A sgRNA for targeted editing of pig PNPLA3 gene and its application

Abstract

The present invention relates to the field of animal genetic engineering technology, and specifically to a sgRNA for targeted editing of the pig PNPLA3 gene and its application. The sgRNA provided by the present invention targets the 444th nucleotide of the exon of the pig PNPLA3 gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.3. The sgRNA provided by the present invention uses CRISPR / Cas9 technology to edit the 444th nucleotide c.444C>G of the exon of the PNPLA3 gene in pig fetal fibroblasts, and the obtained pig fetal fibroblasts after point mutation have a genetic basis consistent with that of humans, which provides a feasible method for in-depth study of the mechanism of the PNPLA3 gene in glycolipid regulation and for obtaining a pig model of fatty liver disease associated with metabolic disorders by somatic cell nuclear transplantation.

Description

Technical Field

[0001] The present invention relates to the field of animal genetic engineering technology, and in particular to a sgRNA for targeted editing of the pig PNPLA3 gene and an application thereof. Background Art

[0002] Metabolic dysfunction-associated steatotic liver disease (MASLD) is one of the most common liver diseases in the world, affecting approximately 25% of the global population. MASLD is usually associated with obesity and insulin resistance. It progresses from simple steatosis at first to metabolic dysfunction-associated steatotic hepatitis characterized by lobular inflammation and hepatocellular ballooning. If not effectively diagnosed and treated, it will continue to develop into organ damage or cirrhosis, ultimately leading to the development of hepatocellular carcinoma. When MASLD progresses to its terminal stage, liver cancer, patients often require a liver transplant to save their lives.

[0003] MASLD has a multifactorial pathogenesis involving a close interaction of environmental and genetic factors. A large number of studies have shown that the rs738409 C>G single nucleotide mutant in the human PNPLA3 (Patatin-like phospholipase domain-containing 3) gene causes the 148th isoleucine residue in the amino acid sequence of its protein composition to mutate to a methionine residue, commonly known as I148M, which is extremely closely related to the occurrence of fatty liver disease associated with a variety of metabolic disorders and is one of the most clinically characterized and most intensively studied mutants. In addition, the PNPLA3I148M variant is positively correlated with alcoholic liver disease, chronic hepatitis C-related cirrhosis, and hepatocellular carcinoma.

[0004] The PNPLA3 gene contains the conserved structure of potato tuber storage proteins and the (GXSXG) motif shared by lipases, has nonspecific lipolysis properties and acylglycerol transacylase activity, and is mainly expressed in the liver, fat, and retina. PNPLA3 plays a role in lipid remodeling in the liver: human hepatocytes overexpressing PNPLA3 and PNPLA3I148M have higher levels of very long-chain polyunsaturated fatty acids in phospholipids; PNPLA3I148M KI mice have reduced arachidonic acid in liver triglycerides and increased arachidonic acid in phospholipids. PNPLA3 knockout and overexpression animal models do not show hepatic triglyceride accumulation and therefore do not develop steatosis. In contrast, the PNPLA3I148M overexpression mouse model develops a hepatic steatosis phenotype. Studies on mouse models have shown that PNPLA3I148M is neither a gain-of-function mutation nor a loss-of-function mutation, but a new variant. In the retina and hepatic stellate cells, PNPLA3 is also involved in the hydrolysis metabolism of retinol esters. Purified PNPLA3 displayed retinyl palmitate hydrolase activity that was impaired in the PNPLA3I148M mutant, resulting in a large accumulation of retinyl esters in these cells. Humans carrying the PNPLA3I148M mutation had lower levels of circulating retinol and retinol-binding protein 4 and higher hepatic retinyl ester content, suggesting that PNPLA3 plays a role in regulating retinol release from astrocytes. Summary of the invention

[0005] Since pigs are similar to humans in terms of genome, nutritional metabolism, and obesity-related molecular pathological characteristics, they are suitable animals for studying human metabolic disorder-related diseases. Therefore, obtaining a pig model of metabolic disorder-related fatty liver disease can provide good research materials for the study of human metabolic disorder-related diseases.

[0006] The purpose of the present invention is to provide a method for encoding targeted editing of pig PNPLA3, laying a foundation for the preparation and application of gene-edited pigs. More specifically, in the first aspect, the present invention provides a target sequence for targeted editing of pig PNPLA3 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The sgRNA target sequence provided by the present invention is located in the vicinity of the third exon of the pig PNPLA3 coding gene. The sgRNA designed according to this sequence can achieve the expected purpose of targeted editing of the PNPLA3 gene. The present invention found that the editing efficiency is highest within the range of about 50 nucleotides upstream and downstream, and the nucleotide sequence finally screened is the target sequence shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides a sgRNA sequence for targeted editing of the pig PNPLA3 gene, the nucleotide sequence of the sgRNA and its complementary nucleotide sequence are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] The present invention designs three sgRNAs that specifically target the 3rd exon of the porcine PNPLA3 gene, including the vicinity of the 148th amino acid codon. It is found that only PNPLA3-sgRNA1 can specifically target the 3rd exon of the porcine PNPLA3 gene, including the vicinity of the 148th amino acid codon, and produce efficient cleavage of the PNPLA3 gene.

[0010] In a third aspect, the present invention provides a homologous recombination donor ssODN for editing the exon of the porcine PNPLA3 gene, wherein the 444th nucleotide of the porcine PNPLA3 gene exon on the homologous recombination donor ssODN is G, and the sequence of the homologous recombination donor ssODN is shown in SEQ ID NO.9.

[0011] In order to prevent Cas9 from performing secondary cutting on the double-stranded genomic DNA of the edited cell, the present invention mutates the base of the homologous recombination donor ssODN, specifically adjusting the C at position 435 to T, thereby preventing Cas9 from performing secondary cutting on the double-stranded genomic DNA.

[0012] In a fourth aspect, the present invention provides primers for identifying the sgRNA sequence (PNPLA3-sg1), wherein the primers are used to verify the editing effect of the PNPLA3-sg1 sequence on the 444th nucleotide of the exon of the pig PNPLA3 gene, and the nucleotide sequences of the primers are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0013] The nucleotide sequence containing the third exon of the PNPLA3 gene and the homologous recombination of ssODN was obtained by specific amplification of the primer pair pPNPLA3-148-F / pPNPLA3-148-R and was named PNPLA3-148. The details are as follows:

[0014] 5'--3' (SEQ ID NO. 13).

[0015] In a fifth aspect, the present invention provides a recombinant expression vector containing the above-mentioned sgRNA sequence.

[0016] In a sixth aspect, the present invention provides the use of the above-mentioned target sequence or the above-mentioned sgRNA sequence or the above-mentioned homologous recombination donor ssODN or the above-mentioned primer or the above-mentioned recombinant expression vector in editing the PNPLA3 gene.

[0017] In a seventh aspect, the present invention provides a method for editing the porcine PNPLA3 gene, using the above-mentioned sgRNA sequence to silence the porcine PNPLA3 gene or insert the target gene into the third exon of the PNPLA3 gene.

[0018] In the method for editing the porcine PNPLA3 gene provided by the present invention, the base C at position 444 of the porcine PNPLA3 gene exon is replaced with base G using the above-mentioned sgRNA sequence and the above-mentioned homologous recombination donor ssODN.

[0019] In an eighth aspect, the present invention provides a mutant of the PNPLA3 gene. Based on the CRISPR-Cas9 technology, the PNPLA3 gene is edited using the above-mentioned sgRNA sequence and the above-mentioned homologous recombination donor ssODN to obtain a mutant in which the 444th nucleotide base of the exon of the PNPLA3 gene is G.

[0020] In a ninth aspect, the present invention provides a method for preparing the above-mentioned mutant, comprising: transfecting cells with the above-mentioned recombinant expression vector and the above-mentioned homologous recombination donor ssODN, culturing cells in DMEM complete medium after transfection, and enriching positive cells by flow cytometry.

[0021] Specifically, 5 μg of sgRNA plasmid vector PX458-sg1 and homologous recombination donor ssODN were transfected into PEFs cells at 10 6 Cells / well were transfected. U-023 was selected as the electroporation program. After transfection, complete medium was added to gently disperse the cells. After culturing in DMEM complete medium at 37°C for 6-8 h, the medium was changed and cultured for 48 h. After culturing for 48 h, the luminescence was observed under a fluorescence microscope. The cells were sorted using a flow cytometer. The cells were digested and centrifuged. After removing the medium, 300 µL DMEM medium was added to resuspend the cells and transferred to a flow tube for use. Before loading the machine, a cell sieve was used to remove the cell clusters with severe adhesion to avoid blocking the sample tube. The positive cells that stimulated GFP were selected for sorting on the machine, and the enriched cells were collected in a 1.5 mL EP tube.

[0022] In a tenth aspect, the present invention provides the use of the mutant in studying metabolic disorder-related fatty liver disease. Specifically, the mutant can be used to obtain a metabolic disorder-related fatty liver disease pig model through somatic cell nuclear transplantation for studying the mechanism of fatty liver disease.

[0023] The beneficial effects of the present invention are:

[0024] (1) The present invention discloses a sgRNA for targeted editing of the porcine PNPLA3 gene. The present invention determines the porcine target site sequence by homologous comparison based on the typical PNPLA3 gene mutation site characteristic of fatty liver disease associated with human metabolic disorders, and obtains the sgRNA that can be used to edit the porcine PNPLA3 gene.

[0025] (2) The present invention is based on the sgRNA with high cutting efficiency obtained by screening, and obtains a homologous recombination donor single-stranded nucleotide sequence (ssODN) for replacing the 148th isoleucine codon in the third exon of the PNPLA3 coding gene with a methionine codon through artificial base adjustment. The ssODN provided by the present invention eliminates the secondary cutting of cas9.

[0026] (3) In the present invention, the sgRNA cutting efficiency for editing the pig PNPLA3 gene was 52%, and the success rate was 40% when preparing point mutation cells. The sgRNA cutting efficiency screened by the present invention and the success rate of obtaining positive cells using the sgRNA were higher than the editing efficiency of the conventional crisper technology.

[0027] (4) The present invention obtains porcine fetal fibroblasts with the pPNPLA3 c.444C>G point mutation through gene editing. The genetic basis of the porcine fetal fibroblasts is consistent with that of humans, which lays the foundation for obtaining a porcine model of metabolic disorder-related fatty liver disease through somatic cell nuclear transplantation, and ultimately serves the treatment of human diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 This is a position diagram of the sequence of the codon encoding the 148th amino acid on the PNPLA3 gene encoding gene targeted by the three sgRNAs of the present invention; purple is the sgRNA target sequence encoding the 148th amino acid codon in the third exon of the pig PNPLA3 encoding gene, light blue is the proposed mutation nucleotide in which the codon (ATC) of isoleucine at position 148 mutates to the codon (ATG) of methionine, and yellow is the target sequence of the three sgRNAs.

[0030] Figure 2 This is the sequencing result of the three sgRNAs of the present invention being successfully connected to the vector.

[0031] Figure 3 This is the plasmid map for expressing sgRNA in the present invention.

[0032] Figure 4 This is a diagram of the cutting efficiency of PNPLA3-sgRNA1 of the present invention.

[0033] Figure 5The efficiency of PNPLA3-sg1 expression vector and ssODN transfection of fetal fibroblasts. The luminescence of cells was observed under a fluorescence microscope 48 hours after cell transfection. Some cells could emit green light after transfection, indicating that the PNPLA3-sg1 expression vector transfected cells successfully.

[0034] Figure 6 The diagram shows the cell sequencing results of the targeted editing of the 148th amino acid codon on the coding gene of the pig PNPLA3 gene. Wild-type is the wild-type sequence, and Homozygote is the mutant homozygous sequence. Protect is the Pam region that prevents Cas9 from secondary cutting of the double-stranded genomic DNA of the edited cell, the nucleotide pPNPLA3 c.435C>T mutation, and Target is the pPNPLA3 c.444C>G point mutation on the coding gene of the PNPLA3 gene, which encodes the 148th amino acid codon. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The present invention downloads the nucleotide sequences of human and porcine PNPLA3 genes from the NCBI database, and determines the codon that causes the mutation of the 148th isoleucine codon to the methionine codon through homology comparison. Based on the analysis of the sequence and according to the design principle of sgRNA in CRISPR / Cas9, sgRNA is designed and screened near the 148th amino acid codon encoded by the porcine PNPLA3 gene, and finally a sgRNA with specific targeting is screened and applied for targeted editing of porcine fetal fibroblasts. The present invention is described in detail below using the sgRNA guide sequence designed by the present invention as an example.

[0037] Example 1: Acquisition of sgRNA sequences

[0038] The sequences of human and porcine PNPLA3 genes were downloaded from the NCBI database. Through homology comparison, it was determined that the codon that caused the mutation of the human isoleucine codon at position 148 to methionine was the porcine pPNPLA3 c.444C>G mutation.

[0039] According to the genomic position of the 148th codon of pig PNPLA3, target sequence screening was performed to obtain a sgRNA target sequence that specifically targets the 148th amino acid codon encoded in the 3rd exon of the pig PNPLA3 encoding gene. The sgRNA target sequence is located in the vicinity of the 3rd exon of the pig PNPLA3 encoding gene, and includes its forward nucleotide sequence and complementary nucleotide sequence, as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0040] The forward nucleotide sequence is as follows, and the bold characters in the sequence are the codons for the 148th amino acid: 5'-GGCCCTCGGTTCCACTCGCTTTCTATTTCACAGGCCTTGCTGTGCTCCTCCTTCATCCCTCTGGTCAGCGGCTTCATCCCTCCTTCCTTCAGAGGCGAGGTCCGCTT-3' (SEQ ID NO. 1).

[0041] The complementary nucleotide sequence is: 5'-AAGCGGACCTCGCCTCTGAAGGAAGGAGGGATGAAGCCGCTGACCAGAGGGATGAAGGAGGAGCACAGCAAGGCCTGTGAAATAGAAAGCGAGTGGAAGGCAGGGCC-3' (SEQ ID NO. 2).

[0042] The length and position of the target sequence are determined by the 148th amino acid codon and its surrounding PAM sites on the PNPLA3 gene coding gene. The forward and complementary nucleotide sequences near the third exon of the PNPLA3 gene include the 148th amino acid codon and its surrounding PAM sequences. Designing sgRNA based on this sequence can achieve the desired purpose of targeted editing of the PNPLA3 gene.

[0043] Targeting the editing site of the porcine PNPLA3 gene, three sgRNAs and complementary sequences (including the sticky end sequence after annealing) were designed and synthesized, named PNPLA3-sg1, PNPLA3-sg2, and PNPLA3-sg3. According to the sequence characteristics of the BbsI restriction site, the CACC base needs to be added to the 5' end of the forward sequence of the designed sgRNA to obtain the PNPLA3-sgRNA-F forward sequence; at the same time, the corresponding DNA complementary chain is obtained according to the forward sequence, and the AAAC base is added to the 5' end to obtain the PNPLA3-sgRNA-R complementary sequence. The specific oligonucleotide sequences are shown in Table 1, and the position map of the codon sequence encoding the 148th amino acid on the gene encoding the PNPLA3 gene targeted by the three sgRNAs is shown in Figure 1 .

[0044] Table 1: Nucleotide sequences corresponding to the three sgRNAs

[0045]

[0046] Example 2: Construction of a vector expressing sgRNA

[0047] The PX458 circular vector with GFP selection marker was linearized by BbsⅠ enzyme, electrophoresed by 1% agarose gel, and then cut and recovered, purified, and the concentration was determined. The two complementary oligo chains synthesized were annealed to form double-stranded DNA, and then SoultionⅠ was used to connect the dsDNA and the linearized PX458 vector. The specific annealing system is shown in Table 2.

[0048] Table 2: Annealing system of two complementary oligo chains

[0049]

[0050] After linearization, PX458 was recombined with the annealed dsDNA, and the ligated product was transformed into competent DH5α and cultured on LB solid medium containing ampicillin resistance. On the second day, a single colony was picked and shaken to extract the plasmid and sent to the company for sequencing and identification. The successfully connected plasmid was expanded and used in subsequent transfection experiments. The plasmid recombination connection system is shown in Table 3 below. Figure 2 The sequencing results of the three sgRNAs of the present invention successfully connected to the vector are shown in Figure 3 .

[0051] Table 3: Plasmid recombination ligation system

[0052]

[0053] From the results in Table 1, it can be seen that only PNPLA3-sgRNA1 can specifically target the region near the 148th amino acid codon in the third exon of the pig PNPLA3 gene and produce efficient cleavage of the PNPLA3 gene. Figure 4 Figure 1 is a graph of the cutting efficiency of PNPLA3-sg1. Based on the sgRNA cutting efficiency test results in Table 1, since the sgRNA sequence contained in sg1 has the highest cutting efficiency, the sgRNA plasmid vector PX458-sg1 constructed with PNPLA3-sg1 was used for subsequent experiments.

[0054] Example 3: Preparation of homologous recombination template

[0055] According to the DNA sequence of the PNPLA3 gene provided in NCBI, the codon for isoleucine at position 148 (ATC) on the PNPLA3 encoding gene in the homologous recombination template donor DNA was mutated to a codon for methionine (ATG), which refers to the porcine pPNPLA3c.444C>G mutation.

[0056] At the same time, in order to prevent Cas9 from performing secondary cutting on the double-stranded genomic DNA of the edited cells, the sequence of the homologous recombination donor ssODN was mutated according to the codon degeneracy, that is, the underlined nucleotide pPNPLA3 c.435C>T in the sequence. Based on this, the homologous recombination donor ssODN and complementary ssODN carrying the mutation point synthesized were: 5'- CTTATCAAGGCCCAGGGAAATGAAAGGGAGCCTGTTCTGGCCCTCGGTTC CACTCGCTTTCTATTTCACAGGCCTTGCTGTGCTCCTCCTTCATGCCTCTGGTCAGCGGCTTCATCCCTCCTTCCTTCAGAGGCGAGGTAAGTCCGCTTCGAAACTGTGTCTGCGCAGCTCCTGCCCGTG -3' (SEQ ID NO.9).

[0057] 5'-CACGGGCAGGAGCTGCGCAGACACAGTTTGGAAGCGGACTTACCTCGCCTCTGAAGGAAGGAGGGATGAAGCCGCTGACCAGAGGCATGAAGGAGGAGCACAGCAAGGCCTGTGAAATAGAAAGCGAGTGGAACCGAGGGCCAGAACAGGCTCCCTTTCATTTCCCTGGGCCTTGATAAG -3' (SEQ ID NO. 10).

[0058] Example 4: Preparation of PNPLA3 point mutation fetal fibroblasts

[0059] Resuscitated Bama porcine fetal fibroblasts (PEFs) were placed in a 10 cm dish and used for transfection when the cells were about 80% full. The medium was changed 8 hours after transfection. After 48 hours of culture, positive cells were sorted by flow cytometry. The steps of cell transfection and flow sorting were as follows:

[0060] (1) After the PEFs cells have grown to about 80%, they are digested with EDTA-free trypsin, and the cells are collected and counted after centrifugation;

[0061] (2) According to 10 6Cells / well were electroporated. The electroporation kit used was the Lonza nuclear transfection kit. The ratio of Solution and Supplement was 82:18, and they were mixed thoroughly.

[0062] (3) Add 100 uL of nuclear transfection reagent to the centrifuge tube after centrifugation, blow gently with a pipette to resuspend the cells, add 5 µg of recombinant vector to the suspension, and mix gently;

[0063] (4) Use a pipette to gently add the mixed cell suspension to the electroporation cup. Try not to create bubbles during the process to avoid affecting the electroporation efficiency.

[0064] (5) To obtain cells with precise editing of amino acid 148 of the PNPLA3 gene, 5 µg of the sgRNA plasmid vector PX458-sg1 prepared in Example 2 and 5 µg of the ssODN described in Example 3 were transfected into PEFs cells at a rate of 106 / well. U-023 was selected as the electroporation program. After transfection, complete culture medium was added and the cells were gently dispersed. The cells were cultured in DMEM complete culture medium at 37°C for 6-8 h, and then the medium was changed and cultured for 48 h;

[0065] (6) After 48 h of culture, the luminescence was observed under a fluorescence microscope. Figure 5 , and use a flow cytometer to sort cells. After digesting the cells, centrifuge them, remove the culture medium, add 300 µL DMEM culture medium to resuspend the cells, and transfer them to a flow tube for later use. Use a cell sieve to remove the cell clusters that are more adhered to avoid blocking the sample tube before loading. Select the positive cells that stimulate GFP on the machine, and collect the enriched cells into a 1.5 mL EP tube.

[0066] (7) After successful sorting, the positive single cells were cultured in a cell culture incubator, and the culture medium was changed every 3 days. When the cells grew to 80%, they were transferred to a 48-well plate and continued to be cultured. The culture medium was changed every 3 days. When the cells grew to 80% in the 48-well plate, some cells were taken to extract genomic DNA for genotype identification. The PCR amplification primers were: pPNPLA3-148-F: 5'-CCCCATCCCGCCATTTATGA-3' (SEQ ID NO.11) and pPNPLA3-148-R: 5'-ACCCCGCAACTTCTGTTTCT -3' (SEQ ID NO.12). The amplification reaction system was shown in Table 4. The amplification results were sequenced to determine whether the expected gene editing genotype (pPNPLA3 c.444C>G) was contained. If the genotype was contained, the gene editing was successful. The cell sequencing results of the targeted editing of the 148th amino acid codon on the pig PNPLA3 gene encoding gene are shown in Figure 6 The remaining cells continued to be cultured.

[0067] Table 4: PCR amplification system for positive identification of gene-edited cells

[0068]

[0069] A total of 100 monoclonal cells were obtained. Through PCR amplification and sequencing, one of them was a PEF cell with precise editing of amino acid 148 in exon 3 of homozygous PNPLA3 gene, accounting for 1% of the total number of monoclonal cells; 4 were heterozygous cells, accounting for 4% of the total number of monoclonal cells; 35 other mutant (base insertion, deletion, etc.) cell lines; 60 wild-type cell lines. The nucleotide sequence containing exon 3 of PNPLA3 gene and ssODN homologous recombination was obtained by specific amplification of primer pair pPNPLA3-148-F / pPNPLA3-148-R, named PNPLA3-148 (SEQ ID NO.13). Cells with positive sequencing results were further expanded and cultured and then frozen for future use.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A sgRNA targeting and editing the porcine PNPLA3 gene, characterized in that: The nucleotide sequence of the sgRNA and its complementary nucleotide sequence are shown in SEQ ID NO.3 and SEQ ID NO.

4.

2. A homologous recombination donor ssODN for editing porcine PNPLA3 gene exons, characterized in that: The 444th nucleotide of the exon of the porcine PNPLA3 gene on the homologous recombination donor ssODN is G, and the sequence of the homologous recombination donor ssODN is shown in SEQ ID NO.

9.

3. A primer for identifying the sgRNA according to claim 1, characterized in that: The primer is used to verify the editing effect of the sgRNA described in claim 1 on the 444th nucleotide of the exon of the pig PNPLA3 gene, and its nucleotide sequence is shown in SEQ ID NO.11 and SEQ ID NO.

12.

4. A recombinant expression vector containing the sgRNA according to claim 1.

5. Use of the sgRNA according to claim 1, the homologous recombination donor ssODN according to claim 2, the primer according to claim 3, or the recombinant expression vector according to claim 4 in PNPLA3 gene editing.

6. A method for editing the porcine PNPLA3 gene, characterized in that: The sgRNA according to claim 1 is used to silence the porcine PNPLA3 gene or to insert the target gene into the third exon of the PNPLA3 gene.

7. The method according to claim 6, characterized in that The base C at position 444 of the exon of the porcine PNPLA3 gene is replaced with the base G using the sgRNA described in claim 1 and the homologous recombination donor ssODN described in claim 2.

8. A method for preparing a mutant of the PNPLA3 gene, characterized in that: include: The recombinant expression vector according to claim 4 and the homologous recombinant donor ssODN according to claim 2 are transfected into cells, and after the transfection, the cells are cultured in a DMEM complete medium, and positive cells are enriched by flow cytometry.

Images