Application of Citrus CsPP2C Gene in Improving Citrus Canker Resistance and Breeding for Citrus Canker Resistance

Abstract

The invention discloses the application of citrus CsPP2C gene in improving resistance to citrus canker and breeding for resistance to citrus canker, and belongs to the field of gene engineering technology. The invention discloses for the first time that the transcription level of citrus CsPP2C gene is significantly reduced, which can significantly improve the resistance of citrus to canker. When the transcription level of citrus CsPP2C gene is reduced by 72% and 67%, the lesion area of ​​canker is reduced by 42% and 29% respectively, and the disease index is reduced by 59% and 41% respectively; the reduction of the transcription level of citrus CsPP2C gene will not have a significant effect on the phenotype and development of the plant; the provided citrus CsPP2C gene can be used as a candidate gene for studying resistance to citrus canker, and can be used for breeding for resistance to citrus canker, and has great application value.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to the application of citrus CsPP2C gene in improving citrus canker resistance and citrus canker resistance breeding. Background Art

[0002] Citrus bacterial canker (CBC) is a bacterial disease caused by Xanthomonas citri subsp. Citri (Xcc), which harms most of the currently cultivated citrus varieties. Therefore, strengthening the research on the prevention and control of citrus bacterial canker is an urgent need for the development of the citrus industry.

[0003] Traditional prevention and control measures for citrus canker, such as burning diseased trees and spraying pesticides, require a lot of manpower and material resources and cause great harm to the environment. Therefore, the prevention and control of citrus canker relies more on the cultivation of new disease-resistant germplasm. Molecular breeding has been rapidly developed and widely used because it can be used to cultivate new disease-resistant germplasm in a targeted and efficient manner. In recent years, some citrus resources resistant to canker have been obtained through biotechnology, such as Jincheng, Xinhuicheng, and Navelcheng strains that have been transformed with the antimicrobial peptide D gene of the silkworm; Wanjincheng strains that overexpress CsBZIP40 (Li et al., 2019); plants with improved resistance to citrus canker obtained by gene-directed editing of the promoter of the citrus canker susceptible gene CsLOB1 (Peng et al., 2017). However, high-quality candidate genes are still scarce, and their functions and mechanisms of action have not been deeply studied. Therefore, it is urgent to specifically explore more genes closely related to citrus canker disease to deeply analyze their functions and mechanisms for molecular breeding of citrus canker disease resistance.

[0004] Protein phosphatase is one of the two key enzymes in the reversible phosphorylation process of proteins, and protein phosphatase 2C (PP2C) is an important member of protein phosphatase. PP2C is a class of serine / threonine protein phosphatases that can regulate the life activities of eukaryotic cells. PP2C is the largest PP family in plants. PP2C members have been identified in many plants, including Arabidopsis (Xue et al., 2008), cotton (Shazadee et al., 2019), wheat (Yu et al., 2019), rapeseed (Khan et al., 2019) and rice (Singh et al., 2010). PP2C members are widely involved in the response and regulation of plants to adverse stress, and many species are involved, and the reaction processes involved are complex and diverse. PP2C members can indirectly regulate the growth and development of plants by responding to adverse stress, and have a regulatory effect on seed dormancy germination, organ development, fruit ripening, etc. Summary of the invention

[0005] The purpose of the present invention is to provide the application of the citrus CsPP2C gene in improving citrus canker resistance and citrus canker resistance breeding, so as to provide a gene closely related to citrus canker resistance, provide a new candidate gene for citrus canker resistance breeding, and contribute to obtaining highly resistant citrus canker varieties and reducing environmental pollution caused by control methods such as pesticides and incineration.

[0006] To achieve the above objectives, the present invention provides an application of the citrus CsPP2C gene in improving resistance to citrus canker. The nucleotide sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1. Reducing the expression level of the citrus CsPP2C gene significantly improves resistance to citrus canker.

[0007] Preferably, the greater the degree of reduction in the expression level of the citrus CsPP2C gene, the stronger the resistance of the citrus to citrus canker.

[0008] Preferably, when the expression level of citrus CsPP2C gene is reduced by 67% or more, the ability of citrus to resist citrus canker is significantly improved.

[0009] The application of vectors and engineered bacteria containing the citrus CsPP2C gene in improving resistance to citrus canker. The nucleotide sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1. The vectors include silencing vectors and knockout vectors. The engineered bacteria are strains used for propagation and infection that contain the silencing vectors and / or knockout vectors of the citrus CsPP2C gene.

[0010] The application of citrus CsPP2C gene in the breeding of varieties resistant to citrus canker. The nucleotide sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1.

[0011] The application of a vector and an engineered bacterium containing the citrus CsPP2C gene in the breeding of varieties resistant to citrus canker. The nucleotide sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1.

[0012] The plant with significantly reduced expression of the citrus CsPP2C gene is obtained by genetic engineering method, and the nucleotide sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1.

[0013] Therefore, the application of the citrus CsPP2C gene provided by the present invention in improving resistance to citrus canker and breeding for resistance to citrus canker has the following specific technical effects:

[0014] (1) The present invention discloses for the first time that the transcription level of the citrus CsPP2C gene can be significantly reduced, which can significantly improve the resistance of citrus to canker disease. When the transcription level of the citrus CsPP2C gene is reduced by 72% and 67%, the lesion area of ​​the canker disease is reduced by 42% and 29%, respectively, and the disease index is reduced by 59% and 41%, respectively;

[0015] (2) The reduction of citrus CsPP2C gene transcription level will not have a significant effect on the phenotype and development of the plant;

[0016] (3) The citrus CsPP2C gene provided by the present invention can be used as a candidate gene for studying resistance to citrus canker and can be used for breeding for resistance to citrus canker, thus having great application value.

[0017] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0019] Figure 1 Schematic diagram of the structure and location of the citrus CsPP2C gene in the embodiment of the present invention, wherein A is the chromosome location of the citrus CsPP2C gene; B is the gene structure of the citrus CsPP2C gene; C is the conserved domain of the citrus CsPP2C gene;

[0020] Figure 2 The electrophoresis diagram of the PCR amplification of the VIGS fragment of the CsPP2C gene in Example 1 of the present invention, wherein VIGS represents the RNAi fragment of the CsPP2C coding gene; M represents the DNA molecular weight standard;

[0021] Figure 3 Schematic diagram of the VIGS vector structure of CsPP2C in Example 2 of the present invention, wherein GFP is green fluorescent protein; RdRp is NA-dependent RNA polymerase; CP is coat protein; 35S is a plant constitutive promoter derived from cauliflower mosaic virus; NOS is the terminator of opine synthase gene; LB is the left homology arm; RB is the right homology arm;

[0022] Figure 4PCR identification diagram of the VIGS plant of CsPP2C in Example 4 of the present invention; wherein A is the PCR amplification result of the TRV1 vector, B is the PCR amplification result of the TRV2 vector, C is the PCR amplification result of the VIGS plant of CsPP2C, + is a positive control; - is a negative control; M is a molecular weight standard;

[0023] Figure 5 The qRT-PCR test results of the VIGS plants of CsPP2C in Example 4 of the present invention, where * indicates significant difference (P=0.05); TRV2 is a plant with an empty vector; TRV2-PP2C-1 and TRV2-PP2C-2 are VIGS plants of CsPP2C;

[0024] Figure 6 The photos are of the VIGS plants of CsPP2C (TRV2-PP2C-1 and TRV2-PP2C-2) and the plants infected with TRV1 and TRV2 empty vectors (TRV2) in Example 4 of the present invention;

[0025] Figure 7 The photos are of the leaves of the VIGS plants of CsPP2C (TRV2-PP2C-1 and TRV2-PP2C-2) and the plants infected with TRV1 and TRV2 empty vectors (TRV2) in Example 5 of the present invention, 10 days after being inoculated with the canker pathogen;

[0026] Figure 8 The statistical graph of the lesion size of the leaves of the VIGS plants of CsPP2C (TRV2-PP2C-1 and TRV2-PP2C-2) and the plants infected with TRV1 and TRV2 empty vectors (TRV2) in Example 5 of the present invention after being inoculated with the canker bacteria for 10 days;

[0027] Fig. 9 The disease index statistics of the leaves of the VIGS plants of CsPP2C (TRV2-PP2C-1 and TRV2-PP2C-2) and the plants infected with TRV1 and TRV2 empty vectors (TRV2) in Example 5 of the present invention were inoculated with canker bacteria 10 days later. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0029] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0030] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0031] The CDS sequence of the citrus CsPP2C gene is shown in SEQ ID NO.1, which is located between 795821 bp and 799723 bp on chromosome 7 of citrus, contains 3 introns and 4 exons, encodes 412 amino acids, and contains the protein phosphatase 2C functional domain. The structural information of the CsPP2C gene is shown in Figure 1 shown.

[0032] SEQ ID NO.1

[0033] ATGGCGGGGATTTGCTGTGGAGTAGGTTGTGAGAGTGAACCAGCGGTATCAGTTGA

[0034] GCAAAGCTCACGAGCTTCTAGACGGAGGAGGCTAGAGCTCCGTCCGTTTAACTTGGT

[0035] TGCAGACGTGGCAGTTTTGCCGCCGTCAGAAAACGATCGGAAACGAAAGAAGCTTG

[0036] AACTTTACACTGCCTTAACAGCTGCACATGCTCGAGAAAACACCGAACAGAATTGT

[0037] GAAGCGAAAGATTCAGAGCGAGGTCGTACCGTAAACAAGGAAGAATTAGTCGGGA

[0038] ATAATGAAGCGGCTGATGATTTGGTAAATGATAACCCCAAGTTCGGGATGACTTCA

[0039] GTTTGCGGTAGAAGACGAGATATGGAGGATACTGTGTCAATTCACCCGTCGTTTTGC

[0040] AAGCAAAATCGCGCTCACTTCTACGGCGTGTTCGACGGTCATGGTTGCTCACATGTG

[0041] GCGATGAAGTGTAAAGATCGGTTGCATGATATACTTAGGGAGGAGATTGAATCTTG

[0042] TAACGTTGTTGAAGAATCGGTGAAGTGGAAGCAGACAATGCAGGCGAGCTTTGGGA

[0043] AGATGGATAAGGAGGTGCAAGATTGGAGTGTGAGTTCCAAGATCTCTAACTGCCGC

[0044] TGCGAGTTACAGACTCCGCAGTGCGACGCCGTTGGATCTACTGCCGTCGTTGCTGTC

[0045] GTCACTCCTGAAAAGCTTATCGTCTCTAACTGCGGCGACTCTCGTGCTGTGCTCTGCC

[0046] GAAACGGCGTCGCGGTTCCTCTGTCCAACGATCATAAACCTGATCGCCCGGATGAGT

[0047] TGCTTAGAATCGAAGCCGCCGGCGGCCGTGTGATTTACTGGGACGGCCCGAGAGTG

[0048] CTTGGCGTTCTGGCGATGTCGAGAGCGATCGGAGACAATTACTTAAAGCCGTATGTG

[0049] ATATCGGAGCCGGAGGTGACCGTGACTGAGCGTACGGCGGAGGATGAGTGTTTGAT

[0050] TTTGGCGAGCGATGGGTTATGGGACGTGGTGTCGAACGAGACGGCGTGCAGCGTGG

[0051] TGCGCACGTGCTTCCGAGCTCAGAAGGCGGCGGCTGCAGCTTCACCACCCGGATCG

[0052] CCGGGGAGCGAGGTGGCAGTGTCTGGTCAAAGCTCTGACAAAGCTTGCTTGGACGC

[0053] GTCAATTTTGTTGACCAAGCTGGCCTTGGCTAGGCGTAGTTCGGATAATGTCAGCGT

[0054] TGTGGTGGTCGATTTAAGGAGAATCAAAAGTCAAAAGCAGGGATTAAGTAGTTAA

[0055] Embodiment 1

[0056] To clone the VIGS fragment, follow these steps:

[0057] 1. RNA extraction and cDNA synthesis

[0058] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09) according to the attached instructions, the quality of the RNA was verified by agarose gel electrophoresis, and its concentration was measured using a concentration meter. Then, cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) according to the attached instructions, and the obtained cDNA was stored at -20°C for future use.

[0059] 2. VIGS fragment amplification

[0060] Primers CsPP2C-VIGS-F (sequence as shown in SEQ ID NO.3) and CsPP2C-VIGS SR (sequence as shown in SEQ ID NO.4) were used, and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) and its attached system were used to clone the VIGS fragment of the CsPP2C encoding gene from the citrus cDNA obtained in step 1. The VIGS fragment was 305 bp in length and the sequence was shown in SEQ ID NO.2. The amplification program was 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C extension for 10 min. The amplification results were as follows: Figure 2 Under ultraviolet light, cut out the agarose gel block containing the target fragment with a clean blade, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0061] SEQ ID NO.2:

[0062] AACGAAAGAAGCTTGAACTTTACACTGCCTTAACAGCTGCACATGCTCGAGAAAC

[0063] ACCGAACAGAATTGTGAAGCGAAAGATTCAGAGCGAGGTCGTACCGTAAACAAGG

[0064] AAGAATTAGTCGGGAATAATGAAGCGGCTGATGATTTGGTAAATGATAACCCCAAG

[0065] TTCGGGATGACTTCAGTTTGCGGTAGAAGACGAGATATGGAGGATACTGTGTCAATT

[0066] CACCCGTCGTTTTGCAAGCAAAATCGCGCTCACTTCTACGGCGTGTTCGACGGTCAT

[0067] GGTTGCTCACATGTGGCGATGAAG

[0068] SEQ ID NO.3:

[0069] GACTTAGATTCTGTGAGTAAGGTTACCGAATTCAACGAAAGAAGCTTGAACTT

[0070] SEQ ID NO.4: CGCGTGAGCTCGGTACCGGATCCCTTCATCGCCACA

[0071] Embodiment 2

[0072] The specific steps for constructing the VIGS vector are as follows:

[0073] The VIGS vector TRV2 and the VIGS fragment of the CsPP2C gene obtained in Example 1 were digested with BamH I and EcoR I. The digested products were subjected to agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit. Then, the two fragments were ligated using T4 ligase according to the system and procedure of the attached manual and transformed into Escherichia coli competent cells. After expansion, the plasmid was extracted to obtain the VIGS expression vector TRV2-CsPP2C (schematic diagram as shown in FIG. Figure 3 ). Among them, GFP is green fluorescent protein; RdRp is NA-dependent RNA polymerase; CP is coat protein; 35S is a plant constitutive promoter derived from cauliflower mosaic virus; NOS is the terminator of opine synthase gene; LB is the left homology arm; RB is the right homology arm. The vector TRV2-CsPP2C is transformed into Agrobacterium by electroporation, and then an Agrobacterium bacterial solution containing the TRV2-CsPP2C expression vector is prepared.

[0074] Embodiment 3

[0075] The TRV2-CsPP2C expression vector obtained in Example 2 was transformed into citrus, and the specific steps were as follows:

[0076] 1. Activation of Agrobacterium tumefaciens

[0077] Take 500 μL of TRV1, TRV2, and TRV2-CsPP2C Agrobacterium culture liquid and add them to 50 mL of liquid LB medium (containing 50 mg·L -1 Kanamycin) and cultured at 28°C, 200 r / min until OD 600 =1; collect the cells, resuspend them in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid, and adjust the OD 600 =1; TRV1 was mixed with TRV2 and TRV2-CsPP2C vector at a volume ratio of 1:1 and incubated at room temperature for 3 h.

[0078] 2. Agrobacterium infection

[0079] Immerse sterile citrus seedlings with radicles growing to 3 cm in the OD 600 = 1 Agrobacterium solution, evacuate with a vacuum pump for 1 minute; rinse with sterile water 3 to 5 times and then insert into the seed culture medium and culture at room temperature in the dark for 2 to 3 days.

[0080] Embodiment 4

[0081] The identification and phenotypic observation of VIGS plants are as follows:

[0082] 1. PCR identification

[0083] The seedlings cultured in the dark at room temperature for 2 to 3 days in Example 4 were observed under ultraviolet light. The seedlings showing green fluorescence were positive seedlings. The positive seedlings were transferred to nutrient soil culture medium under the culture conditions of 25°C and light / darkness of 16h / 8h. One month later, young leaf tissues were collected and DNA and total RNA were extracted using a kit according to the attached instructions. The primers CsPP2C-ID1-F (sequence shown in SEQ ID NO.5) / Cs PP2C-ID1-R (sequence shown in SEQ ID NO.6), CsPP2C-ID2-F (sequence shown in SEQ ID NO.7) / CsPP2C-ID2-R (sequence shown in SEQ ID NO.8) and CsPP2C-ID2-F (sequence shown in SEQ ID NO.7) / CsPP2C-VIGS-R (sequence shown in SEQ ID The PCR verification was performed as shown in NO.4. The amplification system was the system described in the instruction manual of the high-fidelity enzyme. The amplification program was: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0084] SEQ ID NO.5:TTGGGTTGCTACTGATTCGACT

[0085] SEQ ID NO.6: CTGTAAGGACCATCATACTTCGC

[0086] SEQ ID NO.7:ATTCACTGGGAGATGATACGCT

[0087] SEQ ID NO.8:GAATCTAAGTCCACTCGTCCGT

[0088] The amplification results are as follows Figure 4 As shown, the primer pairs CsPP2C-ID1-F / R and CsPP2C-ID2-F / R can amplify 150 bp bands in TRV2 and TRV2-CsPP2C plants, respectively; the primer pair CsPP2C-ID2-F / CsPP2C-VIGS-R did not amplify a band in TRV2 plants, but amplified a 471 bp band in TRV2-CsPP2C plants.

[0089] 2. qRT-PCR analysis

[0090] Primers CsPP2C-RT-F (sequence as shown in SEQ ID NO.9) and CsPP2C-RT-R (sequence as shown in SEQ ID NO.10) were used for qRT-PCR to verify whether the CsPP2C gene was successfully silenced. The qRT-PCR amplification program was: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min. The gene expression level of the plants transformed with TRV1 and TRV2 empty vectors was set to 1. If the CsPP2C gene expression level of the plants containing the target fragment vector was less than 1, gene silencing occurred. The qRT-PCR results are shown in Figure 5 As shown, the transcription levels of TRV2-CsPP2C plant 1 (TRV2-CsPP2C-1) and TRV2-CsPP2C plant 2 (TRV2-CsPP2C-2) decreased by 72% and 67%, respectively.

[0091] SEQ ID NO.9:TTGCAGACGTGGCAGTTTTG

[0092] SEQ ID NO.10:TCGAGCATGTGCAGCTGTTA

[0093] 3. Phenotypic observation

[0094] The phenotype of the transgenic plants was observed and it was found that there was no obvious abnormality in appearance and growth compared with the wild type (citrus plants that grew normally without treatment). Figure 6 ). This indicates that silencing of the CsPP2C gene did not have a significant effect on the phenotype and development of the plant.

[0095] Embodiment 5

[0096] The steps for evaluating the resistance of VIGS plants are as follows:

[0097] The mature leaves of the transgenic plants were washed with running water and then disinfected with 75% alcohol, then rinsed with sterile water and placed on a clean bench. The veins were punctured with needles and the ulcer pathogen liquid was applied with a pipette. 1 μL (1×10 5 CFU / mL); cultured in a 28℃ constant temperature and light incubator (16h light / 8h dark); photographed on the 10th day after the leaf was inoculated with bacteria, and the results of some leaves were as follows Figure 7 As shown, the lesion area was counted using Image J V1.47 software. The results are shown in Figure 8 shown.

[0098] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm 2 ), Level 1 (0.25mm 2 <R≤0.5mm 2 ), Level 2 (0.5mm 2 <R≤0.75mm 2 ), Level 3 (0.75mm 2 <R≤1mm 2 ), 4 levels (1.0mm 2 <R≤1.25mm 2 ), 5 levels (1.25mm 2 <R≤1.5mm 2 ), 6 levels (1.5mm 2 <R≤1.75mm 2 ), 7th level (R>1.75mm 2 ) ; Calculate the disease index (DI) according to the following formula, and the result is as follows Fig. 9 shown.

[0099] DI = 100 × Σ (number of lesions at each level × corresponding level value) / (total number of lesions × maximum level)

[0100] Depend on Figure 7 It can be seen that 10 days after inoculation with the ulcer pathogen, the ulcer symptoms of the VIGS plants of the two CsPP2C strains were significantly milder than those of the wild type; Figure 8 It can be seen that the lesion areas of the VIGS plants of the two CsPP2C strains were reduced by 42% and 29%, respectively. Fig. 9 It can be seen that the disease index of the VIGS plants of the two CsPP2C strains was reduced by 59% and 41%, respectively. Therefore, silencing the CsPP2C gene can enhance the resistance to citrus canker.

[0101] Therefore, the present invention utilizes VIGS technology to silence the CsPP2C gene, which can greatly reduce the lesion area of ​​citrus canker and alleviate the severity of the canker. The provided CsPP2C gene can be silenced by a variety of techniques and used for molecular breeding of resistance to canker, or it can be used together with other disease-resistant or disease-susceptible genes to coordinate molecular breeding of citrus resistance to canker, which has great application value in citrus canker resistance breeding.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Citrus CsPP2C The application of the gene in improving resistance to citrus canker is characterized by: Tangerine CsPP2C The nucleotide sequence of the gene is shown in SEQ ID NO.1, which reduces the CsPP2C The expression of the gene significantly improves the resistance of citrus to ulcer disease.

2. The citrus according to claim 1 CsPP2C The application of the gene in improving resistance to citrus canker is characterized by: Tangerine CsPP2C The greater the degree of reduction in gene expression, the stronger the resistance of citrus to citrus canker.

3. The citrus according to claim 1 CsPP2C The application of the gene in improving resistance to citrus canker is characterized by: Tangerine CsPP2C When the gene expression level was reduced by 67% or more, the ability of citrus to resist citrus canker was significantly improved.

4. Citrus CsPP2C The application of a gene silencing vector, a knockout vector and an engineering bacterium containing the vector in improving resistance to citrus canker is characterized by: Tangerine CsPP2C The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. Citrus CsPP2C The application of the gene in the breeding of varieties resistant to citrus canker is characterized by: The application is to inhibit citrus CsPP2C Gene expression, citrus CsPP2C The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. Citrus CsPP2C The application of a gene silencing vector, a knockout vector and an engineering bacterium containing the vector in the breeding of varieties resistant to citrus canker is characterized by: Tangerine CsPP2C The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images