A Beauveria bassiana strain and a method for controlling grassland caterpillars thereof

Abstract

The invention discloses a Beauveria bassiana strain and a method for controlling grassland caterpillars thereof, and relates to the field of insect pathogenic microorganism control. The Beauveria bassiana GC23620 strain of the present invention is isolated from the body surface of grassland caterpillar larvae and is classified and named Beauveria bassiana. Beauveria bassiana , the deposited name is Beauveria bassiana ( Beauveria bassiana ) strain GC23620, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the address of the deposit unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the deposit date is January 29, 2024, the strain deposit number is CGMCC: NO.41056, the above-mentioned Beauveria bassiana GC23620 strain has high pathogenicity to grassland caterpillar larvae and significant insecticidal effect. This strain is an insect pathogenic fungus and can be used as a living biological pesticide; it is safe and efficient during the application process, environmentally friendly, pollution-free and residue-free, and has very strong application potential in the biological control of grassland caterpillars.

Description

Technical Field

[0001] The invention mainly relates to the technical field of insect pathogenic microorganism control, and specifically relates to a Beauveria bassiana strain and a grassland caterpillar control method thereof. Background Art

[0002] Prairie Caterpillar Gynaephora spp., also known as the red-headed black caterpillar, belongs to the genus Lymantriidae of the order Lepidoptera. Gynaephora ), as a unique insect of the Qinghai-Tibet Plateau, can be found in alpine meadows, mountain meadows and meadow grasslands at an altitude of 3000-5000m.

[0003] Grassland caterpillars mainly feed in large quantities as larvae, harming many types of forage grasses, causing food shortages for livestock, aggravating grassland degradation and deteriorating grassland ecological environment. In addition, the caterpillar molting and cocoon shells left on the grassland can directly cause different types of stomatitis in livestock. In severe cases, the tongue can be broken and the livestock can die of starvation. They are important pests in agricultural and animal husbandry production in high-altitude areas.

[0004] In the past, a single chemical clothing drug was used for a long time and in high doses to control grassland caterpillars. The problems of low efficacy, high residue, easy resistance, poor safety, and environmental pollution have become increasingly prominent, causing serious impacts on animal husbandry and bringing adverse consequences to the ecological environment. On the contrary, biological control can not only effectively prevent the occurrence and damage of pests, but also has the advantages of reducing the use of chemical pesticides, protecting biodiversity, and maintaining the balance of the ecosystem. Parasitic natural enemy resources have many advantages such as abundant natural resources, high selectivity, wide host range, good safety, little impact on the ecosystem, not easy to develop resistance, easy to produce, and long-lasting and stable control effects. From the perspective of ensuring the sustainable development of IPM, they are biological control factors that cannot be ignored and are worthy of in-depth research and utilization in the development of green agriculture and animal husbandry. At present, the parasitic natural enemies reported in the biological control of grassland caterpillars mainly include the Sanjiangyuan grassland caterpillar golden wasp Pteromalus sanjiangyuanicus Yang (Yang Zhongqi et al., 2020), Ancient tussock moth Exorista larvarum (Liu Shidie, 2023), Bacillus brevis Empedobacter brevis (Zhao Lei et al., 2017), Caterpillar nuclear polyhedrosis virus Gynaephora ruoergensis nucleopolyhedrovirus (Wang Jinchang et al., 2022), Entomopathogenic nematodes (Bai Haitao et al., 2020), etc. However, there is a lack of a Beauveria bassiana strain with high insecticidal ability against grassland caterpillars and its application, especially in plateau and high-altitude areas. Summary of the invention

[0005] Based on this, the purpose of the present invention is to provide a Beauveria bassiana strain and a method for controlling grassland caterpillars thereof, so as to solve the technical problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] A strain of Beauveria bassiana, classified as Beauveria bassiana ( Beauveria bassiana ) strain GC23620, deposited as Beauveria bassiana Beauveria bassiana , deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is January 29, 2024, the strain deposit number is: CGMCC: NO.41056.

[0008] The technical solution is specific that the colony of the Beauveria bassiana GC23620 strain is white and short-wool in the early stage of growth, and white conidia begin to appear in the center of the colony after 3 days. As the culture time increases, the conidia appear in a ring-shaped accumulation and spread to the surrounding areas. The hyphae of the strain are branched and septate, with a smooth and colorless surface and a width of (2.45±0.05)µm; the conidiophores are attached to the nutritional hyphae, and the top axial spores are formed to form a spike-shaped spore-forming structure. The conidia are spherical, transparent, and smooth, with an average diameter of about (3.43±0.18)µm.

[0009] Specifically, the use of Beauveria bassiana in producing mycelium comprises the step of contacting grassland caterpillar bodies with live cells of Beauveria bassiana GC23620 or a culture containing live cells of Beauveria bassiana GC23620.

[0010] Specifically, the culture containing live bacteria of Beauveria bassiana GC23620 is a bacterial suspension of Beauveria bassiana GC23620, with a concentration of 1.05×10 5 -1.05×10 8 Spores / mL.

[0011] Specifically, the grassland caterpillars are grassland caterpillar larvae.

[0012] A biological control agent for controlling grassland caterpillar larvae, the active ingredient of which is the above-mentioned Beauveria bassiana ( Beauveria bassiana ) strain GC23620.

[0013] In the technical solution, the biocontrol agent is a suspension of Beauveria bassiana GC23620, with a concentration of 1.05×10 5 -1.05×10 8 Spores / mL.

[0014] According to the technical scheme of the above Beauveria bassiana strain, a method for controlling grassland caterpillars using the Beauveria bassiana strain will also be provided, comprising the following experimental steps:

[0015] Step 1: Collect grassland caterpillar larvae and isolate a strain with high pathogenicity to grassland caterpillar larvae from the surface of the grassland caterpillar larvae;

[0016] Step 2: Prepare Sabouraud dextrose agar yeast extract (SDAY) medium, 40 g glucose, 10 g peptone, 10 g yeast extract powder, 20 g agar, 1000 mL distilled water, autoclave at 121 °C for 15 min, cool and pour into plates for later use;

[0017] Step 3: sterilize the equipment by high-pressure sterilizing the inoculation vessels and utensils at a temperature of 121°C for 30 minutes;

[0018] Step 4: Isolation and purification of strains: Use SDAY medium, gently dip the mature conidia powder on the diseased insect body under sterile conditions, and use the point-grafting method to inoculate the conidia in the center of the medium (90mm). Invert it and culture it at (25±1)℃ and light conditions of L:D=16:8. When the target colony grows hyphae, pick a small amount of hyphae for re-isolation. After purification, use the plate streak method for inoculation and culture, and finally store it at 4℃.

[0019] Step 5: Preparation of bacterial suspension: After the GC23620 strain has fully produced conidia on the SDAY medium, the mature spore powder on the surface of the medium was gently scraped into a 50 mL triangular flask containing 0.05% Tween-80 sterile water, and vortexed for 10 min to disperse the conidia evenly. Then, the number of conidia per milliliter was determined using a hemocytometer under a microscope, and finally 1.05×10 8 spores / mL spore suspension, and then diluted to 1.05×10 7 Spores / mL, 1.05×10 6 Spores / mL, 1.05×10 5 Spores / mL, stored at 4°C for later use;

[0020] Step 6. The bacterial suspension inoculation method includes: (1) using the insect immersion method for inoculation, selecting larvae of the same age with the same individual size and vitality, carefully picking them up with tweezers and placing them in spore suspensions of different concentrations, soaking them for 15 seconds, picking them out, placing them on sterile filter paper to absorb excess water on the surface of the insect body, and then placing the inoculated larvae in an insect breeding box (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm), and then feeding them with fresh Chinese fescue; (2) leaf immersion method for inoculation, cutting fresh Chinese fescue forage into small sections with a length of 9.0 cm, the cut ends should be smooth and neat, and the bottom should be wrapped with wet absorbent cotton to prevent the forage from withering, and the forage sections are respectively immersed in the above-mentioned spore suspensions of different concentrations. After soaking for 10 seconds, take them out to drain excess water, and then place them in an insect breeding box (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm).

[0021] Specifically, the above two inoculation methods both use sterile water containing 0.05% Tween-80 as a blank control (CK), 15 test larvae for each concentration, and each treatment is repeated 3 times. They are uniformly cultured at 25°C and light conditions of L:D=16:8. They are observed once a day for 8 consecutive days, and the number of deaths of the test insects is recorded every day. The dead insects are placed in a culture dish (90 mm) with a moist filter paper on the bottom for moisturizing culture, and the cause of death of the insects is determined based on whether the insects grow hyphae and the hyphae morphology.

[0022] In summary, the present invention mainly has the following beneficial effects:

[0023] The present application overcomes the defects and technical deficiencies of existing grassland caterpillar control methods, and provides a biological control strain of Beauveria bassiana with high pathogenicity to grassland caterpillars. The fungus is an insect pathogenic fungus and can be used as a living biological pesticide with high pathogenicity to grassland caterpillars for controlling grassland caterpillars.

[0024] The present application screened and obtained a Beauveria bassiana strain GC23620 with high pathogenicity to grassland caterpillars. Infection biology and indoor bioassays showed that the strain had a strong infection and insecticidal effect on grassland caterpillars, providing new means and methods for the biological control of grassland caterpillars. Moreover, the strain is an insect pathogenic fungus and can be used as a living biological pesticide. During the application process, it is pollution-free, free of pesticide residues, biologically environmentally friendly, green and healthy, and has good application prospects in the biological control of grassland caterpillars. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The colony morphology and conidia morphology of the strain GC23620 of the present invention on the SDAY plate;

[0026] Figure 2The phylogenetic tree of the strain GC23620 of the present invention based on the 16SrDNA sequence ITS1 / ITS4;

[0027] Figure 3 This is a morphological diagram of the larvae of grassland caterpillars infected by the strain GC23620 of the present invention;

[0028] Figure 4 The trend of the cumulative corrected mortality of grassland caterpillar larvae under the treatment of different concentrations of GC23620 bacteria of the present invention over time;

[0029] Figure 5 It is a flow chart of the present invention. DETAILED DESCRIPTION

[0030] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and cannot be understood as limiting the present invention.

[0031] The following describes an embodiment of the present invention based on its overall structure. Example

[0032] See attached Figures 1 - 5 , a strain of Beauveria bassiana, classified as Beauveria bassiana ( Beauveria bassiana ) strain GC23620, deposited as Beauveria bassiana Beauveria bassiana , deposited in the General Microbiology Center of China Microbiological Culture Collection Administration Committee, the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the deposit date is January 29, 2024, the strain deposit number is CGMCC: NO.41056; the colony of the Beauveria bassiana GC23620 strain is white and short-wool in the early stage of growth, and white conidia begin to appear in the center of the colony after 3 days. With the extension of the culture time, the conidia appear in a ring-shaped accumulation and spread to the surrounding areas. The hyphae of the strain are branched and septate, with a smooth and colorless surface and a width (2.45±0. 05) µm; the conidiophores are attached to the vegetative hyphae, and the top axis produces spores to form a spike-shaped spore-producing structure. The conidia are spherical, transparent, and smooth, with an average diameter of about (3.43±0.18) µm; the use of the Beauveria bassiana in producing mycelium comprises the steps of contacting the live bacteria of Beauveria bassiana GC23620 or a culture containing the live bacteria of Beauveria bassiana GC23620 with the body of a grassland caterpillar; the culture containing the live bacteria of Beauveria bassiana GC23620 is a bacterial suspension of Beauveria bassiana GC23620, and the concentration is 1.05×10 5 -1.05×10 8spores / mL; the grassland caterpillars are grassland caterpillar larvae. A biological control preparation for controlling grassland caterpillar larvae, the active ingredient of which is the above-mentioned Beauveria bassiana ( Beauveria bassiana ) strain GC23620; the biocontrol agent is a bacterial suspension of Beauveria bassiana GC23620, with a concentration of 1.05×10 5 -1.05×10 8 Spores / mL.

[0033] It should be noted that the morphological characteristics of the GC23620 strain are as follows:

[0034] The GC23620 strain was grown on SDAY medium. The colony was white and fluffy at the beginning. After 3 days, white conidia began to appear in the center of the colony. As the culture time increased, the conidia appeared in a ring-shaped pile and spread to the surrounding areas. The hyphae of the strain were branched and septate, with a smooth and colorless surface and a width of (2.45±0.05)µm. The conidiophores were attached to the vegetative hyphae, and the top spores were axial, forming a spike-like conidial structure. The conidia were spherical, transparent, and smooth, with an average diameter of about (3.43±0.18)µm.

[0035] Molecular identification of strain GC23620:

[0036] By amplifying the 16SrDNA sequence TS1 / TS5 of the genomic DNA of the strain GC23620, and then using GENBANK to sequence the results and perform blast homology comparison analysis, it was found that the sequence of the strain GC23620 was consistent with the sequence of Beauveria bassiana in the database. Beauveria bassiana strain BebaHA20C03 (sequence number OM373016.1) has a similarity of 98.90%. Based on phylogenetic analysis, it can be seen that the strain is clustered with other Beauveria bassiana in the database with a higher bootstrap value, indicating that the strain has a high homology with Beauveria bassiana. Combining the morphological characteristics of the strain, the similarity of the ITS sequence with that in the database, and the homology comparison results based on the ITS sequence, it is determined that the GC23620 strain belongs to Beauveria bassiana ( Beauveria bassiana )GC23620.

[0037] Therefore, the first object of the present application is to provide a strain of Beauveria bassiana GC23620, whose deposit number is: CGMCCNO.:41056.

[0038] The present application also provides the use of Beauveria bassiana GC23620 in preventing and controlling grassland caterpillars;

[0039] The application comprises the steps of contacting the live bacteria of Beauveria bassiana GC23620 or the culture containing the live bacteria of Beauveria bassiana GC23620 with the bodies of grassland caterpillars;

[0040] The culture containing live bacteria of Beauveria bassiana GC23620 is a bacterial suspension of Beauveria bassiana GC23620, with a concentration of 1.05×10 5 -1.05×10 8 Spores / mL.

[0041] See also Figures 1 - 5 As shown, according to the above embodiments, a method for controlling grassland caterpillars using a Beauveria bassiana strain is also provided, comprising the following experimental steps:

[0042] Step 1: Collect grassland caterpillar larvae and isolate a strain with high pathogenicity to grassland caterpillar larvae from the surface of the grassland caterpillar larvae;

[0043] Step 2: Prepare Sabouraud dextrose agar yeast extract (SDAY) medium, 40 g glucose, 10 g peptone, 10 g yeast extract powder, 20 g agar, 1000 mL distilled water, autoclave at 121 °C for 15 min, cool and pour into plates for later use;

[0044] Step 3: sterilize the equipment by high-pressure sterilizing the inoculation vessels and utensils at a temperature of 121°C for 30 minutes;

[0045] Step 4: Isolation and purification of strains: Use SDAY medium, gently dip mature conidia powder from the diseased insect body under sterile conditions, and use the point-grafting method to inoculate the conidia in the center of the medium (90 mm), invert and culture at (25±1)℃ and light conditions of L:D=16:8. When the target colony grows hyphae, pick a small amount of hyphae for re-isolation. After purification, use the plate streak method for inoculation and culture, and finally store at 4℃;

[0046] Step 5: Preparation of bacterial suspension: After the GC23620 strain has fully produced conidia on the SDAY medium, the mature spore powder on the surface of the medium was gently scraped into a 50 mL triangular flask containing 0.05% Tween-80 sterile water, and vortexed for 10 min to disperse the conidia evenly. Then, the number of conidia per milliliter was determined using a hemocytometer under a microscope, and finally 1.05×10 8 spores / mL spore suspension, and then diluted to 1.05×10 7 Spores / mL, 1.05×10 6 Spores / mL, 1.05×10 5 Spores / mL, stored at 4°C for later use;

[0047] Step 6: The bacterial suspension inoculation method includes: (1) using the insect immersion method for inoculation, selecting larvae of the same age with the same size and vitality, carefully picking them up with tweezers and placing them in spore suspensions of different concentrations, soaking them for 15 seconds, picking them out, placing them on sterile filter paper to absorb excess moisture on the surface of the insect body, and then placing the inoculated larvae in an insect breeding box (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm), and then feeding them with fresh Chinese fescue; (2) leaf immersion method for inoculation, cutting fresh Chinese fescue forage into small sections with a length of 9.0 cm, the cut ends should be smooth and neat, and the bottom should be wrapped with water-containing absorbent cotton to prevent the forage from withering, and the forage sections are respectively immersed in the above-mentioned spore suspensions of different concentrations. The larvae were immersed in the suspension for 10 seconds, then taken out and drained of excess water, and then placed in an insect box (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm); the above two inoculation methods used sterile water containing 0.05% Tween-80 as a blank control (CK), 15 test larvae for each concentration, and each treatment was repeated 3 times. They were uniformly cultured at 25°C and light conditions of L:D=16:8. They were observed once a day for 8 consecutive days, and the number of deaths of the test insects was recorded every day. The dead insects were placed in a culture dish (90 mm) with a moist filter paper at the bottom for moisturizing culture, and the cause of death of the insects was determined based on whether the insects grew hyphae and the hyphae morphology.

[0048] Example 1

[0049] Isolation and identification of Beauveria bassiana GC23620

[0050] 1. Sources

[0051] (1) Sample: The inventors isolated a strain with high pathogenicity to the larvae of grassland caterpillars from the body surface of grassland caterpillars (see Figure 1 ), numbered GC23620.

[0052] (2) Sabouraud dextrose agar yeast extract (SDAY) medium: 40 g glucose, 10 g peptone, 10 g yeast extract powder, 20 g agar, 1000 mL distilled water, autoclave at 121°C for 15 min. After sterilization, cool and pour into plates for later use.

[0053] (3) Aseptic operation conditions: All inoculation vessels and utensils must also be sterilized under high pressure (121°C, 30 min), and inoculation and other operations must be performed in an ultra-clean workbench.

[0054] (4) Isolation and purification of strains: Use SDAY medium, gently dip mature conidia powder from the diseased insect body under sterile conditions, and use the point-grafting method to inoculate the conidia in the center of the medium (90 mm), invert and culture at (25±1)℃ and light conditions of L:D=16:8. When the target colony grows hyphae, pick a small amount of hyphae for re-isolation. After purification, use the plate streak method for inoculation and culture, and finally store at 4℃.

[0055] It should be noted that Figure 1 In the figure, Figure A shows the colony morphology of strain GC23620 on the front of the plate, Figure B shows the colony morphology of strain GC23620 on the back of the plate, Figure C shows the morphology of mycelium of strain GC23620 under an optical microscope, and Figure D shows the morphology of conidia of strain GC23620 under an optical microscope;

[0056] Morphological identification of strain GC23620

[0057] According to the book "Insect Mycology" edited by Pu Zhelong and Li Zengzhi, the morphological characteristics of the GC23620 strain were clarified. On the SDAY medium, the colony of the GC23620 strain was white and short-haired at the beginning of growth. After 3 days, white conidia began to appear in the center of the colony. The edge of the colony was relatively flat, and the hyphae grew radially in all directions. As the culture time increased, the colony gradually expanded, and the conidia appeared in a ring-shaped pile and spread out in all directions, with dispersed hyphae around.

[0058] Optical microscopic examination revealed that the hyphae of GC23620 strain were branched, septate, smooth and colorless, and (2.45±0.05)µm wide. The conidiophores were attached to the vegetative hyphae, and the apex was axially conidial, forming a spike-like conidial structure. The conidia were spherical, transparent, and smooth, with an average diameter of about (3.43±0.18)µm.

[0059] 16S rDNA sequence ITS1 / ITS4 of strain GC23620

[0060] A small amount of single colony was scraped with a sterile pipette tip, and the genomic DNA of strain GC23620 was extracted using a fungal kit. The fungal universal primers ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′ were used to amplify its rDNA-ITS sequence. The PCR amplification reaction system was 25µL, containing 12.5µL 2×Tap PCRmix, 1µL ITS1, 1µL ITS4, 1µL template DNA, and 9.5µL ddH2O. PCR amplification conditions: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 1min, a total of 30 cycles, 72℃ total extension for 5min; stored at 4℃. The PCR product was detected by 1.0% agarose gel electrophoresis, and the collected samples were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0061] According to the sequencing results, the bases with poor quality at both ends of the obtained sequence were removed, and the optimized sequence was submitted to NCBI (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Blast was used to find the most similar typical strains and download the corresponding sequences. The phylogenetic tree was constructed using the neighbor-joining method based on the pairwise distance matrix and the Kimura two-parameter nucleotide substitution model using MEGA 11 software. The bootstrap value analysis was repeated 1000 times to evaluate the stability of the topological structure of the phylogenetic tree.

[0062] The rDNA-ITS sequence fragment of the isolated strain was amplified by PCR, and the sequencing results showed that the amplified fragment was 545bp. After removing the low-quality sequences at both ends, blast homology comparison was performed in the GENBANK database. The results showed that the sequence of the strain was consistent with the sequence number OM373016.1 of Beauveria bassiana in the database. Beauveria bassiana strain BebaHA20C03 reached 98.90%. Relevant sequences were selected and a phylogenetic tree was constructed using MEGA 11 (see Appendix Figure 2 ), it can be seen that the strain is clustered with other Beauveria bassiana in the database with a higher bootstrap value, indicating that the strain has a high homology with Beauveria bassiana. Combining the strain morphological characteristics and the similarity of the ITS sequence with the database and the homology analysis based on the ITS sequence, the strain GC23620 was finally identified as Beauveria bassiana Beauveria bassiana , No. GC23620, and the strain was deposited in the Institute of Plant Protection, Qinghai Academy of Agricultural and Forestry Sciences on June 25, 2023, with the deposit number: CGMCC NO.: 41056.

[0063] It should be noted that Figure 2 The brackets in the figure are the numbers of the corresponding strains in the Genbank database.

[0064] Table 1 shows the information of the strains used to construct the phylogenetic tree, including the strain species name, number in the Genbank database, collection location, 16SrDNA sequence ITS1 / ITS4 sequence size and similarity analysis with the GC23620 strain.

[0065] Table 1 Information of strains used to construct phylogenetic tree

[0066] Example 2

[0067] Indoor Pathogenicity Determination of GC23620 Strain to Grassland Caterpillars Using Insect Dipping Method

[0068] Bioassay is one of the effective means to detect the lethality and lethality rate of insect pathogenic fungi to target pests, and can provide an important reference for the comprehensive evaluation of the biological control potential of the strain. In this study, the pathogenicity of Beauveria bassiana GC23620 strain to the fourth instar larvae of grassland caterpillars was determined in order to screen out its optimal concentration for the lethality of grassland caterpillar larvae.

[0069] Treatment of test strains

[0070] The purified Beauveria bassiana GC23620 strain was cultured on SDAY plates at a temperature of (25±1)°C and a light condition of L:D=16:8 until sufficient spores were produced. The mature spore powder on the surface of the culture medium was gently scraped into a 50 mL triangular flask containing 0.05% Tween-80 sterile water. The conidia were completely dispersed and evenly stirred with a magnetic stirrer for 30 min. The mycelium was then filtered out with two layers of medical gauze to obtain a conidia suspension. The number of spores per milliliter was then determined using a hemocytometer under a microscope, and finally 1.05×10 8 spores / mL spore suspension, and then diluted to 1.05×10 7 Spores / mL, 1.05×10 6 Spores / mL, 1.05×10 5 Three concentrations of spores / mL were prepared for later use.

[0071] Inoculation was carried out by the insect immersion method: 4th-instar larvae of uniform size and vitality were selected, and the test larvae were carefully picked up with tweezers and placed in the above-mentioned spore suspension of different concentrations. After soaking for 15 seconds, they were picked out and placed on sterile filter paper to absorb the excess water on the surface of the insect body. Then the inoculated larvae were placed in an insect box (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm), and then fresh Chinese fescue was provided for them to eat. Then the insect box was uniformly placed at 25°C and light L: D = 16: 8 for culture. Sterile water containing 0.05% Tween-80 was used as a blank control (CK). 15 larvae were treated with each concentration and repeated 3 times. Observation was performed once a day for 8 consecutive days, and the number of deaths of the test insects was recorded every day. The dead insects were placed in a culture dish (90 mm) with a moist filter paper on the bottom for moisturizing culture. The cause of death of the insect body was determined based on whether the insect body grew hyphae and the hyphae morphology.

[0072] Cumulative corrected mortality of GC23620 strain against fourth-instar larvae of grassland caterpillars

[0073] After inoculation with bacterial suspensions of different spore concentrations, the larvae of grassland caterpillars began to die as early as the first day, with 1.05×10 8 -1.05×10 5 The mortality rates of the spores were (17.78±3.14)%, (11.11±3.14)%, (8.89±3.14)% and (6.67±0.00)% respectively. Subsequently, the mortality rates increased with time. When the spore concentration was 1.05×10 8 spores / mL, the cumulative corrected mortality rate on the 8th day was (84.85±4.29)%; using 1.05×10 7 , 1.05×10 6 and 1.05×10 5 The mortality rates on the 8th day after inoculation with the concentration of spores / mL were (81.82±7.42)%, (69.70±4.29)% and (42.42±8.57)%, respectively.

[0074] It should be noted that Figure 3 Figure A is a morphological picture of the larvae of grassland caterpillars infected by strain GC23620 for 2 days, Figure B is a morphological picture of the larvae of grassland caterpillars infected by strain GC23620 for 6 days, Figure C is a morphological picture of the larvae of grassland caterpillars infected by strain GC23620 for 8 days, and Figure D is a morphological picture of the larvae of grassland caterpillars infected by strain GC23620 for 10 days.

[0075] Table 2 Cumulative corrected mortality of grassland caterpillar larvae at different concentrations after inoculation by insect immersion method

[0076] Dosage effect of GC23620 strain on infection and pathogenicity of the fourth instar larvae of Caterpillar moth

[0077] According to 1.05×10 8 -1.05×10 5 The linear regression equation was fitted to the treatment results of bacterial suspension with a concentration of spores / mL on grassland caterpillar larvae, and the dose effect of GC23620 strain infecting larvae at different time periods was estimated. The results showed that as the number of inoculation days increased, the lethal dose of GC23620 strain on grassland caterpillar larvae gradually decreased, indicating that the dose effect increased with the extension of time. After 3-8 days of inoculation, LD 50 From 1.74×10 9 Spores / mL dropped to 1.34×10 4 Spores / mL.

[0078] Table 3 The median lethal concentration of grassland caterpillar larvae after treatment with GC23620 strain for different days

[0079] Time effect of GC23620 strain on infection and pathogenicity of the fourth instar larvae of Caterpillar moth

[0080] The lethal time of GC23620 strain to prairie caterpillar larvae decreased with the increase of inoculation concentration. 8 , 1.05×10 7 , 1.05×10 6 and 1.05×10 5 When the larvae are treated with a spore suspension of spores / mL, LT 50 The values ​​are 3.15, 3.90, 4.48 and 7.73d respectively.

[0081] It should be noted that Figure 4 Figure A shows the cumulative corrected mortality of grassland caterpillar larvae treated with different concentrations of GC23620 bacteria using the insect immersion method, and Figure B shows the cumulative corrected mortality of grassland caterpillar larvae treated with different concentrations of GC23620 bacteria using the leaf immersion method.

[0082] Table 4 The median lethal time of grassland caterpillar larvae after treatment with different concentrations of GC23620 strain

[0083] Example 3

[0084] Indoor pathogenicity test of GC23620 strain against grassland caterpillars by leaf dipping method

[0085] Inoculation by leaf dipping method: Cut fresh Chinese fescue forage grass into small sections with a length of 9.0 cm, the cut ends should be smooth and neat, and the bottom should be wrapped with water-containing absorbent cotton to prevent the forage grass from withering. Soak the forage grass sections in the above-mentioned spore suspensions of different concentrations respectively, soak for 10 seconds, take out and drain excess water, and then place them in insect boxes (length × width × height = 17.0 cm × 11.5 cm × 7.0 cm), put 15 4th-instar larvae of the same size and vitality in each box, and repeat each treatment 3 times. Sterile water containing 0.05% Tween-80 is used as a blank control (CK). The insect box is placed under the same environmental conditions as in Example 2 for breeding, and the number of dead larvae is checked and recorded regularly every day, and the dead insects are preserved and the cause of death is determined in the same way.

[0086] Cumulative corrected mortality of GC23620 strain against fourth-instar larvae of grassland caterpillars

[0087] The cumulative corrected mortality of larvae in the presence of different concentrations of GC23620 spores increased with the extension of inoculation time. Larvae began to die as early as the first day, with a mortality rate of 1.05×10 8 -1.05×10 5 Under the conditions of spore concentration of 1.05×10 8 spores / mL, the mortality rate on the 4th day could reach (100.00±0.00)%; 1.05×10 7 and 1.05×10 6 The mortality rate reached (100.00±0.00)% on the 6th and 8th days respectively at 1.05×10 5 After inoculation with bacterial solution containing spores / mL, the mortality rate of caterpillars was (72.73±12.86)% on the 8th day.

[0088] Table 5 Cumulative corrected mortality of grassland caterpillar larvae at different concentrations after leaf dipping inoculation

[0089] Dosage effect of GC23620 strain on infection and pathogenicity of the fourth instar larvae of Caterpillar moth

[0090] The linear regression equation was fitted based on the treatment results of different concentrations of bacterial suspension on grassland caterpillar larvae, and the dose effect was estimated. The results showed that as the number of inoculation days increased, the lethal dose required for grassland caterpillar larvae after GC23620 strain inoculated by leaf dipping method decreased with the extension of inoculation time, indicating that the dose effect gradually increased. After 3-8 days of inoculation, LD 50 From 6.51×105 Spores / mL decreased to 2.02×10 3 Spores / mL.

[0091] Table 6 The median lethal concentration of grassland caterpillar larvae after treatment with GC23620 strain for different days

[0092] Time effect of GC23620 strain on infection and pathogenicity of the fourth instar larvae of Caterpillar moth

[0093] When the spore concentration increased from 1.05×10 8 Spores / mL decreased to 1.05×10 5 Spores / mL, its LT 50 Increased from 1.00d to 4.04d.

[0094] Table 7 The median lethal time of grassland caterpillar larvae after treatment with different concentrations of GC23620 strain

[0095] SIPO Sequence Listing 1.0 545

[0097] DNA

[0098] Beauveria bassiana GC23620 ( Beauveria bassiana GC23620) sequence:

[0099] GGGGGCTTACGACTTCACTCCCTACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGA ATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACG CACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGC GGCGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA

[0100] The specific process of the present invention is as follows:

[0101] 1. For strain isolation and culture, select SDAY medium, gently dip mature conidia powder from the diseased insect body under sterile conditions, and use the point-grafting method to inoculate the conidia in the center of the culture medium (90mm), invert and culture at (25±1)℃ and light conditions of L:D=16:8. When the target colony grows hyphae, pick a small amount of hyphae for re-isolation, and after purification, use the plate streak method for inoculation and culture, and finally store at 4℃;

[0102] 2. Preparation of bacterial suspension: After the GC23620 strain has fully produced conidia on the SDAY medium, gently scrape the mature spore powder on the surface of the medium into a 50 mL triangular flask containing 0.05% Tween-80 sterile water, vortex and oscillate for 10 minutes to disperse the conidia evenly, and then use a hemocytometer to measure the number of conidia per milliliter under a microscope. Finally, prepare 1.05×10 8 spores / mL spore suspension, and then diluted to 1.05×10 7 Spores / mL, 1.05×106 Spores / mL, 1.05×10 5 Spores / mL, stored at 4°C for later use;

[0103] 3. The inoculation method of bacterial suspension includes: (1) Inoculation by insect immersion method, select larvae of the same age with the same size and vitality, carefully pick them up with tweezers and put them into spore suspension of different concentrations, soak them for 15 seconds, pick them out, place them on sterile filter paper to absorb excess water on the surface of the insect body, and then put the inoculated larvae into an insect box (length × width × height = 17.0cm × 11.5cm × 7.0cm), and then feed them with fresh Chinese fescue. (2) Inoculation by leaf immersion method, cut fresh Chinese fescue forage into small sections with a length of 9.0cm, the cut ends should be smooth and neat, and the bottom should be wrapped with wet absorbent cotton to prevent the forage from withering. Soak the forage sections in the above-mentioned spore suspension of different concentrations, soak them for 10 seconds, take them out and drain excess water, and then place them in an insect box (length × width × height = 17.0cm × 11.5cm × 7.0cm).

[0104] For both inoculation methods, sterile water containing 0.05% Tween-80 was used as a blank control (CK). Fifteen larvae were tested at each concentration, and each treatment was repeated three times. They were uniformly cultured at 25°C and a light condition of L:D=16:8. The larvae were observed once a day for 8 consecutive days. The number of deaths of the test larvae was recorded every day, and the dead larvae were placed in a culture dish (90 mm) with moist filter paper on the bottom to keep them moist. The cause of death of the larvae was determined based on whether the larvae grew hyphae and the hyphae morphology.

[0105] The working principle of the present invention is:

[0106] The larvae of grassland caterpillars were collected, and a strain with high pathogenicity to the larvae of grassland caterpillars was isolated from the body surface of the larvae of grassland caterpillars;

[0107] Prepare Sabouraud dextrose agar yeast extract (SDAY) medium, glucose 40g, peptone 10g, yeast extract powder 10g, agar 20g, distilled water 1000mL, autoclave at 121℃ for 15min, cool and pour into plates for later use; autoclave inoculation vessels and utensils at 121℃ for 30min; select SDAY medium, gently dip mature conidia powder from the diseased insect body under sterile conditions, and use the point grafting method to graft the conidia to the center of the medium (90mm), and place it upside down at (25±1)℃, The cells were cultured under the illumination condition of L:D=16:8. When the target colony grew hyphae, a small amount of hyphae was picked for re-isolation. After purification, the cells were inoculated and cultured by the plate streak method, and finally stored at 4°C. After the GC23620 strain fully produced spores on the SDAY medium, the mature spore powder on the surface of the medium was gently scraped into a 50 mL triangular flask containing 0.05% Tween-80 sterile water, and vortexed for 10 min to disperse the conidia evenly. Then, the number of spores per milliliter was determined using a hemocytometer under a microscope, and finally 1.05×10 8 spores / mL spore suspension, and then diluted to 1.05×10 7 Spores / mL, 1.05×10 6 Spores / mL, 1.05×10 5 Spores / mL, stored at 4℃ for future use; (1) Inoculation by insect immersion method, select larvae of the same age with the same size and vitality, carefully pick them up with tweezers and put them into spore suspension of different concentrations, soak for 15 seconds, pick them out, put them on sterile filter paper to absorb excess water on the surface of the insect body, and then put the inoculated larvae into an insect box (length × width × height = 17.0cm × 11.5cm × 7.0cm), and then feed them with fresh Chinese fescue. (2) Inoculation by leaf immersion method, cut fresh Chinese fescue forage into small sections with a length of 9.0cm, the cut should be smooth and neat, and the bottom should be wrapped with wet absorbent cotton to prevent the forage from withering. Soak the forage sections in the above spore suspension of different concentrations, soak for 10 seconds, take them out and drain excess water, and then place them in an insect box (length × width × height = 17.0 cm × 11.5cm × 7.0cm).

[0108] For both inoculation methods, sterile water containing 0.05% Tween-80 was used as a blank control (CK). Fifteen larvae were tested at each concentration, and each treatment was repeated three times. They were uniformly cultured at 25°C and a light condition of L:D=16:8. The larvae were observed once a day for 8 consecutive days. The number of deaths of the test larvae was recorded every day, and the dead larvae were placed in a culture dish (90 mm) with moist filter paper on the bottom to keep them moist. The cause of death of the larvae was determined based on whether the larvae grew hyphae and the hyphae morphology.

[0109] Although an embodiment of the present invention has been shown and described, this specific embodiment is merely an explanation of the present invention and is not a limitation of the invention. The specific features, structures, materials or characteristics described may be combined in a suitable manner in any one or more embodiments or examples. After reading this specification, those skilled in the art may make modifications, substitutions and variations to the embodiments without creative contributions as needed without departing from the principles and purpose of the present invention. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A Beauveria bassiana strain, characterized in that Beauveria bassiana Beauveria bassiana , the deposited name is Beauveria bassiana ( Beauveria bassiana ) strain GC23620, deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the address of the deposit unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the deposit date is January 29, 2024, the strain deposit number is: CGMCC: NO.41056.

2. A biological control agent for controlling grassland caterpillar larvae, characterized in that: The spores of the Beauveria bassiana strain GC23620 according to claim 1 are used as an effective ingredient.

3. The biocontrol agent according to claim 2, characterized in that The spore concentration was 1.05×10 5 -1.05×10 8 Spores / mL.

4. The use of a Beauveria bassiana strain according to claim 1 or a biocontrol agent according to any one of claims 2 to 3, characterized in that: The application is to control grassland caterpillar larvae.

5. A method for controlling grassland caterpillars, characterized in that: Utilize the strain in claim 1 and the biocontrol agent in any one of claims 2-3.

Images