Existing vaccines lack effective protection against Klebsiella pneumoniae (hvKP), and existing vaccines cannot effectively reduce their drug resistance and pathogenicity. In particular, infections of Klebsiella pneumoniae lack a safe and efficient live attenuated vaccine.

Method used

The rpoE gene of Klebsiella pneumoniae was knocked out by Red homologous recombination method, and a rpoE gene deletion strain of Klebsiella pneumoniae was constructed, and a live attenuated vaccine was prepared, combined with pharmaceutically accepted adjuvant, and a live attenuated vaccine was used to prepare a live attenuated vaccine.

Benefits of technology

It significantly reduces the pathogenicity of hvKP, reduces the number of colonization and lung damage in the internal organs of mice, provides a higher immune protection, and has better immune protection than the inadequately poisoned vaccine, broadens the research on the pathogenic mechanism of hvKP, and provides a theoretical basis for its prevention and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118562700B_ABST
    Figure CN118562700B_ABST
Patent Text Reader

Abstract

The invention discloses a highly toxic Klebsiella pneumoniae rpoE The invention relates to a deletion strain and its application in preparing attenuated live vaccines, belonging to the field of microbiology. rpoE The killing effect of hvKP gene on wax moth was weakened, and the number of colonization in mouse viscera was reduced, and the damage to the lung was reduced, indicating that the knockout of high-virulence Klebsiella pneumoniae rpoE The gene can reduce the pathogenicity of highly virulent Klebsiella pneumoniae. At the same time, immune protection experiments have shown that highly virulent Klebsiella pneumoniae rpoE The attenuated live vaccine prepared from the gene-deleted strain provides high immune protection for mice, and has better immune protection than attenuated killed vaccines, with broad market application prospects. This invention broadens the research on the pathogenesis of hvKP and provides a theoretical basis for the prevention and treatment of hvKP.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of microorganisms, and in particular relates to a highly virulent Klebsiella pneumoniae rpoE Deletion strains and their application in the preparation of attenuated live vaccines. Background Art

[0002] Klebsiella pneumoniae ( Klebsiella pneumoniae ; abbreviated as KP) is a common clinical pathogen that can attack multiple systems of the human body such as the respiratory system, urinary system, circulatory system, etc. KP is a common cause of antibiotic-resistant opportunistic infections in hospitalized patients. This species is naturally resistant to penicillin, and members of the population usually have acquired resistance to a variety of antimicrobial drugs such as β-lactams, aminoglycosides, and quinolones. In the past decade, the prevalence of hospital-associated infections caused by multidrug-resistant strains that produce extended-spectrum β-lactamases and / or carbapenemases has continued to rise. The lack of appropriate antibiotics in the clinic to deal with drug-resistant KP has made it a major clinical and public health threat. In recent years, hypervirulent Klebsiella pneumoniae (hypervirulent Klebsiella pneumoniae) has emerged with stronger virulence and higher mortality than classic KP. Klebsiel pneumoniae KP (hepatitis virus KP), also known as hvKP, can infect healthy individuals without underlying medical conditions and cause severe community-acquired infections. Furthermore, its primary symptom is often primary liver abscess, which can metastasize to other tissue infections, including splenic abscess, pneumonia, and endophthalmitis. This significantly increases the mortality rate and complicates the diagnosis and treatment of KP.

[0003] These unique clinical challenges have stimulated research into KP treatments. For example, the World Health Organization (WHO) has called for vaccines to address the significant public health problem of antimicrobial resistance. Numerous vaccines are currently available, but each has limitations. The KP capsular polysaccharide (CPS) vaccine was first reported in 1985. However, the high variability of capsular serotypes limits vaccine coverage, and a universal KP vaccine is currently lacking in clinical practice. Inactivated vaccines primarily produce antibodies against extracellular pathogens. Intracellular pathogens cannot be neutralized by antibodies produced by serum, resulting in inadequate protection. In contrast, live attenuated vaccines are replicative and, upon vaccination, induce a robust cellular immune response, effectively eliminating invading pathogens. Therefore, the development and widespread use of live attenuated KP vaccines holds promise for preventing KP infection and reducing the risk of antimicrobial resistance.

[0004] A key factor in determining the safety of attenuated live vaccines is the low virulence of the vaccine strain. It is currently known that KP uses a variety of virulence factors to enhance its own virulence, such as capsular polysaccharides, lipopolysaccharides, siderophores, flagella, outer membrane proteins, and secretory proteins. RpoE is a sigma factor that controls gene transcription and translation. Several literature reports have shown that RpoE can be expressed in Escherichia coli, Pasteurella multocida, and Salmonella. rpoE The absence of RpoE leads to a decrease in the virulence of the strain. RpoE protein is considered to be a good candidate protein for attenuated vaccine due to its good immunogenicity. rpoE There have been no reports on studies on gene deletion and construction of live attenuated vaccines. Summary of the Invention

[0005] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.

[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a highly toxic Klebsiella pneumoniae rpoE Gene deletion strain, the highly virulent Klebsiella pneumoniae rpoE The gene deletion strain was generated by Red homologous recombination method for highly virulent Klebsiella pneumoniae. rpoE The goal is to address the current lack of an effective and safe hvKP vaccine.

[0008] As the highly virulent Klebsiella pneumoniae of the present invention rpoE A preferred embodiment of the gene-deleted strain, wherein: the highly virulent Klebsiella pneumoniae rpoE The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] Highly virulent Klebsiella pneumoniae rpoE Analysis of gene deletion strains rpoE Application of genes affecting the lethality of hvKP in the Galleria mellonella model.

[0010] Highly virulent Klebsiella pneumoniae rpoE Analysis of gene deletion strains rpoE Application of genes affecting hvKP growth and lung inflammation in mice.

[0011] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for rpoEA live attenuated vaccine prepared from a gene-deleted strain.

[0012] As a preferred embodiment of the attenuated live vaccine of the present invention, wherein: the attenuated live vaccine comprises highly virulent Klebsiella pneumoniae rpoE Gene-deleted strains and pharmaceutically acceptable adjuvants.

[0013] As a preferred embodiment of the attenuated live vaccine of the present invention, the adjuvant includes one or more of aluminum hydroxide, lecithin, Freund's adjuvant, MPLTM, IL-12, aluminum hydroxide combined with CpG ODN composite adjuvant, ISA51VG, ISA720VG, MF59, QS21, and AS03 adjuvant.

[0014] The present invention also provides a method for preventing Klebsiella pneumoniae infection in humans and animals using a live attenuated vaccine.

[0015] Beneficial effects of the present invention:

[0016] The invention lacks innovative discovery rpoE The killing effect of hvKP on greater wax moth was weakened, and the number of colonization in the mouse viscera was reduced, and the damage to the lungs was reduced, indicating that the knockout of hvKP rpoE The gene can reduce the pathogenicity of hvKP. At the same time, immune protection experiments have shown that highly virulent Klebsiella pneumoniae rpoE The attenuated live vaccine prepared from the gene-deleted strain provides high immune protection for mice, and has better immune protection than attenuated killed vaccines, with broad market application prospects. This invention broadens the research on the pathogenesis of hvKP and provides a theoretical basis for the prevention and treatment of hvKP. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:

[0018] Figure 1 The highly toxic Klebsiella pneumoniae prepared in the embodiment of the present invention rpoE PCR verification results of gene deletion strains.

[0019] Figure 2 The embodiment of the present invention provides rpoE Schematic diagram of the effects of genes on the lethality of hvKP in the wax moth model.

[0020] Figure 3 The embodiment of the present invention providesrpoE Results of the effects of genes on hvKP growth in mice.

[0021] Figure 4 The embodiment of the present invention provides rpoE Results of genetic influence on hvKP growth-induced lung inflammation in mice.

[0022] Figure 5 The highly toxic Klebsiella pneumoniae provided by the embodiment of the present invention rpoE The results show that the attenuated live vaccine prepared from the gene-deleted strain provides immune protection to mice. DETAILED DESCRIPTION

[0023] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0024] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0025] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.

[0026] Example 1: Highly virulent Klebsiella pneumoniae rpoE Construction of deletion strains

[0027] Highly toxic Klebsiella pneumoniae in the present invention rpoE The gene deletion strain was constructed from hvKP, accession number ATCC43816, from the American Type Culture Collection (ATCC). Plasmid pKD42 provides a template for homologous recombination; plasmid pKD46 is a homologous recombination helper plasmid; and plasmid pCP20 is a FLP flippase expression plasmid. These plasmids were purchased from Shanghai Beino Biological Co., Ltd. The present invention primarily utilizes the Red homologous recombination method to isolate Klebsiella pneumoniae. rpoE Gene knockout to construct a highly virulent Klebsiella pneumoniae rpoE ATCC43816 is also referred to as wild strain in the following text, and Klebsiella pneumoniae is also referred to as highly virulent Klebsiella pneumoniae. rpoE Deletion strains are also called knockout strains.

[0028] 1. Main culture media, reagents and instruments

[0029] The bacterial culture medium was LB medium.

[0030] Reagents: 2× Taq Master Mix (Dye Plus) (Novozymes), standard DNA product purification kit (Tiangen), plasmid mini-preparation kit (Tiangen), apramycin sulfate (CSNpharm), rifampicin (Solarbio), and arabinose (Biosharp).

[0031] Instruments: constant temperature incubator (Yiheng), constant temperature shaking incubator (Lanyi), low temperature desktop high-speed centrifuge (Eppendorf), electroporation converter (Bio-Rad).

[0032] 2. Gene deletion steps

[0033] A. Prepare and purify the target gene deletion fragment.

[0034] The Klebsiella pneumoniae was identified by NCBI database rpoE The second generation sequencing sequence of ATCC43816 was compared with the rpoE Gene sequence, confirmed rpoE The specific location of the gene. Select appropriate gene fragments (about 30-40bp) upstream and downstream of the gene as the upstream homology arm and downstream homology arm respectively. Add the upstream homology arm sequence to the 5' end of the prime1 primer sequence, and the new sequence formed is r poE-prime1 primer (Table 1). Similarly, the downstream homology arm sequence is added to the 5' end of the prime2 primer sequence, and the new sequence formed is r poE-prime2 primer (Table 1). Using a strain (or plasmid) containing the pKD42 plasmid (Rif resistance) as a template, use r poE-prime1 primer, r The poE-prime2 primer was used to amplify the target gene deletion fragment. The PCR fragment was purified using a standard DNA product purification kit (Tiangen) and set aside.

[0035] B. Introduce the pKD46 plasmid (Apr-resistant, temperature-sensitive plasmid) and the target gene deletion fragment into the ATCC43816 to be knocked out. Specific steps:

[0036] (1) Prepare the ATCC43816 to be knocked out as competent cells. Take out the frozen ATCC43816 to be knocked out from the -80℃ freezer, thaw it naturally at room temperature, and then streak it onto a regular plate. Pick a single colony the next day, shake it overnight, and then shake it again at a ratio of 1:100 until the logarithmic growth phase. After ice bathing for half an hour, centrifuge at 4℃ at low speed to collect the bacteria. Wash the strain 3 to 4 times with sterile pre-cooled deionized water and 10% glycerol water respectively. The final aliquot is dispensed into 1.5 mL sterile centrifuge tubes, each tube containing approximately 100 μL of competent cells.

[0037] (2) Extract the pKD46 plasmid. Remove the frozen strain containing the pKD46 plasmid from the -80°C freezer, thaw naturally at room temperature, and streak onto a plate containing Apr resistance. Then, incubate at 27°C overnight. The next day, pick a single colony and shake it in 5 mL of LB containing Apr resistance for 14-16 hours. After shaking, use a plasmid extraction kit (Tiangen) to extract the pKD46 plasmid and set aside.

[0038] (3) The pKD46 plasmid and the target gene deletion fragment were introduced into ATCC43816 respectively. The extracted pKD46 plasmid was electroporated into the ATCC43816 competent cells to be knocked out, and the cells were spread on Apr-resistant plates and cultured at 28°C. Positive strains were screened using Apr-F and Apr-R primers (Table 1). The positive strains were induced with arabinose and prepared into competent cells again. The purified target gene deletion fragment was then electroporated into the competent cells and spread on dual-resistant plates containing Apr and Rif and cultured at 28°C. The strains on the dual-resistant plates were verified by PCR using prime1 and prime2 primers. If a bright, single band appeared, it proved that homologous recombination had occurred.

[0039] C. Eliminate functional plasmids and fragments.

[0040] Pick the positive strain obtained in the previous step and inoculate it on a Rif-resistant plate and culture it overnight at 37°C. Use Apr-F and Apr-R primers to PCR verify the strain on the plate. If there is no obvious band in the PCR product, it proves that the pKD46 plasmid has been eliminated. Prepare the strain as a competent cell, electroporate the pCP20 plasmid (Apr-resistant, temperature-sensitive plasmid), spread it on an Apr-resistant plate and culture it overnight at 28°C. Use Apr-F and Apr-R primers to PCR verify whether the pCP20 plasmid has been introduced into the strain grown on the plate, and use prime1 and prime2 primers to PCR verify that the FRT and Rif fragments have been eliminated. Transfer the strain confirmed in the previous step to a normal plate and culture it at 37°C, and use Apr-F and Apr-R primers to PCR confirm that the pCP20 plasmid has been eliminated. Finally, use external primers out-F and out-R (Table 1) to perform PCR on the knockout strain, and perform first-generation sequencing on the product to confirm rpoE The deletion of the gene. After sequencing, it was confirmed that the highly virulent Klebsiella pneumoniae was successfully constructed. rpoE Deletion strain.

[0041] The results of PCR verification of the knockout strain using external primers out-F and out-R are shown in Figure 1 As shown in the figure, it can be seen that the PCR product fragment using the knockout strain as a template is smaller than the PCR product fragment using the wild-type strain as a template, proving that rpoE The gene has been successfully knocked out.

[0042] Table 1 Construction and identification primers of deletion strains

[0043] Primer Name Primer Sequence (5’→3’) prime1 GTGTAGGCTGGAGCTGCTTC prime2 GGACCATGGCTAATTCCCAT poE-prime1 ATGGGAATTGGGTTTGGGGAGACATTACCTCGGATGAGCGTGTAGGCTGGAGCTGCTTC poE-prime2 CGTTGACGATAGCGGAATACTGGAAAAGGGTATCAGGCATGCAGAAAATGGGAATTAGCCATGGTCC Apr-F ATGGGCCACTTGGACTGATCG Apr-R TTCTTCGCATCCCGCCTCTG out-F TGATTGATAACGATCTGCCGC out-R ATCGCGGATAAGGTGATAACTCTC

[0044] Example 2: Deletion rpoE Genetic influence on hvKP pathogenicity

[0045] This part verifies the change of virulence of knockout strain relative to wild strain by measuring the virulence of wild strain and knockout strain to host through the killing experiment of greater wax moth and bloodstream infection model of mice. rpoE Gene significantly reduces the virulence of hvKP, a highly virulent Klebsiella pneumoniae rpoE The gene-deleted strain is a weak strain.

[0046] 1. Greater wax moth killing experiment

[0047] The wax moth killing assay was used to determine the lethality of wild-type and knockout strains to wax moth. Wild-type and knockout strains were inoculated from bacterial tubes stored in a -80°C freezer. Single colonies were picked and shaken overnight. The strains were then shaken again at a ratio of 1:100 until the mid-to-late logarithmic phase. After washing three times with sterile saline, the concentrations of both strains were adjusted to an OD of 600The virulence test model was 0.27. About 300 mg of G. mellonella was used as an in vivo virulence test model (Tianjin Huiyude Company). Each G. mellonella was injected with 10 μl of bacteria in the penultimate left leg, so that the amount of bacteria in each G. mellonella was controlled at 1.0×10 5 CFU. A wild-type group, a knockout group, and a blank control group were set up, each injected with the wild-type strain, the knockout strain, and normal saline, respectively. Each group contained 20 G. mellonella. After the manipulation, the cells were placed at 37°C and observed every 6 hours. The number of survivors was recorded and a survival curve was plotted.

[0048] The experimental results are as follows Figure 2 As shown, Figure 2 hvKP has a strong lethal effect on G. mellonella, compared with infection with highly virulent Klebsiella pneumoniae. rpoE The gene-deficient strain of G. mellonella died more slowly. There was a significant difference in the killing effect of the two strains on G. mellonella. *: p < 0.05. This indicates that hvKP is missing. rpoE The virulence of the gene will be reduced in the future.

[0049] 2. Effects of strain infection on organ bacterial load and visceral tissue structure in mice Wild-type and knockout strains were used to construct a mouse bloodstream infection model. The accumulation of bacteria from the liver, kidney, and lungs of mice was analyzed to determine the extent of their accumulation. HE staining of lung tissue sections was used to determine the extent of damage to different organs caused by different strains.

[0050] A. Construction of mouse models infected with wild-type and knockout strains.

[0051] The wild-type strain and the knockout strain were inoculated from the bacterial tube stored in the -80℃ refrigerator. Single colonies were picked and shaken overnight. Then, they were shaken again at a ratio of 1:100 until the middle and late logarithmic growth phase. After washing three times with sterile PBS buffer, the concentrations of the two strains were adjusted to OD 600 Eighteen C57BL / 6J mice (Hangzhou Ziyuan Experimental Animal Technology Co., Ltd.) aged about 7 weeks were randomly and evenly divided into three groups: wild-type strain infection group, knockout strain infection group, and blank control group. Each of the three groups of mice was injected with 0.2 mL of wild-type strain (1.0×10 5 CFU), knockout strains (1.0×10 5 CFU) and PBS buffer.

[0052] B. Organ bacterial load counts after infection with wild-type and knockout strains.

[0053] The mice were observed within 24 hours of invasion. If there were signs of moribundity such as lethargy, difficulty breathing, and slow movement, the samples were immediately taken and the mice were killed. If there were no signs of moribundity, the samples were taken and the mice were killed 24 hours after modeling. When taking samples, 300 μL Delivector™ Avertin (Duowo Bio) was injected intraperitoneally for anesthesia. The liver, kidney, and lung of the mice were then collected using aseptic techniques and placed in a 1.5 mL EP tube containing 200 μL sterile PBS buffer. The collected tissues were fully ground using an electric tissue grinder (Shengong) in a low-temperature, sterile environment. The ground tissue homogenate needed to be 10 times to 1.0×10 5 The bacterial count in these organs was detected by plate counting method.

[0054] The experimental results are as follows Figure 3 As shown in Figure 2, after hvKP infection of mice, the liver, kidney, and lung of the mice were affected, and the number of bacteria isolated from each gram of internal organs after grinding could reach 10 6 CFU. In contrast, infection with highly virulent Klebsiella pneumoniae rpoE After 24 hours, the number of bacteria isolated from the viscera of mice with the gene-deficient strain decreased significantly, with a minimum of only 3.0 bacteria per gram of viscera. The above results indicate that there is a significant difference in the invasive effects of the two strains on the mouse viscera, *: p < 0.05, **: p < 0.005.

[0055] C. Effects of infection with wild-type and knockout strains on the visceral tissue structure of mice

[0056] The liver, kidney, and lung were harvested from the mice using the same method as above. The organs were then fixed in a tissue fixative (ensuring that the tissues were completely immersed in the fixative). The organs were promptly delivered to Wuhan Pinuofei Biotechnology Co., Ltd. for embedding, sectioning, and HE staining of the mouse visceral tissues to assess for inflammation.

[0057] The experimental results are as follows Figure 4 As shown in the figure, after hvKP infection in mice, the lung morphology of mice was severely damaged. Compared with the blank control group, the alveolar septa of the lungs of mice infected with wild strains were significantly thickened, and more neutrophils were seen, which shows that wild strain infection caused an inflammatory response in the lungs of mice. Compared with the blank control group, the lungs of mice infected with highly virulent Klebsiella pneumoniae were significantly thickened. rpoE The alveolar septa in the lungs of mice with the gene-deficient strain were slightly thickened, and occasional neutrophils were seen, indicating that infection with the knockout strain resulted in only a mild inflammatory response in the lungs of mice.

[0058] Example 3: Based on highly virulent Klebsiella pneumoniae rpoE A gene-deleted live vaccine can provide immune protection in mice

[0059] Among various vaccines, attenuated live vaccines have better protection performance. They simulate the infection process by activating the body's immune system and produce specific immune responses against pathogens. This vaccine can induce the body to produce two types of immune responses, cellular immunity and humoral immunity, providing long-term protection for the vaccinated host. The low toxicity of bacteria is the key to the strong protection of attenuated live vaccines and their harmlessness to the host. This section aims to verify the high toxicity of Klebsiella pneumoniae. rpoE Gene-deleted strains can be used as potential candidates for attenuated live vaccines.

[0060] 1. Preparation of attenuated live and attenuated killed vaccines and immunization of mice

[0061] The deletion strain was inoculated from the bacterial tube stored in the -80℃ refrigerator. A single colony was picked and shaken overnight. Then, the strain was shaken again at a ratio of 1:100 until the middle and late logarithmic growth phase. After washing three times with sterile PBS buffer, the concentration of the strain was adjusted to OD 600 The emulsification rate is 1.0. Take the prepared bacterial solution and shake it with an equal amount of Freund's complete adjuvant (Sigma) or Freund's incomplete adjuvant (Sigma). When a drop of the emulsified solution is dropped into clean water, if the drop does not disperse, it proves that the emulsification is complete.

[0062] The knockout strain was inoculated from a tube stored at -80°C. A single colony was selected and shaken overnight. The strain was then shaken a second time at a 1:100 ratio until the mid-to-late logarithmic growth phase. 10% formaldehyde (Wexis) was then added to the tube to a final formaldehyde concentration of 0.5%. The tube was then shaken at 37°C for 24 hours to inactivate the knockout strain. After inactivation, bacteria were inoculated from the tube and cultured overnight. If no growth was observed after incubation, inactivation was successful and the experiment could be continued. The inactivated bacteria were washed three times with sterile PBS buffer and the strain concentration was adjusted to an OD600 of 1.0. The prepared bacterial solution was then shaken with an equal volume of Freund's complete adjuvant (Sigma) or Freund's incomplete adjuvant (Sigma). A drop of the emulsified solution was dropped into water and remained intact, indicating complete emulsification. A blank control vaccine was also prepared by shaking the tube with an equal volume of Freund's complete adjuvant (Sigma) and Freund's incomplete adjuvant (Sigma).

[0063] Thirty-six C57BL / 6J mice, approximately seven weeks old, were divided into a live attenuated vaccine group, a killed attenuated vaccine group, and a blank control group. The live attenuated vaccine group and the killed attenuated vaccine group were immunized with the live attenuated vaccine and the killed attenuated vaccine, respectively, while the blank control group was immunized with the blank control vaccine. Each group consisted of 12 mice. Multiple subcutaneous injections were used. In the first week, mice were immunized with a vaccine prepared with Freund's complete adjuvant. In the second and third weeks, mice were immunized with a vaccine prepared with Freund's incomplete adjuvant. No mice died after three weeks of immunization.

[0064] 2. Virus challenge experiment in mice after immunization

[0065] In the fourth week of the experiment, mice that had been immunized for three weeks were used for the challenge experiment. The wild strain was inoculated from the bacterial tube stored in the -80℃ refrigerator. A single colony was picked and shaken overnight. Then, the strain was shaken again at a ratio of 1:100 until the middle and late logarithmic growth phase. After washing three times with sterile PBS buffer, the concentration of the strain was adjusted to OD 600 The concentration of hvKP in the mouse body was controlled at 1.0 × 10. 5 After the operation, observe and record the number of surviving cells every 12 hours (at night) or every 4 hours (during the day) and draw a survival curve.

[0066] The experimental results are as follows Figure 5 As shown, the results show rpoE Gene deletion strains can be used as potential attenuated live vaccines. As can be seen from the figure, different experimental results were obtained after three weeks of immunization with different vaccines and then the challenge experiment. The blank control vaccine prepared with PBS buffer did not provide immune protection to mice. All mice in this group died within a short period of time after being attacked by hvKP. rpoE The attenuated vaccine prepared by the gene deletion strain can only provide partial immune protection for mice. When the mice were attacked by hvKP after immunization, the death rate of the mice in this group was slower than that of the blank control group, but most of the mice died after 60 hours. rpoE Compared with the first two vaccines, the attenuated live vaccine prepared from the gene-deficient live bacteria can provide mice with higher immune protection. The survival time of mice in this group was greatly prolonged when they were attacked by hvKP after receiving the vaccine, and most mice could survive until the seventh day after the attack. The above results all indicate that highly virulent Klebsiella pneumoniae rpoE The gene-deleted strain can provide mice with higher immune protection when used as a live attenuated vaccine to immunize mice.

[0067] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A highly virulent Klebsiella pneumoniae rpoE A gene-deficient strain, characterized by: The highly virulent Klebsiella pneumoniae rpoE The gene deletion strain was generated by Red homologous recombination against hypervirulent Klebsiella pneumoniae. Klebsiella pneumoniae )of rpoE Gene knockout; The highly virulent Klebsiella pneumoniae has a preservation number of ATCC43816.

2. The highly virulent Klebsiella pneumoniae according to claim 1 rpoE A gene-deficient strain, characterized by: The highly virulent Klebsiella pneumoniae rpoE The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A method using the highly virulent Klebsiella pneumoniae as claimed in claim 1 rpoE A live attenuated vaccine prepared from a gene-deleted strain.

4. The attenuated live vaccine according to claim 3, wherein: The attenuated live vaccine comprises the highly virulent Klebsiella pneumoniae according to claim 1 rpoE Gene-deleted strains and pharmaceutically acceptable adjuvants.

5. The attenuated live vaccine according to claim 4, characterized in that: The adjuvant includes one or more of aluminum hydroxide, lecithin, Freund's adjuvant, MPLTM, IL-12, aluminum hydroxide combined with CpG ODN composite adjuvant, ISA51VG, ISA720VG, MF59, QS21, and AS03 adjuvant.

6. Use of the attenuated live vaccine according to claim 3 in the preparation of a vaccine for preventing Klebsiella pneumoniae infection in humans and animals.

Citation Information

Patent Citations

  • Klebsiella pneumoniae syA gene deleted attenuated live vaccine strain as well as preparation method and application thereof

    CN117070434A